BIOSApplyStatisticsFilter 2017.05.28 02:00:21 Execution time: 17 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSApplyStatisticsFilter.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

filtered_statistics

Format

Show or HideShow perl code used to test filtered_statistics format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSApplyStatisticsFilter/test/BIOSApplyStatisticsFilter.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSApplyStatisticsFilter/test/BIOSApplyStatisticsFilter.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test filtered_statistics content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSApplyStatisticsFilter/test/BIOSApplyStatisticsFilter.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSApplyStatisticsFilter/test/BIOSApplyStatisticsFilter.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for filtered_statistics

<?xml version="1.0" encoding="iso-8859-1"?>
<entry_db>
  <entry accession="#Tax1E4D3Z3Y02IRQDG" confidence="" id="3350" length="" locus_tag="" type="" version="" xmlfile="">
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="#Tax1E4D3Z3Y02IRQDG">
      <feature date="" entry_file="" id="" path="" type=""/>
      <pattern definition="Herbert2008" type="test">
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="4"/>
        <property id="f_zero" value="0.00328137817883511"/>
        <property id="f_one" value="0"/>
        <property id="f_two" value="0.0344827586206897"/>
        <property id="up" value="UP2"/>
        <property id="rstat" value="9.40878375349963"/>
        <property id="chisprob" value="1.438400E-05"/>
        <property id="rank" value="6"/>
        <property id="adjustp" value="2.229520E-04"/>
        <property id="qvalue" value="1.029009E-04"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="#Tax1E4D3Z3Y02JC6AH" confidence="" id="1350" length="" locus_tag="" type="" version="" xmlfile="">
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="#Tax1E4D3Z3Y02JC6AH">
      <feature date="" entry_file="" id="" path="" type=""/>
      <pattern definition="Herbert2008" type="test">
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="4"/>
        <property id="f_zero" value="0.00328137817883511"/>
        <property id="f_one" value="0"/>
        <property id="f_two" value="0.0344827586206897"/>
        <property id="up" value="UP2"/>
        <property id="rstat" value="9.40878375349963"/>
        <property id="chisprob" value="1.438400E-05"/>
        <property id="rank" value="7"/>
        <property id="adjustp" value="1.911017E-04"/>
        <property id="qvalue" value="1.029009E-04"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="#Tax1E4D3Z3Y02HLIFX" confidence="" id="1834" length="" locus_tag="" type="" version="" xmlfile="">
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="#Tax1E4D3Z3Y02HLIFX">
      <feature date="" entry_file="" id="" path="" type=""/>
      <pattern definition="Herbert2008" type="test">
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="4"/>
        <property id="f_zero" value="0.00328137817883511"/>
        <property id="f_one" value="0"/>
        <property id="f_two" value="0.0344827586206897"/>
        <property id="up" value="UP2"/>
        <property id="rstat" value="9.40878375349963"/>
        <property id="chisprob" value="1.438400E-05"/>
        <property id="rank" value="8"/>
        <property id="adjustp" value="1.672140E-04"/>
        <property id="qvalue" value="1.029009E-04"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="#Tax1E4D3Z3Y02JDCX9" confidence="" id="1256" length="" locus_tag="" type="" version="" xmlfile="">
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="#Tax1E4D3Z3Y02JDCX9">
      <feature date="" entry_file="" id="" path="" type=""/>
      <pattern definition="Herbert2008" type="test">
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="4"/>
        <property id="f_zero" value="0.00328137817883511"/>
        <property id="f_one" value="0"/>
        <property id="f_two" value="0.0344827586206897"/>
        <property id="up" value="UP2"/>
        <property id="rstat" value="9.40878375349963"/>
        <property id="chisprob" value="1.438400E-05"/>
        <property id="rank" value="9"/>
        <property id="adjustp" value="1.486347E-04"/>
        <property id="qvalue" value="1.029009E-04"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="#Tax1E4D3Z3Y02HBI1F" confidence="" id="1213" length="" locus_tag="" type="" version="" xmlfile="">
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="#Tax1E4D3Z3Y02HBI1F">
      <feature date="" entry_file="" id="" path="" type=""/>
      <pattern definition="Herbert2008" type="test">
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="8"/>
        <property id="f_zero" value="0.00656275635767022"/>
        <property id="f_one" value="0"/>
        <property id="f_two" value="0.0689655172413793"/>
        <property id="up" value="UP2"/>
        <property id="rstat" value="18.8175675069993"/>
        <property id="chisprob" value="8.529400E-10"/>
        <property id="rank" value="3"/>
        <property id="adjustp" value="2.644114E-08"/>
        <property id="qvalue" value="2.644114E-08"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="Taj1E4D3Z3Y02HPNK8#" confidence="" id="315" length="" locus_tag="" type="" version="" xmlfile="">
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="Taj1E4D3Z3Y02HPNK8#">
      <feature date="" entry_file="" id="" path="" type=""/>
      <pattern definition="Herbert2008" type="test">
        <property id="pool1_count" value="541"/>
        <property id="pool2_count" value="0"/>
        <property id="f_zero" value="0.443806398687449"/>
        <property id="f_one" value="0.490480507706256"/>
        <property id="f_two" value="0"/>
        <property id="up" value="UP1"/>
        <property id="rstat" value="54.0984366332231"/>
        <property id="chisprob" value="2.433600E-25"/>
        <property id="rank" value="1"/>
        <property id="adjustp" value="2.263248E-23"/>
        <property id="qvalue" value="2.263248E-23"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="#Tax1E4D3Z3Y02HXCBU" confidence="" id="2083" length="" locus_tag="" type="" version="" xmlfile="">
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="#Tax1E4D3Z3Y02HXCBU">
      <feature date="" entry_file="" id="" path="" type=""/>
      <pattern definition="Herbert2008" type="test">
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="5"/>
        <property id="f_zero" value="0.00410172272354389"/>
        <property id="f_one" value="0"/>
        <property id="f_two" value="0.0431034482758621"/>
        <property id="up" value="UP2"/>
        <property id="rstat" value="11.7609796918745"/>
        <property id="chisprob" value="1.235000E-06"/>
        <property id="rank" value="4"/>
        <property id="adjustp" value="2.871375E-05"/>
        <property id="qvalue" value="2.297100E-05"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="#Tax1E4D3Z3Y02GVZ9F" confidence="" id="2221" length="" locus_tag="" type="" version="" xmlfile="">
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="#Tax1E4D3Z3Y02GVZ9F">
      <feature date="" entry_file="" id="" path="" type=""/>
      <pattern definition="Herbert2008" type="test">
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="5"/>
        <property id="f_zero" value="0.00410172272354389"/>
        <property id="f_one" value="0"/>
        <property id="f_two" value="0.0431034482758621"/>
        <property id="up" value="UP2"/>
        <property id="rstat" value="11.7609796918745"/>
        <property id="chisprob" value="1.235000E-06"/>
        <property id="rank" value="5"/>
        <property id="adjustp" value="2.297100E-05"/>
        <property id="qvalue" value="2.297100E-05"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="#Tax1E4D3Z3Y02HVTD1" confidence="" id="1673" length="" locus_tag="" type="" version="" xmlfile="">
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="#Tax1E4D3Z3Y02HVTD1">
      <feature date="" entry_file="" id="" path="" type=""/>
      <pattern definition="Herbert2008" type="test">
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="11"/>
        <property id="f_zero" value="0.00902378999179656"/>
        <property id="f_one" value="0"/>
        <property id="f_two" value="0.0948275862068965"/>
        <property id="up" value="UP2"/>
        <property id="rstat" value="25.874155322124"/>
        <property id="chisprob" value="6.309100E-13"/>
        <property id="rank" value="2"/>
        <property id="adjustp" value="2.933731E-11"/>
        <property id="qvalue" value="2.933731E-11"/>
      </pattern>
    </entry_features>
  </entry>
</entry_db>
BIOSGetAssemblyVersions 2017.05.28 02:00:23 Execution time: 1 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetAssemblyVersions.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

assembly_versions

Format

Show or HideShow perl code used to test assembly_versions format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetAssemblyVersions/test/BIOSGetAssemblyVersions.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetAssemblyVersions/test/BIOSGetAssemblyVersions.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test assembly_versions content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetAssemblyVersions/test/BIOSGetAssemblyVersions.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetAssemblyVersions/test/BIOSGetAssemblyVersions.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for assembly_versions

#species	library_id	version	access
ROSCH	Rosa-BFL	20090808	public
ROSCH	Rosa-CYN	20090808	public
ROSCH	Rosa-DBO	20090808	public
ROSCH	Rosa-DET	20090808	public
ROSCH	Rosa-FTB	20090808	public
ROSCH	Rosa-FTN	20090808	public
ROSCH	Rosa-FTS	20090808	public
ROSCH	Rosa-IFL	20090808	public
ROSCH	Rosa-IMO	20090808	public
ROSCH	Rosa-NDB	20090808	public
ROSCH	Rosa-OB-1	20090808	adubois,carrere,gouzy,mlmartin,mohammed,oraymond
ROSCH	Rosa-OB-2	20090808	adubois,carrere,gouzy,mlmartin,mohammed,oraymond
ROSCH	Rosa-OB-3	20090808	adubois,carrere,gouzy,mlmartin,mohammed,oraymond
ROSCH	Rosa-OFT	20090808	public
ROSCH	Rosa-RAC	20090808	public
ROSCH	Rosa-SEN	20090808	public
ROSCH	Rosa-T49-1	20090808	adubois,carrere,gouzy,mlmartin,mohammed,oraymond
ROSCH	Rosa-T49-2	20090808	adubois,carrere,gouzy,mlmartin,mohammed,oraymond
ROSCH	Rosa-T49-3	20090808	adubois,carrere,gouzy,mlmartin,mohammed,oraymond
BRADI	BRADI-callus	20100527	public
BRADI	BRADI-devspike	20100527	public
BRADI	BRADI-leaf	20100527	public
BRADI	BRADI-mRNA	20100527	public
BRADI	BRADI-root	20100527	public
BRADI	BRADI-stemsheath	20100527	public
ALOMY	ALOMY-CY46H-R00h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R02h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R06h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R12h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R24h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R36h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S00h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S02h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S06h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S12h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S24h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S36h	20110816	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
RALSO	Rs-GMI1000-MM-R1	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-R1A	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-R1B	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-R2	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-R2A	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-R2B	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-R3	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-R3A	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-R3B	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-S1	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-S2	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-MM-S3	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-PHi-R1	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-PHi-R2	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1000-PHi-R3	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1525-MM-R1	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1525-MM-R2	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1525-MM-R3	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1755-MM-R1	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1755-MM-R2	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GMI1755-MM-R3	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS553-MM-R1A	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS553-MM-R1B	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS554-MM-R1A	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS554-MM-R1B	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS555-MM-R1A	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS555-MM-R1B	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS573-MM-R1A	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS573-MM-R1B	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS704-MM-R1A	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS704-MM-R1B	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS704-MM-R2A	20110902	aguidot,carrere,peeters,sgenin
RALSO	Rs-GRS704-MM-R2B	20110902	aguidot,carrere,peeters,sgenin
HELAN	INEDI_Leaves_Plant_FTSW0	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	INEDI_Leaves_Plant_FTSW0.1	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	INEDI_Leaves_Plant_FTSW0.25	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	INEDI_Leaves_Plant_FTSW0.4	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	INEDI_Leaves_Plant_FTSW0.55	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	INEDI_Leaves_Plant_FTSW0.7	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	PSC8_Leaves_Plant_FTSW0	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	PSC8_Leaves_Plant_FTSW0.1	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	PSC8_Leaves_Plant_FTSW0.25	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	PSC8_Leaves_Plant_FTSW0.4	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	PSC8_Leaves_Plant_FTSW0.55	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	PSC8_Leaves_Plant_FTSW0.7	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	XRQ_Bract_Plant	20120203	public
HELAN	XRQ_Corolla_Plant	20120203	public
HELAN	XRQ_Leaves_Plantlet_Auxin	20120203	public
HELAN	XRQ_Leaves_Plantlet_Brassino	20120203	public
HELAN	XRQ_Leaves_Plant_FTSW0	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	XRQ_Leaves_Plant_FTSW0.1	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	XRQ_Leaves_Plant_FTSW0.25	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	XRQ_Leaves_Plant_FTSW0.4	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	XRQ_Leaves_Plant_FTSW0.55	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	XRQ_Leaves_Plant_FTSW0.7	20120203	biogemma,gouzy,lipm,ragt2n,soltis,syngenta,UPMC
HELAN	XRQ_Ligule_Plant	20120203	public
HELAN	XRQ_Pollen_Plant	20120203	public
HELAN	XRQ_Root_Plantlet_ABA	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Auxin	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Brassinoster	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Control_1	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Control_2	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Control_3	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Control_4	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Control_5	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Control_6	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Control_7	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Cytokinin	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Ethylene	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Gibberellin	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_MethylJasmon	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_NaCl	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_PEG	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_SalycilicAci	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Root_Plantlet_Strigo	20120203	gouzy,lipm,UPMC
HELAN	XRQ_Seeds_Plant	20120203	public
HELAN	XRQ_Stamen_Plant	20120203	public
HELAN	XRQ_Stem_Plant	20120203	public
HELAN	XRQ_Style_Plant	20120203	public
HELAN	HA412-HO-LR-cold	20120319	public
HELAN	HA412-HO-LR-drought	20120319	public
HELAN	HA412-HO-LR-flowers	20120319	public
HELAN	HA412-HO-LR-roots_stems	20120319	public
XANC8	Xcc-8004_1_RbmL	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_1_RbmS	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_2_RbmL	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_2_RbmS	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_3_RbmL	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_3_RbmS	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_Gstar_1_RbmL	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_Gstar_1_RbmS	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_Gstar_2_L	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_Gstar_2_RbmL	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_Gstar_2_RbmS	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_Gstar_2_S	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_Gstar_3_RbmL	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_Gstar_3_RbmS	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_PlGstar_1_RbmL	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_PlGstar_1_RbmS	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_PlGstar_2_RbmL	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_PlGstar_2_RbmS	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_PlGstar_3_RbmL	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
XANC8	Xcc-8004_PlGstar_3_RbmS	20120621	arlat,broux,carrere,eguy,elauber,gouzy,lnoel
LOLSS	LOLSS-08.82-R00H	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-R02HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-R06HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-R12HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-R24HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-R36HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-R48HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-S00T	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-S02HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-S06HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-S12HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-S24HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-S36HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-08.82-S48HAT	20120723	aduhoux,aimenzaidi8,carrere,cdelye,fmohamadi,gouzy,kravet,lbonin,ptools,tasp,tgaines
LOLSS	LOLSS-1269-1322-R100H-A	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-1269-1322-R100H-B	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-1269-1322-R200H-A	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-1269-1322-R200H-B	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-1269-1322-S100H-A	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-1269-1322-S100H-B	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-1269-1322-S200H-A	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-1269-1322-S200H-B	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-F1-08994-1-R00H-A	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-F1-08994-1-R00H-B	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-F1-08994-1-S00H-A	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-F1-08994-1-S00H-B	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-F1-08994-3-R00H-A	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-F1-08994-3-R00H-B	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-F1-08994-3-S00H-A	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
LOLSS	LOLSS-F1-08994-3-S00H-B	20120723	aduhoux,carrere,cdelye,fmohamadi,gouzy
ALOMY	ALOMY-1323-RA	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1323-RB	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1323-S1A	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1323-S1B	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1323-S2A	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1323-S2B	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1323-WeakRA	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1323-WeakRB	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1330-R1A	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1330-R1B	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1330-R2A	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-1330-R2B	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-14093-RA	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-14093-RB	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-14093-SA	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-14093-SB	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-80D-S1A	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-80D-S1B	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-80D-S2A	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-80D-S2B	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-CY101F2C6-2-R00h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-R06h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-R12h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-R24h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-R36h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-R48h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-R73h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-S00h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-S06h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-S12h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-S24h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-S36h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-S48h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY101F2C6-2-S73h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R00h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R02h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R06h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R12h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R24h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-R36h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S00h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S02h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S06h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S12h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S24h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-CY46H-S36h	20130204	aimenzaidi8,alomycyc,carrere,cdelye,dlthiery,gouzy,jgardin,kravet,tgaines
ALOMY	ALOMY-F1-A28-RA	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-F1-A28-RB	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-F1-A28-SA	20130204	carrere,cdelye,dlthiery,gouzy
ALOMY	ALOMY-F1-A28-SB	20130204	carrere,cdelye,dlthiery,gouzy
BIOSGetGoTermsFromSpecies 2017.05.28 02:00:43 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetGoTermsFromSpecies.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

GOTerms

Format

Show or HideShow perl code used to test GOTerms format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetGoTermsFromSpecies/test/BIOSGetGoTermsFromSpecies.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetGoTermsFromSpecies/test/BIOSGetGoTermsFromSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test GOTerms content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetGoTermsFromSpecies/test/BIOSGetGoTermsFromSpecies.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetGoTermsFromSpecies/test/BIOSGetGoTermsFromSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for GOTerms

BIOSGetLibrariesFromSpecies 2017.05.28 02:00:45 Execution time: 2 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetLibrariesFromSpecies.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

libraries

Format

Show or HideShow perl code used to test libraries format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetLibrariesFromSpecies/test/BIOSGetLibrariesFromSpecies.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetLibrariesFromSpecies/test/BIOSGetLibrariesFromSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test libraries content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetLibrariesFromSpecies/test/BIOSGetLibrariesFromSpecies.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetLibrariesFromSpecies/test/BIOSGetLibrariesFromSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for libraries

<?xml version="1.0"?>
<collection>
  <library authority="" count_nr="0" count_raw="" definition="Test import BIOS DATA number 2" id="LIBTEST2" key="TestBank2" tag="Taw" url="http://www.google.com"/>
  <library authority="" count_nr="0" count_raw="" definition="Test import BIOS DATA number 1" id="LIBTEST1" key="TestBank1" tag="Taw" url="http://www.google.com"/>
</collection>
BIOSGetNodeLoad 2017.05.28 02:00:47 Execution time: 2 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetNodeLoad.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

node_load

Format

Show or HideShow perl code used to test node_load format

#these are default tests for format consistancy #you can/should write your own test #your test MUST return a boolean and a free text return (0, "Not in correct XML format") if ($_ !~ /<system/); return (1, "<system> tag found");
<system> tag found

Content

Show or Hide Show perl code used to test node_load content

#these are default tests for content analysis #you can/should write your own test #your test MUST return a boolean and a free text return (0, "empty article") if ($_ !~ /cpus\s+number="\d+"/); return (1, " CPUs detected");
 CPUs detected

Raw

Show or Hide Show raw output data for node_load

<?xml version="1.0"?>
<system score="-0.973571428571429">
	<cpus number="4" speed="2660">
		<load>
			<one>0.42</one>
			<five>0.12</five>
			<fifteen>0.08</fifteen>
		</load>
	</cpus>
	<memory totalmem="65916988" freemem="54426900" totalswap="131068" freeswap="131068" />
</system>
BIOSGetSequencesFromClusterIds 2017.05.28 02:01:07 Execution time: 17 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetSequencesFromClusterIds.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

Sequences

Format

Show or HideShow perl code used to test Sequences format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromClusterIds/test/BIOSGetSequencesFromClusterIds.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromClusterIds/test/BIOSGetSequencesFromClusterIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test Sequences content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromClusterIds/test/BIOSGetSequencesFromClusterIds.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromClusterIds/test/BIOSGetSequencesFromClusterIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for Sequences

BIOSGetSequencesFromFastaIds 2017.05.28 02:01:29 Execution time: 20 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetSequencesFromFastaIds.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

Sequences

Format

Show or HideShow perl code used to test Sequences format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromFastaIds/test/BIOSGetSequencesFromFastaIds.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromFastaIds/test/BIOSGetSequencesFromFastaIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test Sequences content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromFastaIds/test/BIOSGetSequencesFromFastaIds.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromFastaIds/test/BIOSGetSequencesFromFastaIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for Sequences

BIOSGetSequencesFromLibraryIds 2017.05.28 02:01:51 Execution time: 20 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetSequencesFromLibraryIds.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

Sequences

Format

Show or HideShow perl code used to test Sequences format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromLibraryIds/test/BIOSGetSequencesFromLibraryIds.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromLibraryIds/test/BIOSGetSequencesFromLibraryIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test Sequences content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromLibraryIds/test/BIOSGetSequencesFromLibraryIds.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromLibraryIds/test/BIOSGetSequencesFromLibraryIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for Sequences

BIOSGetSequencesFromSequenceIds 2017.05.28 02:02:10 Execution time: 17 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetSequencesFromSequenceIds.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

Sequences

Format

Show or HideShow perl code used to test Sequences format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromSequenceIds/test/BIOSGetSequencesFromSequenceIds.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromSequenceIds/test/BIOSGetSequencesFromSequenceIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test Sequences content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromSequenceIds/test/BIOSGetSequencesFromSequenceIds.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSequencesFromSequenceIds/test/BIOSGetSequencesFromSequenceIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for Sequences

>Rootsalt#15#1 acc=E4D3Z3Y02IF2C0 len=28 length=28 uaccno=E4D3Z3Y02IF2C0 old_id=009842_3346_1378
CTATATACTAGGACGCGTACGACTGTGC
>Rootsalt#158#1 acc=E4D3Z3Y02JP28A len=23 length=23 uaccno=E4D3Z3Y02JP28A old_id=040148_3870_2376
TATCTCCCTGTTGCGTGTCTCAG
>Rootsalt#654#1 acc=E4D3Z3Y02GY7P8 len=27 length=27 uaccno=E4D3Z3Y02GY7P8 old_id=070846_2744_1358
AGTTAGCGTCCGTGACTAATTGATGGT
>Rootsalt#654#2 acc=E4D3Z3Y02GY7P8 len=27 length=27 uaccno=E4D3Z3Y02GY7P8 old_id=070846_2744_1358
AGTTAGCGTCCGTGACTAATTGATGGT
>Rootsalt#654#3 acc=E4D3Z3Y02GY7P8 len=27 length=27 uaccno=E4D3Z3Y02GY7P8 old_id=070846_2744_1358
AGTTAGCGTCCGTGACTAATTGATGGT
>Mt-N1-pA-all#17675149#1 acc=HWI-EAS210R_0001:3:58:1042:1518#ATCTCG/1 len=54 def=
CGTGGTTGGGATGCGAAAGAGATAGAGGATTTTCTGCTTCTTCGTTTGGATATG
BIOSGetSpecies 2017.05.28 02:02:13 Execution time: 2 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetSpecies.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

BIOS_species

Format

Show or HideShow perl code used to test BIOS_species format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSpecies/test/BIOSGetSpecies.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSpecies/test/BIOSGetSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test BIOS_species content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSpecies/test/BIOSGetSpecies.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetSpecies/test/BIOSGetSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for BIOS_species

<?xml version="1.0"?>
<organism>
  <species code="ROSCH" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety="">Rosa chinensis</species>
  <taxonomy id="0" ontology="NCBI"/>
  <organelle/>
</organism><?xml version="1.0"?>
<organism>
  <species code="TEST" cultivar="lastachoeras" ecotype="" isolate="" strain="samatan" subspecies="" substrain="bezeril" variety="">Homo gascon gersus</species>
  <taxonomy id="32" ontology="NCBI"/>
  <organelle/>
</organism><?xml version="1.0"?>
<organism>
  <species code="Vitvi" cultivar="multi" ecotype="" isolate="" strain="" subspecies="" substrain="" variety="">Vitis vinifera</species>
  <taxonomy id="29760" ontology="NCBI"/>
  <organelle/>
</organism><?xml version="1.0"?>
<organism>
  <species code="MEDTR" cultivar="Jemalong super nodulating mutant TR122 (allelic to Sunn)" ecotype="" isolate="" strain="" subspecies="" substrain="" variety="">Medicago truncatula</species>
  <taxonomy id="3880" ontology="NCBI"/>
  <organelle/>
</organism><?xml version="1.0"?>
<organism>
  <species code="BRADI" cultivar="Bd21" ecotype="" isolate="" strain="" subspecies="" substrain="" variety="">Brachypodium distachyon</species>
  <taxonomy id="15368" ontology="NCBI"/>
  <organelle/>
</organism><?xml version="1.0"?>
<organism>
  <species code="HELAN" cultivar="HA-412-HO" ecotype="" isolate="" strain="" subspecies="" substrain="" variety="">Helianthus annuus</species>
  <taxonomy id="4232" ontology="NCBI"/>
  <organelle/>
</organism>
BIOSGetStatisticsFilterCriteria 2017.05.28 02:02:15 Execution time: 2 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetStatisticsFilterCriteria.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

criteria

Format

Show or HideShow perl code used to test criteria format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetStatisticsFilterCriteria/test/BIOSGetStatisticsFilterCriteria.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetStatisticsFilterCriteria/test/BIOSGetStatisticsFilterCriteria.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test criteria content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetStatisticsFilterCriteria/test/BIOSGetStatisticsFilterCriteria.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetStatisticsFilterCriteria/test/BIOSGetStatisticsFilterCriteria.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for criteria

<?xml version="1.0"?>
<pattern definition="Herbert2008" type="rules">
  <rule id="adjustp" value="Adjusted P-value"/>
  <rule id="chisprob" value="Pvalue based on probability of Chi2 distribution"/>
  <rule id="f_one" value="The frequency of gene transcript copies in pool 1"/>
  <rule id="f_two" value="The frequency of gene transcript copies in pool 2"/>
  <rule id="f_zero" value="The frequency of gene transcript copies in pool 1 &amp;amp; 2"/>
  <rule id="pool1_count" value="Total number of reads in pool 1"/>
  <rule id="pool2_count" value="Total number of reads in pool 2"/>
  <rule id="qvalue" value="Q-value"/>
  <rule id="rank" value="Rank in full statistics analysis data according to Qvalue from smallest to largest"/>
  <rule id="rstat" value="log likelihood ratio statistic"/>
  <rule id="up" value="UP1 if gene is overexpressed in pool 1,  UP2 if gene is overexpressed in pool 2"/>
</pattern>
BIOSGetTableClusterExpression 2017.05.28 02:02:36 Execution time: 19 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetTableClusterExpression.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

expression_data

Format

Show or HideShow perl code used to test expression_data format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test expression_data content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for expression_data

gene	length	type	version	product	pool1	pool2
TOTAL					0	0

libraries_with_counts

Format

Show or HideShow perl code used to test libraries_with_counts format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test libraries_with_counts content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for libraries_with_counts

<?xml version="1.0"?>
<collection>
  <class count_nr="1206" count_raw="0" definition="" id="pool1" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="1206" count_raw="4348" definition="Test import BIOS DATA number 1" id="LIBTEST1" key="test_library1" tag="Taj" url=""/>
  </class>
  <class count_nr="3644" count_raw="0" definition="" id="pool2" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="3644" count_raw="4263" definition="Test import BIOS DATA number 2" id="LIBTEST2" key="test_library2" tag="Tax" url=""/>
  </class>
</collection>
BIOSGetTableRawExpression 2017.05.28 02:02:57 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetTableRawExpression.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

expression_data

Format

Show or HideShow perl code used to test expression_data format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test expression_data content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for expression_data

gene	length	type	version	product	pool1	pool2

libraries_with_counts

Format

Show or HideShow perl code used to test libraries_with_counts format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test libraries_with_counts content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for libraries_with_counts

<?xml version="1.0"?>
<collection>
  <class count_nr="1206" count_raw="0" definition="" id="pool1" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="1206" count_raw="4348" definition="Test import BIOS DATA number 1" id="LIBTEST1" key="test_library1" tag="Taj" url=""/>
  </class>
  <class count_nr="3644" count_raw="0" definition="" id="pool2" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="3644" count_raw="4263" definition="Test import BIOS DATA number 2" id="LIBTEST2" key="test_library2" tag="Tax" url=""/>
  </class>
</collection>
BIOSGetXmlClusterExpression 2017.05.28 02:03:17 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSGetXmlClusterExpression.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

expression_data

Format

Show or HideShow perl code used to test expression_data format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test expression_data content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for expression_data

<?xml version="1.0"?>
<entry_db accession=""></entry_db>

libraries_with_counts

Format

Show or HideShow perl code used to test libraries_with_counts format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test libraries_with_counts content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for libraries_with_counts

<?xml version="1.0"?>
<collection>
  <class count_nr="1206" count_raw="0" definition="" id="pool1" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="1206" count_raw="4348" definition="Test import BIOS DATA number 1" id="LIBTEST1" key="test_library1" tag="Taj" url=""/>
  </class>
  <class count_nr="3644" count_raw="0" definition="" id="pool2" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="3644" count_raw="4263" definition="Test import BIOS DATA number 2" id="LIBTEST2" key="test_library2" tag="Tax" url=""/>
  </class>
</collection>
BIOSTestDifferentialGeneExpressionFromTable_DESeq 2017.05.28 02:03:37 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSTestDifferentialGeneExpressionFromTable_DESeq.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

statistics

Format

Show or HideShow perl code used to test statistics format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_DESeq/test/BIOSTestDifferentialGeneExpressionFromTable_DESeq.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_DESeq/test/BIOSTestDifferentialGeneExpressionFromTable_DESeq.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test statistics content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_DESeq/test/BIOSTestDifferentialGeneExpressionFromTable_DESeq.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_DESeq/test/BIOSTestDifferentialGeneExpressionFromTable_DESeq.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for statistics

<?xml version="1.0"?>
<entry_db>
  <entry accession="TESTTEST000710" confidence="" id="710" length="1329" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000710">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="30.8132930694012"/>
        <property id="baseMeanA" value="22.1843284860455"/>
        <property id="baseMeanB" value="39.4422576527568"/>
        <property id="foldChange" value="1.77793335856737"/>
        <property id="log2FoldChange" value="0.830201249327304"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="25"/>
        <property id="pval" value="0.471359726638419"/>
        <property id="rank" value="26"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008428" confidence="" id="8428" length="806" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015865:Riboflavin kinase;</definition>
    <entry_features accession="TESTTEST008428">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="14.3956474658042"/>
        <property id="baseMeanA" value="17.7474627888364"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.62227667549858"/>
        <property id="log2FoldChange" value="-0.684371923502454"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.722676435088688"/>
        <property id="rank" value="52"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020565" confidence="" id="20565" length="628" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal;</definition>
    <entry_features accession="TESTTEST020565">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="14.2406402694932"/>
        <property id="baseMeanA" value="19.0151387023248"/>
        <property id="baseMeanB" value="9.46614183666162"/>
        <property id="foldChange" value="0.497821340398864"/>
        <property id="log2FoldChange" value="-1.00630001838982"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.573078364505772"/>
        <property id="rank" value="36"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000743" confidence="" id="743" length="847" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR018485:Carbohydrate kinase, FGGY, C-terminal;</definition>
    <entry_features accession="TESTTEST000743">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.3398732310798"/>
        <property id="baseMeanA" value="17.7474627888364"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="1.06676001514042"/>
        <property id="log2FoldChange" value="0.0932356551610976"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.986869467843521"/>
        <property id="rank" value="111"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000481" confidence="" id="481" length="2175" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000481">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="26.0871267368205"/>
        <property id="baseMeanA" value="25.3535182697663"/>
        <property id="baseMeanB" value="26.8207352038746"/>
        <property id="foldChange" value="1.05787034834759"/>
        <property id="log2FoldChange" value="0.0811628228605226"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="40"/>
        <property id="pool2_count" value="17"/>
        <property id="pval" value="0.976330386378829"/>
        <property id="rank" value="108"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007446" confidence="" id="7446" length="674" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002872:Proline dehydrogenase; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST007446">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="8.23989343767406"/>
        <property id="baseMeanA" value="16.4797868753481"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.0715924843587128"/>
        <property id="rank" value="4"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011536" confidence="" id="11536" length="676" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000623:Shikimate kinase;</definition>
    <entry_features accession="TESTTEST011536">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="20.5790198369348"/>
        <property id="baseMeanA" value="31.6918978372079"/>
        <property id="baseMeanB" value="9.46614183666162"/>
        <property id="foldChange" value="0.298692804239318"/>
        <property id="log2FoldChange" value="-1.74326561255602"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="50"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.223292935378832"/>
        <property id="rank" value="7"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001902" confidence="" id="1902" length="801" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR013750:GHMP kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST001902">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="62.7875869562305"/>
        <property id="baseMeanA" value="70.3560131986016"/>
        <property id="baseMeanB" value="55.2191607138595"/>
        <property id="foldChange" value="0.784853464592804"/>
        <property id="log2FoldChange" value="-0.349504772907594"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="111"/>
        <property id="pool2_count" value="35"/>
        <property id="pval" value="0.744742589849506"/>
        <property id="rank" value="55"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000697" confidence="" id="697" length="983" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000697">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="30.861625169652"/>
        <property id="baseMeanA" value="44.3686569720911"/>
        <property id="baseMeanB" value="17.354593367213"/>
        <property id="foldChange" value="0.391145338884822"/>
        <property id="log2FoldChange" value="-1.35422332181012"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="70"/>
        <property id="pool2_count" value="11"/>
        <property id="pval" value="0.264066045119708"/>
        <property id="rank" value="10"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005092" confidence="" id="5092" length="1334" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase; IPR018042:Aspartate kinase, conserved site;</definition>
    <entry_features accession="TESTTEST005092">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.4941335955717"/>
        <property id="baseMeanA" value="13.9444350483715"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.791988496089102"/>
        <property id="log2FoldChange" value="-0.336448620082148"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.922441011819771"/>
        <property id="rank" value="99"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST052293" confidence="" id="52293" length="323" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST052293">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="7.4441436988688"/>
        <property id="baseMeanA" value="13.3105970916273"/>
        <property id="baseMeanB" value="1.57769030611027"/>
        <property id="foldChange" value="0.118528890571158"/>
        <property id="log2FoldChange" value="-3.07668934628121"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.255625458665923"/>
        <property id="rank" value="9"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001051" confidence="" id="1051" length="1172" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006082:Phosphoribulokinase;</definition>
    <entry_features accession="TESTTEST001051">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.34677781683"/>
        <property id="baseMeanA" value="20.9166525725572"/>
        <property id="baseMeanB" value="15.7769030611027"/>
        <property id="foldChange" value="0.754274758180097"/>
        <property id="log2FoldChange" value="-0.406837947973546"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="0.834681317901576"/>
        <property id="rank" value="79"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002945" confidence="" id="2945" length="1085" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001697:Pyruvate kinase; IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core; IPR018209:Pyruvate kinase, active si</definition>
    <entry_features accession="TESTTEST002945">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="41.3061422844304"/>
        <property id="baseMeanA" value="58.9469299772067"/>
        <property id="baseMeanB" value="23.6653545916541"/>
        <property id="foldChange" value="0.40146882290231"/>
        <property id="log2FoldChange" value="-1.31664013900197"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="93"/>
        <property id="pool2_count" value="15"/>
        <property id="pval" value="0.230764879157034"/>
        <property id="rank" value="8"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002171" confidence="" id="2171" length="1756" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST002171">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="42.222376290796"/>
        <property id="baseMeanA" value="45.0024949288352"/>
        <property id="baseMeanB" value="39.4422576527568"/>
        <property id="foldChange" value="0.876446021828986"/>
        <property id="log2FoldChange" value="-0.190262853232412"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="71"/>
        <property id="pool2_count" value="25"/>
        <property id="pval" value="0.900877014345769"/>
        <property id="rank" value="91"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001694" confidence="" id="1694" length="1098" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001312:Hexokinase;</definition>
    <entry_features accession="TESTTEST001694">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="13.4448905306879"/>
        <property id="baseMeanA" value="15.845948918604"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.69694987655841"/>
        <property id="log2FoldChange" value="-0.520873191219575"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.817508477166729"/>
        <property id="rank" value="73"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009746" confidence="" id="9746" length="891" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase;</definition>
    <entry_features accession="TESTTEST009746">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="13.5998977269989"/>
        <property id="baseMeanA" value="14.5782730051156"/>
        <property id="baseMeanB" value="12.6215224488822"/>
        <property id="foldChange" value="0.865776244171938"/>
        <property id="log2FoldChange" value="-0.207933879559467"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="8"/>
        <property id="pval" value="0.980635049834636"/>
        <property id="rank" value="109"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000569" confidence="" id="569" length="761" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001564:Nucleoside diphosphate kinase, core;</definition>
    <entry_features accession="TESTTEST000569">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="57.9854701803985"/>
        <property id="baseMeanA" value="38.6641153613937"/>
        <property id="baseMeanB" value="77.3068249994033"/>
        <property id="foldChange" value="1.99944636717577"/>
        <property id="log2FoldChange" value="0.999600583049867"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="61"/>
        <property id="pool2_count" value="49"/>
        <property id="pval" value="0.298282213400853"/>
        <property id="rank" value="13"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001861" confidence="" id="1861" length="1486" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001861">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="36.3490183122873"/>
        <property id="baseMeanA" value="28.5227080534871"/>
        <property id="baseMeanB" value="44.1753285710876"/>
        <property id="foldChange" value="1.54877750346313"/>
        <property id="log2FoldChange" value="0.631129902225475"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="45"/>
        <property id="pool2_count" value="28"/>
        <property id="pval" value="0.566579849605925"/>
        <property id="rank" value="35"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000597" confidence="" id="597" length="1065" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000597">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="26.0802221510703"/>
        <property id="baseMeanA" value="22.1843284860455"/>
        <property id="baseMeanB" value="29.9761158160951"/>
        <property id="foldChange" value="1.3512293525112"/>
        <property id="log2FoldChange" value="0.434272572996164"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="19"/>
        <property id="pval" value="0.736079924685461"/>
        <property id="rank" value="54"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026720" confidence="" id="26720" length="513" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST026720">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="16.4383593608474"/>
        <property id="baseMeanA" value="13.9444350483715"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="1.35769456472417"/>
        <property id="log2FoldChange" value="0.441158958581404"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.788718379849424"/>
        <property id="rank" value="65"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001053" confidence="" id="1053" length="1004" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <entry_features accession="TESTTEST001053">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="22.7767389282889"/>
        <property id="baseMeanA" value="26.6211941832547"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="0.711173343426949"/>
        <property id="log2FoldChange" value="-0.491726845560059"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.754086259312251"/>
        <property id="rank" value="59"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007784" confidence="" id="7784" length="972" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST007784">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="14.2268310979929"/>
        <property id="baseMeanA" value="12.6767591348832"/>
        <property id="baseMeanB" value="15.7769030611027"/>
        <property id="foldChange" value="1.24455335099716"/>
        <property id="log2FoldChange" value="0.315628076497546"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="0.876719032999514"/>
        <property id="rank" value="85"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006664" confidence="" id="6664" length="563" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006206:Mevalonate/galactokinase; IPR014721:Ribosomal protein S5 domain 2-type fold, subgroup;</definition>
    <entry_features accession="TESTTEST006664">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="15.6633233792925"/>
        <property id="baseMeanA" value="20.2828146158131"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.544492091061258"/>
        <property id="log2FoldChange" value="-0.877017001444851"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="32"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.611093129550767"/>
        <property id="rank" value="43"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011563" confidence="" id="11563" length="659" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002891:Adenylylsulphate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST011563">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.4941335955717"/>
        <property id="baseMeanA" value="13.9444350483715"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.791988496089102"/>
        <property id="log2FoldChange" value="-0.336448620082148"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.922441011819771"/>
        <property id="rank" value="100"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026180" confidence="" id="26180" length="684" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016149:Casein kinase II, regulatory subunit, alpha-helical;</definition>
    <entry_features accession="TESTTEST026180">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="39.2081937033862"/>
        <property id="baseMeanA" value="37.3964394479053"/>
        <property id="baseMeanB" value="41.019947958867"/>
        <property id="foldChange" value="1.09689447884495"/>
        <property id="log2FoldChange" value="0.133424745276796"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="59"/>
        <property id="pool2_count" value="26"/>
        <property id="pval" value="0.917460996855529"/>
        <property id="rank" value="95"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST018164" confidence="" id="18164" length="964" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008144:Guanylate kinase;</definition>
    <entry_features accession="TESTTEST018164">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="36.2078202874766"/>
        <property id="baseMeanA" value="36.128763534417"/>
        <property id="baseMeanB" value="36.2868770405362"/>
        <property id="foldChange" value="1.00437638852402"/>
        <property id="log2FoldChange" value="0.00630001838981663"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="57"/>
        <property id="pool2_count" value="23"/>
        <property id="pval" value="1"/>
        <property id="rank" value="115"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004342" confidence="" id="4342" length="1181" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002573:Choline/ethanolamine kinase;</definition>
    <entry_features accession="TESTTEST004342">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="17.3960208817137"/>
        <property id="baseMeanA" value="19.0151387023248"/>
        <property id="baseMeanB" value="15.7769030611027"/>
        <property id="foldChange" value="0.829702233998107"/>
        <property id="log2FoldChange" value="-0.269334424223611"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="0.921756708729996"/>
        <property id="rank" value="98"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007767" confidence="" id="7767" length="1068" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001844:Chaperonin Cpn60; IPR002423:Chaperonin Cpn60/TCP-1; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST007767">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="84.8614420702741"/>
        <property id="baseMeanA" value="64.01763363116"/>
        <property id="baseMeanB" value="105.705250509388"/>
        <property id="foldChange" value="1.65118959439227"/>
        <property id="log2FoldChange" value="0.723505784203523"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="101"/>
        <property id="pool2_count" value="67"/>
        <property id="pval" value="0.415457227749029"/>
        <property id="rank" value="18"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008330" confidence="" id="8330" length="1706" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST008330">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="46.2080295705724"/>
        <property id="baseMeanA" value="64.01763363116"/>
        <property id="baseMeanB" value="28.3984255099849"/>
        <property id="foldChange" value="0.443603174612849"/>
        <property id="log2FoldChange" value="-1.17265840481194"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="101"/>
        <property id="pool2_count" value="18"/>
        <property id="pval" value="0.270288652350257"/>
        <property id="rank" value="11"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003951" confidence="" id="3951" length="861" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <entry_features accession="TESTTEST003951">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="17.5441234922746"/>
        <property id="baseMeanA" value="14.5782730051156"/>
        <property id="baseMeanB" value="20.5099739794335"/>
        <property id="foldChange" value="1.4068863967794"/>
        <property id="log2FoldChange" value="0.492505838581625"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="13"/>
        <property id="pval" value="0.750599593939717"/>
        <property id="rank" value="57"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003779" confidence="" id="3779" length="792" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST003779">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="9.65567196172323"/>
        <property id="baseMeanA" value="14.5782730051156"/>
        <property id="baseMeanB" value="4.73307091833081"/>
        <property id="foldChange" value="0.324666091564477"/>
        <property id="log2FoldChange" value="-1.62297137883831"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.453680695338112"/>
        <property id="rank" value="22"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST030037" confidence="" id="30037" length="772" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST030037">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.8256085772631"/>
        <property id="baseMeanA" value="23.4520043995339"/>
        <property id="baseMeanB" value="14.1992127549924"/>
        <property id="foldChange" value="0.605458386971591"/>
        <property id="log2FoldChange" value="-0.723900287689092"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="37"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="0.651841070077045"/>
        <property id="rank" value="49"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000617" confidence="" id="617" length="1565" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST000617">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="43.4831476185342"/>
        <property id="baseMeanA" value="44.3686569720911"/>
        <property id="baseMeanB" value="42.5976382649773"/>
        <property id="foldChange" value="0.960084013626381"/>
        <property id="log2FoldChange" value="-0.0587674382839524"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="70"/>
        <property id="pool2_count" value="27"/>
        <property id="pval" value="1"/>
        <property id="rank" value="116"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000830" confidence="" id="830" length="1105" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015824:Phosphoglycerate kinase, N-terminal; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST000830">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="127.273348486132"/>
        <property id="baseMeanA" value="123.598401565111"/>
        <property id="baseMeanB" value="130.948295407152"/>
        <property id="foldChange" value="1.05946592956681"/>
        <property id="log2FoldChange" value="0.0833371940948597"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="195"/>
        <property id="pool2_count" value="83"/>
        <property id="pval" value="0.919742000823883"/>
        <property id="rank" value="96"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006838" confidence="" id="6838" length="1066" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008656:Inositol 1, 3, 4-trisphosphate 56-kinase;</definition>
    <entry_features accession="TESTTEST006838">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="17.8679470563968"/>
        <property id="baseMeanA" value="18.3813007455806"/>
        <property id="baseMeanB" value="17.354593367213"/>
        <property id="foldChange" value="0.944143921446121"/>
        <property id="log2FoldChange" value="-0.0829212999927295"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="11"/>
        <property id="pval" value="1"/>
        <property id="rank" value="117"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000857" confidence="" id="857" length="1447" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001805:Adenosine kinase; IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000857">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="487.801479397788"/>
        <property id="baseMeanA" value="497.562796044164"/>
        <property id="baseMeanB" value="478.040162751412"/>
        <property id="foldChange" value="0.960763478604177"/>
        <property id="log2FoldChange" value="-0.0577467838084929"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="785"/>
        <property id="pool2_count" value="303"/>
        <property id="pval" value="0.956988348288876"/>
        <property id="rank" value="106"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009902" confidence="" id="9902" length="670" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR015940:Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST009902">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.663696795202"/>
        <property id="baseMeanA" value="21.5504905293014"/>
        <property id="baseMeanB" value="15.7769030611027"/>
        <property id="foldChange" value="0.732090206468918"/>
        <property id="log2FoldChange" value="-0.449906669865432"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="34"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="0.807161564078839"/>
        <property id="rank" value="70"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001446" confidence="" id="1446" length="1219" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR008351:JNK MAP kinase; IPR011009:Protein kinase-like; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001446">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="25.4532887800763"/>
        <property id="baseMeanA" value="24.085842356278"/>
        <property id="baseMeanB" value="26.8207352038746"/>
        <property id="foldChange" value="1.11354773510272"/>
        <property id="log2FoldChange" value="0.155163404304299"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="17"/>
        <property id="pval" value="0.926475075004886"/>
        <property id="rank" value="104"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST035440" confidence="" id="35440" length="731" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST035440">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.4941335955717"/>
        <property id="baseMeanA" value="13.9444350483715"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.791988496089102"/>
        <property id="log2FoldChange" value="-0.336448620082148"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.922441011819771"/>
        <property id="rank" value="101"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002924" confidence="" id="2924" length="1482" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL doma</definition>
    <entry_features accession="TESTTEST002924">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="22.2910035821056"/>
        <property id="baseMeanA" value="20.9166525725572"/>
        <property id="baseMeanB" value="23.6653545916541"/>
        <property id="foldChange" value="1.13141213727015"/>
        <property id="log2FoldChange" value="0.178124552747611"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="15"/>
        <property id="pval" value="0.920006659336259"/>
        <property id="rank" value="97"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001547" confidence="" id="1547" length="1145" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001547">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="17.8610424706467"/>
        <property id="baseMeanA" value="15.2121109618598"/>
        <property id="baseMeanB" value="20.5099739794335"/>
        <property id="foldChange" value="1.34826613024692"/>
        <property id="log2FoldChange" value="0.431105293917481"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="13"/>
        <property id="pval" value="0.783965223515643"/>
        <property id="rank" value="62"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003609" confidence="" id="3609" length="698" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015824:Phosphoglycerate kinase, N-terminal; IPR015911:Phosphoglycerate kinase, conserved site;</definition>
    <entry_features accession="TESTTEST003609">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="31.7709545902675"/>
        <property id="baseMeanA" value="27.2550321399988"/>
        <property id="baseMeanB" value="36.2868770405362"/>
        <property id="foldChange" value="1.3313826545551"/>
        <property id="log2FoldChange" value="0.41292527785246"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="23"/>
        <property id="pval" value="0.728450856775586"/>
        <property id="rank" value="53"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003288" confidence="" id="3288" length="778" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST003288">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="41.2370964269291"/>
        <property id="baseMeanA" value="27.2550321399988"/>
        <property id="baseMeanB" value="55.2191607138595"/>
        <property id="foldChange" value="2.02601708301863"/>
        <property id="log2FoldChange" value="1.01864633874041"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="35"/>
        <property id="pval" value="0.331080721181832"/>
        <property id="rank" value="16"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005404" confidence="" id="5404" length="1001" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001805:Adenosine kinase; IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST005404">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="52.1880626451412"/>
        <property id="baseMeanA" value="57.0454161069743"/>
        <property id="baseMeanB" value="47.3307091833081"/>
        <property id="foldChange" value="0.829702233998107"/>
        <property id="log2FoldChange" value="-0.269334424223611"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="90"/>
        <property id="pool2_count" value="30"/>
        <property id="pval" value="0.823580561779211"/>
        <property id="rank" value="74"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008959" confidence="" id="8959" length="1190" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST008959">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="55.3503478431118"/>
        <property id="baseMeanA" value="60.214605890695"/>
        <property id="baseMeanB" value="50.4860897955287"/>
        <property id="foldChange" value="0.838435941724403"/>
        <property id="log2FoldChange" value="-0.254227531833402"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="95"/>
        <property id="pool2_count" value="32"/>
        <property id="pval" value="0.831709370683837"/>
        <property id="rank" value="78"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001387" confidence="" id="1387" length="1222" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR005935:Diphosphomevalonate decarboxylase; IPR006204:GHMP kinase;</definition>
    <entry_features accession="TESTTEST001387">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="15.8252351613536"/>
        <property id="baseMeanA" value="22.1843284860455"/>
        <property id="baseMeanB" value="9.46614183666162"/>
        <property id="foldChange" value="0.426704006056169"/>
        <property id="log2FoldChange" value="-1.22869243972626"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.454454791069039"/>
        <property id="rank" value="23"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000534" confidence="" id="534" length="2048" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site; IPR002655:Acyl-CoA oxidase, C-terminal; IPR006089:Acyl-CoA dehydrogenase, conserved site; IPR006090:Acyl-CoA oxidase/dehydrogenase, type 1; I</definition>
    <entry_features accession="TESTTEST000534">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="29.9384865775363"/>
        <property id="baseMeanA" value="55.1439022367418"/>
        <property id="baseMeanB" value="4.73307091833081"/>
        <property id="foldChange" value="0.085831265586011"/>
        <property id="log2FoldChange" value="-3.54235291863003"/>
        <property id="padj" value="0.598042348028942"/>
        <property id="pool1_count" value="87"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.00949273568299907"/>
        <property id="rank" value="2"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020362" confidence="" id="20362" length="751" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST020362">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="16.4383593608474"/>
        <property id="baseMeanA" value="13.9444350483715"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="1.35769456472417"/>
        <property id="log2FoldChange" value="0.441158958581404"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.788718379849424"/>
        <property id="rank" value="66"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000814" confidence="" id="814" length="583" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000814">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.6567922094519"/>
        <property id="baseMeanA" value="18.3813007455806"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="1.02997518703213"/>
        <property id="log2FoldChange" value="0.0426095820911295"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="1"/>
        <property id="rank" value="119"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016392" confidence="" id="16392" length="811" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase;</definition>
    <entry_features accession="TESTTEST016392">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="22.5941133889775"/>
        <property id="baseMeanA" value="15.2121109618598"/>
        <property id="baseMeanB" value="29.9761158160951"/>
        <property id="foldChange" value="1.9705428057455"/>
        <property id="log2FoldChange" value="0.978593089219975"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="19"/>
        <property id="pval" value="0.446782863358946"/>
        <property id="rank" value="21"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000469" confidence="" id="469" length="1179" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR011990:Tetratricopeptide-like helical;</definition>
    <entry_features accession="TESTTEST000469">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.9660597702547"/>
        <property id="baseMeanA" value="13.3105970916273"/>
        <property id="baseMeanB" value="12.6215224488822"/>
        <property id="foldChange" value="0.948231124569265"/>
        <property id="log2FoldChange" value="-0.0766893462812148"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="8"/>
        <property id="pval" value="1"/>
        <property id="rank" value="118"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002489" confidence="" id="2489" length="961" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR014746:Glutamine synthetase/guanido kinase, catalytic region;</definition>
    <entry_features accession="TESTTEST002489">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="21.6502610396114"/>
        <property id="baseMeanA" value="16.4797868753481"/>
        <property id="baseMeanB" value="26.8207352038746"/>
        <property id="foldChange" value="1.62749284361167"/>
        <property id="log2FoldChange" value="0.702651199606793"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="17"/>
        <property id="pval" value="0.598847749439776"/>
        <property id="rank" value="39"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003730" confidence="" id="3730" length="1142" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <entry_features accession="TESTTEST003730">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="15.8114259898533"/>
        <property id="baseMeanA" value="15.845948918604"/>
        <property id="baseMeanB" value="15.7769030611027"/>
        <property id="foldChange" value="0.995642680797728"/>
        <property id="log2FoldChange" value="-0.00630001838981696"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="1"/>
        <property id="rank" value="120"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020686" confidence="" id="20686" length="579" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST020686">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="11.0714504857724"/>
        <property id="baseMeanA" value="12.6767591348832"/>
        <property id="baseMeanB" value="9.46614183666162"/>
        <property id="foldChange" value="0.746732010598296"/>
        <property id="log2FoldChange" value="-0.421337517668661"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.896349090406699"/>
        <property id="rank" value="89"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009956" confidence="" id="9956" length="620" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011611:Carbohydrate/purine kinase;</definition>
    <entry_features accession="TESTTEST009956">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="16.6071757286586"/>
        <property id="baseMeanA" value="19.0151387023248"/>
        <property id="baseMeanB" value="14.1992127549924"/>
        <property id="foldChange" value="0.746732010598296"/>
        <property id="log2FoldChange" value="-0.421337517668661"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="0.839675792362038"/>
        <property id="rank" value="81"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000971" confidence="" id="971" length="1250" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST000971">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="24.3337154771488"/>
        <property id="baseMeanA" value="17.1136248320923"/>
        <property id="baseMeanB" value="31.5538061222054"/>
        <property id="foldChange" value="1.84378274221802"/>
        <property id="log2FoldChange" value="0.882668669221439"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="20"/>
        <property id="pval" value="0.48170405044986"/>
        <property id="rank" value="27"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003711" confidence="" id="3711" length="1471" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase; IPR001057:Glutamate 5-kinase;</definition>
    <entry_features accession="TESTTEST003711">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="15.0156762510481"/>
        <property id="baseMeanA" value="12.6767591348832"/>
        <property id="baseMeanB" value="17.354593367213"/>
        <property id="foldChange" value="1.36900868609688"/>
        <property id="log2FoldChange" value="0.45313160024748"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="11"/>
        <property id="pval" value="0.793861636544872"/>
        <property id="rank" value="67"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001519" confidence="" id="1519" length="689" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST001519">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="43.6381548148452"/>
        <property id="baseMeanA" value="43.1009810586028"/>
        <property id="baseMeanB" value="44.1753285710876"/>
        <property id="foldChange" value="1.02492628905648"/>
        <property id="log2FoldChange" value="0.03552015730481"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="68"/>
        <property id="pool2_count" value="28"/>
        <property id="pval" value="0.990318407464282"/>
        <property id="rank" value="112"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004389" confidence="" id="4389" length="852" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST004389">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="33.3486448963778"/>
        <property id="baseMeanA" value="27.2550321399988"/>
        <property id="baseMeanB" value="39.4422576527568"/>
        <property id="foldChange" value="1.44715505929902"/>
        <property id="log2FoldChange" value="0.533219511570172"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="25"/>
        <property id="pval" value="0.641338040894753"/>
        <property id="rank" value="48"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST010712" confidence="" id="10712" length="639" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR009286:Inositol-pentakisphosphate 2-kinase;</definition>
    <entry_features accession="TESTTEST010712">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.8110525739438"/>
        <property id="baseMeanA" value="14.5782730051156"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.757554213650445"/>
        <property id="log2FoldChange" value="-0.400578957501863"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.886317004619526"/>
        <property id="rank" value="88"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000063" confidence="" id="63" length="2073" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000063">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="136.408762172921"/>
        <property id="baseMeanA" value="116.626184040925"/>
        <property id="baseMeanB" value="156.191340304917"/>
        <property id="foldChange" value="1.33924762770347"/>
        <property id="log2FoldChange" value="0.421422740520142"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="184"/>
        <property id="pool2_count" value="99"/>
        <property id="pval" value="0.608373282498485"/>
        <property id="rank" value="41"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016344" confidence="" id="16344" length="908" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR018483:Carbohydrate kinase, FGGY, conserved site;</definition>
    <entry_features accession="TESTTEST016344">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.6629499633829"/>
        <property id="baseMeanA" value="19.0151387023248"/>
        <property id="baseMeanB" value="6.31076122444108"/>
        <property id="foldChange" value="0.331880893599243"/>
        <property id="log2FoldChange" value="-1.59126251911097"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.385135244298664"/>
        <property id="rank" value="17"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026919" confidence="" id="26919" length="494" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST026919">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="20.0794753192512"/>
        <property id="baseMeanA" value="19.6489766590689"/>
        <property id="baseMeanB" value="20.5099739794335"/>
        <property id="foldChange" value="1.04381893954601"/>
        <property id="log2FoldChange" value="0.0618714842517624"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="31"/>
        <property id="pool2_count" value="13"/>
        <property id="pval" value="1"/>
        <property id="rank" value="121"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011337" confidence="" id="11337" length="1040" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST011337">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="20.4171080548737"/>
        <property id="baseMeanA" value="29.7903839669754"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.370718019445963"/>
        <property id="log2FoldChange" value="-1.43160585312249"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="47"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.318859183534065"/>
        <property id="rank" value="15"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006591" confidence="" id="6591" length="686" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <entry_features accession="TESTTEST006591">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="9.02183400497907"/>
        <property id="baseMeanA" value="13.3105970916273"/>
        <property id="baseMeanB" value="4.73307091833081"/>
        <property id="foldChange" value="0.355586671713474"/>
        <property id="log2FoldChange" value="-1.49172684556006"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.513933931709818"/>
        <property id="rank" value="32"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009115" confidence="" id="9115" length="723" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal; IPR015994:Phosphoenolpyruv</definition>
    <entry_features accession="TESTTEST009115">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.97221752418574"/>
        <property id="baseMeanA" value="13.9444350483715"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.109878407914774"/>
        <property id="rank" value="5"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016716" confidence="" id="16716" length="590" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST016716">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="14.543750076365"/>
        <property id="baseMeanA" value="13.3105970916273"/>
        <property id="baseMeanB" value="15.7769030611027"/>
        <property id="foldChange" value="1.18528890571158"/>
        <property id="log2FoldChange" value="0.245238748606147"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="0.914006214637554"/>
        <property id="rank" value="94"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001164" confidence="" id="1164" length="735" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core;</definition>
    <entry_features accession="TESTTEST001164">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="28.7636765886078"/>
        <property id="baseMeanA" value="22.8181664427897"/>
        <property id="baseMeanB" value="34.709186734426"/>
        <property id="foldChange" value="1.52112076232986"/>
        <property id="log2FoldChange" value="0.60513469369253"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="36"/>
        <property id="pool2_count" value="22"/>
        <property id="pval" value="0.614190773246337"/>
        <property id="rank" value="44"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000348" confidence="" id="348" length="1510" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000348">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="33.827475656811"/>
        <property id="baseMeanA" value="29.7903839669754"/>
        <property id="baseMeanB" value="37.8645673466465"/>
        <property id="foldChange" value="1.27103320952901"/>
        <property id="log2FoldChange" value="0.346001725541064"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="47"/>
        <property id="pool2_count" value="24"/>
        <property id="pval" value="0.769245087674316"/>
        <property id="rank" value="61"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000756" confidence="" id="756" length="1433" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000756">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.8117994057629"/>
        <property id="baseMeanA" value="17.1136248320923"/>
        <property id="baseMeanB" value="20.5099739794335"/>
        <property id="foldChange" value="1.19845878244171"/>
        <property id="log2FoldChange" value="0.261180292475169"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="13"/>
        <property id="pval" value="0.880842201829409"/>
        <property id="rank" value="86"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001621" confidence="" id="1621" length="1838" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001621">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="22.7767389282889"/>
        <property id="baseMeanA" value="26.6211941832547"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="0.711173343426949"/>
        <property id="log2FoldChange" value="-0.491726845560059"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.754086259312251"/>
        <property id="rank" value="60"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003722" confidence="" id="3722" length="1245" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase;</definition>
    <entry_features accession="TESTTEST003722">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="55.4777366964223"/>
        <property id="baseMeanA" value="46.2701708423236"/>
        <property id="baseMeanB" value="64.6853025505211"/>
        <property id="foldChange" value="1.39799143536667"/>
        <property id="log2FoldChange" value="0.483355522235612"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="73"/>
        <property id="pool2_count" value="41"/>
        <property id="pval" value="0.621859775889627"/>
        <property id="rank" value="46"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST046970" confidence="" id="46970" length="432" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase;</definition>
    <entry_features accession="TESTTEST046970">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="14.8675736404872"/>
        <property id="baseMeanA" value="17.1136248320923"/>
        <property id="baseMeanB" value="12.6215224488822"/>
        <property id="foldChange" value="0.737513096887206"/>
        <property id="log2FoldChange" value="-0.439259425665923"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="8"/>
        <property id="pval" value="0.845195725342429"/>
        <property id="rank" value="83"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST012447" confidence="" id="12447" length="799" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006204:GHMP kinase; IPR018260:Ribosomal protein L22/L17, conserved site;</definition>
    <entry_features accession="TESTTEST012447">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="19.1218137983849"/>
        <property id="baseMeanA" value="14.5782730051156"/>
        <property id="baseMeanB" value="23.6653545916541"/>
        <property id="foldChange" value="1.62333045782238"/>
        <property id="log2FoldChange" value="0.698956716049051"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="15"/>
        <property id="pval" value="0.62121673887995"/>
        <property id="rank" value="45"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003801" confidence="" id="3801" length="717" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001564:Nucleoside diphosphate kinase, core;</definition>
    <entry_features accession="TESTTEST003801">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="58.5264422125828"/>
        <property id="baseMeanA" value="69.7221752418574"/>
        <property id="baseMeanB" value="47.3307091833081"/>
        <property id="foldChange" value="0.678847282362087"/>
        <property id="log2FoldChange" value="-0.558841041418595"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="110"/>
        <property id="pool2_count" value="30"/>
        <property id="pval" value="0.589704303254701"/>
        <property id="rank" value="38"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001295" confidence="" id="1295" length="1564" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001295">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="32.5528951575725"/>
        <property id="baseMeanA" value="24.085842356278"/>
        <property id="baseMeanB" value="41.019947958867"/>
        <property id="foldChange" value="1.70307300662769"/>
        <property id="log2FoldChange" value="0.768140281195052"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="26"/>
        <property id="pval" value="0.498219222130034"/>
        <property id="rank" value="29"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002129" confidence="" id="2129" length="788" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST002129">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="14.071823901682"/>
        <property id="baseMeanA" value="13.9444350483715"/>
        <property id="baseMeanB" value="14.1992127549924"/>
        <property id="foldChange" value="1.01827092354313"/>
        <property id="log2FoldChange" value="0.0261214593025606"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="1"/>
        <property id="rank" value="122"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007751" confidence="" id="7751" length="1579" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase; IPR011183:Pyrophosphate-dependent phosphofructokinase PfpB;</definition>
    <entry_features accession="TESTTEST007751">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="20.0725707335011"/>
        <property id="baseMeanA" value="16.4797868753481"/>
        <property id="baseMeanB" value="23.6653545916541"/>
        <property id="foldChange" value="1.43602309730442"/>
        <property id="log2FoldChange" value="0.522078953964972"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="15"/>
        <property id="pval" value="0.714758045841577"/>
        <property id="rank" value="51"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000946" confidence="" id="946" length="946" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000946">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="35.2639679381105"/>
        <property id="baseMeanA" value="37.3964394479053"/>
        <property id="baseMeanB" value="33.1314964283157"/>
        <property id="foldChange" value="0.885953232913233"/>
        <property id="log2FoldChange" value="-0.174697550085536"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="59"/>
        <property id="pool2_count" value="21"/>
        <property id="pval" value="0.924599540138368"/>
        <property id="rank" value="103"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002173" confidence="" id="2173" length="1621" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase; IPR011183:Pyrophosphate-dependent phosphofructokinase PfpB;</definition>
    <entry_features accession="TESTTEST002173">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.0229542527078"/>
        <property id="baseMeanA" value="17.1136248320923"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="1.10626964533081"/>
        <property id="log2FoldChange" value="0.145703075055233"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.955524204606142"/>
        <property id="rank" value="105"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002113" confidence="" id="2113" length="906" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006828:5-AMP-activated protein kinase, beta subunit, complex-interacting region;</definition>
    <entry_features accession="TESTTEST002113">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="15.3325952294202"/>
        <property id="baseMeanA" value="13.3105970916273"/>
        <property id="baseMeanB" value="17.354593367213"/>
        <property id="foldChange" value="1.30381779628274"/>
        <property id="log2FoldChange" value="0.382742272356082"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="11"/>
        <property id="pval" value="0.830582472542814"/>
        <property id="rank" value="77"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004870" confidence="" id="4870" length="986" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004870">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="16.7621829249696"/>
        <property id="baseMeanA" value="17.7474627888364"/>
        <property id="baseMeanB" value="15.7769030611027"/>
        <property id="foldChange" value="0.888966679283686"/>
        <property id="log2FoldChange" value="-0.169798750672696"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="0.983587297061382"/>
        <property id="rank" value="110"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002561" confidence="" id="2561" length="1778" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <entry_features accession="TESTTEST002561">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="39.8282224886301"/>
        <property id="baseMeanA" value="32.3257357939521"/>
        <property id="baseMeanB" value="47.3307091833081"/>
        <property id="foldChange" value="1.46418041293784"/>
        <property id="log2FoldChange" value="0.550093330134568"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="51"/>
        <property id="pool2_count" value="30"/>
        <property id="pval" value="0.608908357414475"/>
        <property id="rank" value="42"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000312" confidence="" id="312" length="1016" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016149:Casein kinase II, regulatory subunit, alpha-helical; IPR016150:Casein kinase II, regulatory subunit, beta-sheet;</definition>
    <entry_features accession="TESTTEST000312">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="10.1275981364063"/>
        <property id="baseMeanA" value="13.9444350483715"/>
        <property id="baseMeanB" value="6.31076122444108"/>
        <property id="foldChange" value="0.452564854908058"/>
        <property id="log2FoldChange" value="-1.14380354213975"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.601320367414311"/>
        <property id="rank" value="40"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002401" confidence="" id="2401" length="817" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <entry_features accession="TESTTEST002401">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="36.0804314341661"/>
        <property id="baseMeanA" value="50.0731985827885"/>
        <property id="baseMeanB" value="22.0876642855438"/>
        <property id="foldChange" value="0.44110751680912"/>
        <property id="log2FoldChange" value="-1.18079774962195"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="14"/>
        <property id="pval" value="0.304675503041179"/>
        <property id="rank" value="14"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001539" confidence="" id="1539" length="1356" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001539">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="53.118105823007"/>
        <property id="baseMeanA" value="49.4393606260443"/>
        <property id="baseMeanB" value="56.7968510199697"/>
        <property id="foldChange" value="1.14881847784353"/>
        <property id="log2FoldChange" value="0.20015085907761"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="78"/>
        <property id="pool2_count" value="36"/>
        <property id="pval" value="0.847815604538654"/>
        <property id="rank" value="84"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001889" confidence="" id="1889" length="961" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008145:Guanylate kinase/L-type calcium channel region;</definition>
    <entry_features accession="TESTTEST001889">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="16.1214403824753"/>
        <property id="baseMeanA" value="13.3105970916273"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="1.4223466868539"/>
        <property id="log2FoldChange" value="0.508273154439941"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.753444511512139"/>
        <property id="rank" value="58"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004574" confidence="" id="4574" length="1450" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004574">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="28.1436478033639"/>
        <property id="baseMeanA" value="27.888870096743"/>
        <property id="baseMeanB" value="28.3984255099849"/>
        <property id="foldChange" value="1.01827092354313"/>
        <property id="log2FoldChange" value="0.0261214593025606"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="44"/>
        <property id="pool2_count" value="18"/>
        <property id="pval" value="1"/>
        <property id="rank" value="123"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST012608" confidence="" id="12608" length="644" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006206:Mevalonate/galactokinase; IPR014721:Ribosomal protein S5 domain 2-type fold, subgroup;</definition>
    <entry_features accession="TESTTEST012608">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="66.1186885220124"/>
        <property id="baseMeanA" value="78.5959066362756"/>
        <property id="baseMeanB" value="53.6414704077492"/>
        <property id="foldChange" value="0.682496998933927"/>
        <property id="log2FoldChange" value="-0.55110539263899"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="124"/>
        <property id="pool2_count" value="34"/>
        <property id="pval" value="0.58292602561585"/>
        <property id="rank" value="37"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011700" confidence="" id="11700" length="564" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST011700">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="23.3967677135329"/>
        <property id="baseMeanA" value="21.5504905293014"/>
        <property id="baseMeanB" value="25.2430448977643"/>
        <property id="foldChange" value="1.17134433035027"/>
        <property id="log2FoldChange" value="0.228165235247206"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="34"/>
        <property id="pool2_count" value="16"/>
        <property id="pval" value="0.883194534660355"/>
        <property id="rank" value="87"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001627" confidence="" id="1627" length="1256" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST001627">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="27.0309790861866"/>
        <property id="baseMeanA" value="24.085842356278"/>
        <property id="baseMeanB" value="29.9761158160951"/>
        <property id="foldChange" value="1.24455335099716"/>
        <property id="log2FoldChange" value="0.315628076497545"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="19"/>
        <property id="pval" value="0.811571068050835"/>
        <property id="rank" value="72"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001720" confidence="" id="1720" length="648" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000623:Shikimate kinase;</definition>
    <entry_features accession="TESTTEST001720">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="38.4607760648318"/>
        <property id="baseMeanA" value="56.4115781502301"/>
        <property id="baseMeanB" value="20.5099739794335"/>
        <property id="foldChange" value="0.363577383437373"/>
        <property id="log2FoldChange" value="-1.45966563632776"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="89"/>
        <property id="pool2_count" value="13"/>
        <property id="pval" value="0.193966243605507"/>
        <property id="rank" value="6"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006552" confidence="" id="6552" length="759" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001772:Kinase-associated KA1;</definition>
    <entry_features accession="TESTTEST006552">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="24.967553433893"/>
        <property id="baseMeanA" value="18.3813007455806"/>
        <property id="baseMeanB" value="31.5538061222054"/>
        <property id="foldChange" value="1.71662531172022"/>
        <property id="log2FoldChange" value="0.779575176257336"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="20"/>
        <property id="pval" value="0.532729755855814"/>
        <property id="rank" value="33"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001383" confidence="" id="1383" length="1357" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001412:Aminoacyl-tRNA synthetase, class I, conserved site; IPR011147:Bifunctional aspartokinase/homoserine dehydrogenase I; IPR016040:NAD(P)-binding domain;</definition>
    <entry_features accession="TESTTEST001383">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="29.0667863954797"/>
        <property id="baseMeanA" value="17.1136248320923"/>
        <property id="baseMeanB" value="41.019947958867"/>
        <property id="foldChange" value="2.39691756488342"/>
        <property id="log2FoldChange" value="1.26118029247517"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="26"/>
        <property id="pval" value="0.27965512988234"/>
        <property id="rank" value="12"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002989" confidence="" id="2989" length="800" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <entry_features accession="TESTTEST002989">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="10.2826053327173"/>
        <property id="baseMeanA" value="12.6767591348832"/>
        <property id="baseMeanB" value="7.88845153055135"/>
        <property id="foldChange" value="0.62227667549858"/>
        <property id="log2FoldChange" value="-0.684371923502454"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.787127309356642"/>
        <property id="rank" value="64"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005798" confidence="" id="5798" length="804" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST005798">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.8256085772631"/>
        <property id="baseMeanA" value="23.4520043995339"/>
        <property id="baseMeanB" value="14.1992127549924"/>
        <property id="foldChange" value="0.605458386971591"/>
        <property id="log2FoldChange" value="-0.723900287689092"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="37"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="0.651841070077045"/>
        <property id="rank" value="50"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002143" confidence="" id="2143" length="680" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016150:Casein kinase II, regulatory subunit, beta-sheet;</definition>
    <entry_features accession="TESTTEST002143">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="20.8752250580565"/>
        <property id="baseMeanA" value="22.8181664427897"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="0.829702233998107"/>
        <property id="log2FoldChange" value="-0.269334424223611"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="36"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.903229012723541"/>
        <property id="rank" value="92"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST015237" confidence="" id="15237" length="558" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <entry_features accession="TESTTEST015237">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="23.03842122066"/>
        <property id="baseMeanA" value="1.90151387023247"/>
        <property id="baseMeanB" value="44.1753285710876"/>
        <property id="foldChange" value="23.231662551947"/>
        <property id="log2FoldChange" value="4.53802049783399"/>
        <property id="padj" value="0.251347161079813"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="28"/>
        <property id="pval" value="0.00199481873872867"/>
        <property id="rank" value="1"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004597" confidence="" id="4597" length="999" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004597">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="10.5995243110893"/>
        <property id="baseMeanA" value="13.3105970916273"/>
        <property id="baseMeanB" value="7.88845153055135"/>
        <property id="foldChange" value="0.59264445285579"/>
        <property id="log2FoldChange" value="-0.754761251393853"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.749983676927994"/>
        <property id="rank" value="56"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003485" confidence="" id="3485" length="578" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST003485">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.0291120066388"/>
        <property id="baseMeanA" value="17.7474627888364"/>
        <property id="baseMeanB" value="6.31076122444108"/>
        <property id="foldChange" value="0.355586671713474"/>
        <property id="log2FoldChange" value="-1.49172684556006"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.4309889399081"/>
        <property id="rank" value="20"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002218" confidence="" id="2218" length="841" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST002218">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="34.4613136135551"/>
        <property id="baseMeanA" value="31.0580598804638"/>
        <property id="baseMeanB" value="37.8645673466465"/>
        <property id="foldChange" value="1.21915430301763"/>
        <property id="log2FoldChange" value="0.285880733103493"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="49"/>
        <property id="pool2_count" value="24"/>
        <property id="pval" value="0.811108897882908"/>
        <property id="rank" value="71"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000388" confidence="" id="388" length="1195" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST000388">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="29.3906099596019"/>
        <property id="baseMeanA" value="20.9166525725572"/>
        <property id="baseMeanB" value="37.8645673466465"/>
        <property id="foldChange" value="1.81025941963223"/>
        <property id="log2FoldChange" value="0.856196457860248"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="24"/>
        <property id="pval" value="0.464547867085753"/>
        <property id="rank" value="25"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001183" confidence="" id="1183" length="1661" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001183">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="44.4200953821502"/>
        <property id="baseMeanA" value="39.931791274882"/>
        <property id="baseMeanB" value="48.9083994894184"/>
        <property id="foldChange" value="1.22479853590197"/>
        <property id="log2FoldChange" value="0.292544463384504"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="63"/>
        <property id="pool2_count" value="31"/>
        <property id="pval" value="0.785984964917677"/>
        <property id="rank" value="63"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004119" confidence="" id="4119" length="1118" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004119">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="26.4040457151925"/>
        <property id="baseMeanA" value="25.9873562265105"/>
        <property id="baseMeanB" value="26.8207352038746"/>
        <property id="foldChange" value="1.03206863253423"/>
        <property id="log2FoldChange" value="0.045538913129801"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="17"/>
        <property id="pval" value="1"/>
        <property id="rank" value="124"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003221" confidence="" id="3221" length="1430" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST003221">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="15.8252351613536"/>
        <property id="baseMeanA" value="22.1843284860455"/>
        <property id="baseMeanB" value="9.46614183666162"/>
        <property id="foldChange" value="0.426704006056169"/>
        <property id="log2FoldChange" value="-1.22869243972626"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.454454791069039"/>
        <property id="rank" value="24"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST015285" confidence="" id="15285" length="540" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST015285">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="11.8602956388275"/>
        <property id="baseMeanA" value="12.6767591348832"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.871187345698012"/>
        <property id="log2FoldChange" value="-0.198945096332213"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.998181290485696"/>
        <property id="rank" value="113"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003927" confidence="" id="3927" length="939" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <entry_features accession="TESTTEST003927">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="45.4706228275764"/>
        <property id="baseMeanA" value="15.2121109618598"/>
        <property id="baseMeanB" value="75.729134693293"/>
        <property id="foldChange" value="4.97821340398864"/>
        <property id="log2FoldChange" value="2.31562807649755"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="48"/>
        <property id="pval" value="0.0268333144621233"/>
        <property id="rank" value="3"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000737" confidence="" id="737" length="1211" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL domain;</definition>
    <entry_features accession="TESTTEST000737">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="21.8259819931727"/>
        <property id="baseMeanA" value="24.7196803130222"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="0.765878985229022"/>
        <property id="log2FoldChange" value="-0.384811641643547"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.825968679343558"/>
        <property id="rank" value="75"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001017" confidence="" id="1017" length="1032" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR003594:ATP-binding region, ATPase-like; IPR004358:Signal transduction histidine kinase-related protein, C-terminal;</definition>
    <entry_features accession="TESTTEST001017">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="21.8259819931727"/>
        <property id="baseMeanA" value="24.7196803130222"/>
        <property id="baseMeanB" value="18.9322836733232"/>
        <property id="foldChange" value="0.765878985229022"/>
        <property id="log2FoldChange" value="-0.384811641643547"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.825968679343558"/>
        <property id="rank" value="76"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000339" confidence="" id="339" length="1588" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000339">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="24.0375102560271"/>
        <property id="baseMeanA" value="25.9873562265105"/>
        <property id="baseMeanB" value="22.0876642855438"/>
        <property id="foldChange" value="0.849938873851719"/>
        <property id="log2FoldChange" value="-0.234569006062934"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="14"/>
        <property id="pval" value="0.912314034156414"/>
        <property id="rank" value="93"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008417" confidence="" id="8417" length="822" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST008417">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.4879758416407"/>
        <property id="baseMeanA" value="13.3105970916273"/>
        <property id="baseMeanB" value="23.6653545916541"/>
        <property id="foldChange" value="1.77793335856737"/>
        <property id="log2FoldChange" value="0.830201249327304"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="15"/>
        <property id="pval" value="0.557563314000106"/>
        <property id="rank" value="34"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001448" confidence="" id="1448" length="1192" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001448">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="51.0684893422137"/>
        <property id="baseMeanA" value="50.0731985827885"/>
        <property id="baseMeanB" value="52.0637801016389"/>
        <property id="foldChange" value="1.03975343247864"/>
        <property id="log2FoldChange" value="0.056241447678896"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="33"/>
        <property id="pval" value="0.968485645356437"/>
        <property id="rank" value="107"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000518" confidence="" id="518" length="1351" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000518">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="36.6590327049093"/>
        <property id="baseMeanA" value="25.9873562265105"/>
        <property id="baseMeanB" value="47.3307091833081"/>
        <property id="foldChange" value="1.82129758682511"/>
        <property id="log2FoldChange" value="0.86496666748798"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="30"/>
        <property id="pval" value="0.426406400103085"/>
        <property id="rank" value="19"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002069" confidence="" id="2069" length="608" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000789:Cyclin-dependent kinase, regulatory subunit;</definition>
    <entry_features accession="TESTTEST002069">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="168.524254084561"/>
        <property id="baseMeanA" value="157.191813272551"/>
        <property id="baseMeanB" value="179.856694896571"/>
        <property id="foldChange" value="1.14418614527158"/>
        <property id="log2FoldChange" value="0.194321780275412"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="248"/>
        <property id="pool2_count" value="114"/>
        <property id="pval" value="0.806190188127001"/>
        <property id="rank" value="68"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000533" confidence="" id="533" length="2542" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000533">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="31.9259617865785"/>
        <property id="baseMeanA" value="25.9873562265105"/>
        <property id="baseMeanB" value="37.8645673466465"/>
        <property id="foldChange" value="1.45703806946009"/>
        <property id="log2FoldChange" value="0.543038572600618"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="24"/>
        <property id="pval" value="0.640233887733074"/>
        <property id="rank" value="47"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST014790" confidence="" id="14790" length="992" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST014790">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="21.8052682359223"/>
        <property id="baseMeanA" value="15.2121109618598"/>
        <property id="baseMeanB" value="28.3984255099849"/>
        <property id="foldChange" value="1.86683002649574"/>
        <property id="log2FoldChange" value="0.900590577218702"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="18"/>
        <property id="pval" value="0.491798578987697"/>
        <property id="rank" value="28"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST014061" confidence="" id="14061" length="499" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core;</definition>
    <entry_features accession="TESTTEST014061">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="16.6071757286586"/>
        <property id="baseMeanA" value="19.0151387023248"/>
        <property id="baseMeanB" value="14.1992127549924"/>
        <property id="foldChange" value="0.746732010598296"/>
        <property id="log2FoldChange" value="-0.421337517668661"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="0.839675792362038"/>
        <property id="rank" value="82"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003004" confidence="" id="3004" length="692" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006259:Adenylate kinase, subfamily; IPR007862:Adenylate kinase, zinc-finger lid region;</definition>
    <entry_features accession="TESTTEST003004">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="53.7657529512515"/>
        <property id="baseMeanA" value="57.0454161069743"/>
        <property id="baseMeanB" value="50.4860897955287"/>
        <property id="foldChange" value="0.885015716264647"/>
        <property id="log2FoldChange" value="-0.176225019832129"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="90"/>
        <property id="pool2_count" value="32"/>
        <property id="pval" value="0.897590216798552"/>
        <property id="rank" value="90"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001542" confidence="" id="1542" length="1285" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001542">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="54.0757673438734"/>
        <property id="baseMeanA" value="54.5100642799976"/>
        <property id="baseMeanB" value="53.6414704077492"/>
        <property id="foldChange" value="0.984065440323336"/>
        <property id="log2FoldChange" value="-0.0231738369542132"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="86"/>
        <property id="pool2_count" value="34"/>
        <property id="pval" value="1"/>
        <property id="rank" value="125"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003103" confidence="" id="3103" length="928" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase;</definition>
    <entry_features accession="TESTTEST003103">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="27.3478980645587"/>
        <property id="baseMeanA" value="24.7196803130222"/>
        <property id="baseMeanB" value="29.9761158160951"/>
        <property id="foldChange" value="1.21264172661262"/>
        <property id="log2FoldChange" value="0.278153371078883"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="19"/>
        <property id="pval" value="0.836211798102917"/>
        <property id="rank" value="80"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003590" confidence="" id="3590" length="805" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST003590">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="11.0783550715225"/>
        <property id="baseMeanA" value="15.845948918604"/>
        <property id="baseMeanB" value="6.31076122444108"/>
        <property id="foldChange" value="0.398257072319091"/>
        <property id="log2FoldChange" value="-1.32822811327718"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.509577640243101"/>
        <property id="rank" value="31"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST043433" confidence="" id="43433" length="685" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006204:GHMP kinase;</definition>
    <entry_features accession="TESTTEST043433">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="11.8602956388275"/>
        <property id="baseMeanA" value="12.6767591348832"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.871187345698012"/>
        <property id="log2FoldChange" value="-0.198945096332213"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.998181290485696"/>
        <property id="rank" value="114"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005297" confidence="" id="5297" length="513" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST005297">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.4941335955717"/>
        <property id="baseMeanA" value="13.9444350483715"/>
        <property id="baseMeanB" value="11.0438321427719"/>
        <property id="foldChange" value="0.791988496089102"/>
        <property id="log2FoldChange" value="-0.336448620082148"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.922441011819771"/>
        <property id="rank" value="102"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005971" confidence="" id="5971" length="540" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST005971">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="15.1913972046094"/>
        <property id="baseMeanA" value="20.9166525725572"/>
        <property id="baseMeanB" value="9.46614183666162"/>
        <property id="foldChange" value="0.452564854908058"/>
        <property id="log2FoldChange" value="-1.14380354213975"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.498871542368439"/>
        <property id="rank" value="30"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST029496" confidence="" id="29496" length="316" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011611:Carbohydrate/purine kinase;</definition>
    <entry_features accession="TESTTEST029496">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="13.7549049233099"/>
        <property id="baseMeanA" value="13.3105970916273"/>
        <property id="baseMeanB" value="14.1992127549924"/>
        <property id="foldChange" value="1.06676001514042"/>
        <property id="log2FoldChange" value="0.0932356551610976"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="1"/>
        <property id="rank" value="126"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST010564" confidence="" id="10564" length="801" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase;</definition>
    <entry_features accession="TESTTEST010564">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="28.4536621959859"/>
        <property id="baseMeanA" value="25.3535182697663"/>
        <property id="baseMeanB" value="31.5538061222054"/>
        <property id="foldChange" value="1.24455335099716"/>
        <property id="log2FoldChange" value="0.315628076497546"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="40"/>
        <property id="pool2_count" value="20"/>
        <property id="pval" value="0.806762856241499"/>
        <property id="rank" value="69"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
</entry_db>
BIOSTestDifferentialGeneExpressionFromTable_Herbert2008 2017.05.28 02:03:58 Execution time: 19 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSTestDifferentialGeneExpressionFromTable_Herbert2008.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

statistics

Format

Show or HideShow perl code used to test statistics format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Herbert2008/test/BIOSTestDifferentialGeneExpressionFromTable_Herbert2008.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Herbert2008/test/BIOSTestDifferentialGeneExpressionFromTable_Herbert2008.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test statistics content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Herbert2008/test/BIOSTestDifferentialGeneExpressionFromTable_Herbert2008.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Herbert2008/test/BIOSTestDifferentialGeneExpressionFromTable_Herbert2008.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for statistics

<?xml version="1.0"?>
<entry_db>
  <entry accession="TESTTEST000710" confidence="" id="710" length="1329" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000710">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.627096E-01"/>
        <property id="chisprob" value="3.357500E-02"/>
        <property id="f_one" value="0.00546533416614616"/>
        <property id="f_two" value="0.00965250965250965"/>
        <property id="f_zero" value="0.0066711140760507"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="25"/>
        <property id="qvalue" value="1.585453E-01"/>
        <property id="rank" value="26"/>
        <property id="rstat" value="2.25812061892685"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008428" confidence="" id="8428" length="806" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015865:Riboflavin kinase;</definition>
    <entry_features accession="TESTTEST008428">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="5.655704E-01"/>
        <property id="chisprob" value="2.334100E-01"/>
        <property id="f_one" value="0.00437226733291693"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00389148321102958"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="5.655704E-01"/>
        <property id="rank" value="52"/>
        <property id="rstat" value="0.709990874616239"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020565" confidence="" id="20565" length="628" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal;</definition>
    <entry_features accession="TESTTEST020565">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.980298E-01"/>
        <property id="chisprob" value="8.988200E-02"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00400266844563042"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="6"/>
        <property id="qvalue" value="2.980298E-01"/>
        <property id="rank" value="38"/>
        <property id="rstat" value="1.43824215305687"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000743" confidence="" id="743" length="847" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR018485:Carbohydrate kinase, FGGY, C-terminal;</definition>
    <entry_features accession="TESTTEST000743">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.583737E-01"/>
        <property id="chisprob" value="8.671000E-01"/>
        <property id="f_one" value="0.00437226733291693"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.0044474093840338"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="9.530985E-01"/>
        <property id="rank" value="114"/>
        <property id="rstat" value="0.014002679442414"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000481" confidence="" id="481" length="2175" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000481">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.638777E-01"/>
        <property id="chisprob" value="8.644300E-01"/>
        <property id="f_one" value="0.00624609618988132"/>
        <property id="f_two" value="0.00656370656370656"/>
        <property id="f_zero" value="0.00633755837224817"/>
        <property id="pool1_count" value="40"/>
        <property id="pool2_count" value="17"/>
        <property id="qvalue" value="9.530985E-01"/>
        <property id="rank" value="113"/>
        <property id="rstat" value="0.0145752903358394"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007446" confidence="" id="7446" length="674" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002872:Proline dehydrogenase; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST007446">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.315370E-04"/>
        <property id="chisprob" value="2.639800E-05"/>
        <property id="f_one" value="0.00405996252342286"/>
        <property id="f_two" value="0"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="0"/>
        <property id="qvalue" value="8.315370E-04"/>
        <property id="rank" value="4"/>
        <property id="rstat" value="8.83050722356524"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011536" confidence="" id="11536" length="676" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000623:Shikimate kinase;</definition>
    <entry_features accession="TESTTEST011536">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.302336E-02"/>
        <property id="chisprob" value="1.033600E-03"/>
        <property id="f_one" value="0.00780762023735166"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00622637313764732"/>
        <property id="pool1_count" value="50"/>
        <property id="pool2_count" value="6"/>
        <property id="qvalue" value="1.302336E-02"/>
        <property id="rank" value="10"/>
        <property id="rstat" value="5.38315594213206"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001902" confidence="" id="1902" length="801" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR013750:GHMP kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST001902">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="4.690165E-01"/>
        <property id="chisprob" value="1.898400E-01"/>
        <property id="f_one" value="0.0173329169269207"/>
        <property id="f_two" value="0.0135135135135135"/>
        <property id="f_zero" value="0.0162330442517234"/>
        <property id="pool1_count" value="111"/>
        <property id="pool2_count" value="35"/>
        <property id="qvalue" value="4.690165E-01"/>
        <property id="rank" value="51"/>
        <property id="rstat" value="0.859434317438162"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000697" confidence="" id="697" length="983" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000697">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.310171E-02"/>
        <property id="chisprob" value="1.143800E-03"/>
        <property id="f_one" value="0.0109306683322923"/>
        <property id="f_two" value="0.00424710424710425"/>
        <property id="f_zero" value="0.00900600400266845"/>
        <property id="pool1_count" value="70"/>
        <property id="pool2_count" value="11"/>
        <property id="qvalue" value="1.310171E-02"/>
        <property id="rank" value="11"/>
        <property id="rstat" value="5.28947387976076"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005092" confidence="" id="5092" length="1334" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase; IPR018042:Aspartate kinase, conserved site;</definition>
    <entry_features accession="TESTTEST005092">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.931354E-01"/>
        <property id="chisprob" value="5.728200E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="7.672751E-01"/>
        <property id="rank" value="91"/>
        <property id="rstat" value="0.158992286830921"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST052293" confidence="" id="52293" length="323" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST052293">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.620485E-02"/>
        <property id="chisprob" value="3.327600E-03"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.000386100386100386"/>
        <property id="f_zero" value="0.00244607516121859"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="1"/>
        <property id="qvalue" value="2.620485E-02"/>
        <property id="rank" value="16"/>
        <property id="rstat" value="4.30926978844099"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001051" confidence="" id="1051" length="1172" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006082:Phosphoribulokinase;</definition>
    <entry_features accession="TESTTEST001051">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.021776E-01"/>
        <property id="chisprob" value="4.123900E-01"/>
        <property id="f_one" value="0.00515302935665209"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00478096508783634"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="10"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="74"/>
        <property id="rstat" value="0.335945085945378"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002945" confidence="" id="2945" length="1085" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001697:Pyruvate kinase; IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core; IPR018209:Pyruvate kinase, active si</definition>
    <entry_features accession="TESTTEST002945">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="4.331520E-03"/>
        <property id="chisprob" value="2.406400E-04"/>
        <property id="f_one" value="0.0145221736414741"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.0120080053368913"/>
        <property id="pool1_count" value="93"/>
        <property id="pool2_count" value="15"/>
        <property id="qvalue" value="4.331520E-03"/>
        <property id="rank" value="7"/>
        <property id="rstat" value="6.74187560883267"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002171" confidence="" id="2171" length="1756" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST002171">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.744753E-01"/>
        <property id="chisprob" value="5.470500E-01"/>
        <property id="f_one" value="0.0110868207370394"/>
        <property id="f_two" value="0.00965250965250965"/>
        <property id="f_zero" value="0.0106737825216811"/>
        <property id="pool1_count" value="71"/>
        <property id="pool2_count" value="25"/>
        <property id="qvalue" value="7.672751E-01"/>
        <property id="rank" value="89"/>
        <property id="rstat" value="0.181313244850242"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001694" confidence="" id="1694" length="1098" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001312:Hexokinase;</definition>
    <entry_features accession="TESTTEST001694">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.036630E-01"/>
        <property id="chisprob" value="3.741700E-01"/>
        <property id="f_one" value="0.00390381011867583"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00355792750722704"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="67"/>
        <property id="rstat" value="0.394888794311634"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009746" confidence="" id="9746" length="891" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase;</definition>
    <entry_features accession="TESTTEST009746">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.602892E-01"/>
        <property id="chisprob" value="7.100800E-01"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.00308880308880309"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="8"/>
        <property id="qvalue" value="8.544765E-01"/>
        <property id="rank" value="104"/>
        <property id="rstat" value="0.0690970057892425"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000569" confidence="" id="569" length="761" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001564:Nucleoside diphosphate kinase, core;</definition>
    <entry_features accession="TESTTEST000569">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.496280E-03"/>
        <property id="chisprob" value="4.640200E-04"/>
        <property id="f_one" value="0.00952529668956902"/>
        <property id="f_two" value="0.0189189189189189"/>
        <property id="f_zero" value="0.012230375806093"/>
        <property id="pool1_count" value="61"/>
        <property id="pool2_count" value="49"/>
        <property id="qvalue" value="6.496280E-03"/>
        <property id="rank" value="9"/>
        <property id="rstat" value="6.12747939010019"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001861" confidence="" id="1861" length="1486" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001861">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.703245E-01"/>
        <property id="chisprob" value="7.938100E-02"/>
        <property id="f_one" value="0.00702685821361649"/>
        <property id="f_two" value="0.0108108108108108"/>
        <property id="f_zero" value="0.00811652212586168"/>
        <property id="pool1_count" value="45"/>
        <property id="pool2_count" value="28"/>
        <property id="qvalue" value="2.703245E-01"/>
        <property id="rank" value="37"/>
        <property id="rstat" value="1.53876406920763"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000597" confidence="" id="597" length="1065" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000597">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.606671E-01"/>
        <property id="chisprob" value="3.093600E-01"/>
        <property id="f_one" value="0.00546533416614616"/>
        <property id="f_two" value="0.00733590733590734"/>
        <property id="f_zero" value="0.00600400266844563"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="19"/>
        <property id="qvalue" value="6.591480E-01"/>
        <property id="rank" value="59"/>
        <property id="rstat" value="0.516701944417014"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026720" confidence="" id="26720" length="513" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST026720">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.212275E-01"/>
        <property id="chisprob" value="4.121300E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00378029797642873"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="72"/>
        <property id="rstat" value="0.336321336743339"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001053" confidence="" id="1053" length="1004" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <entry_features accession="TESTTEST001053">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.267698E-01"/>
        <property id="chisprob" value="2.735900E-01"/>
        <property id="f_one" value="0.00655840099937539"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00600400266844563"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="6.155775E-01"/>
        <property id="rank" value="55"/>
        <property id="rstat" value="0.599328517521477"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007784" confidence="" id="7784" length="972" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST007784">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.725375E-01"/>
        <property id="chisprob" value="5.886000E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00333555703802535"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="10"/>
        <property id="qvalue" value="7.672751E-01"/>
        <property id="rank" value="96"/>
        <property id="rstat" value="0.146270941807257"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006664" confidence="" id="6664" length="563" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006206:Mevalonate/galactokinase; IPR014721:Ribosomal protein S5 domain 2-type fold, subgroup;</definition>
    <entry_features accession="TESTTEST006664">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="3.427786E-01"/>
        <property id="chisprob" value="1.169800E-01"/>
        <property id="f_one" value="0.00499687695190506"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="32"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="3.427786E-01"/>
        <property id="rank" value="43"/>
        <property id="rstat" value="1.22863100523123"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011563" confidence="" id="11563" length="659" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002891:Adenylylsulphate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST011563">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.845143E-01"/>
        <property id="chisprob" value="5.728200E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="7.672751E-01"/>
        <property id="rank" value="92"/>
        <property id="rstat" value="0.158992286830921"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026180" confidence="" id="26180" length="684" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016149:Casein kinase II, regulatory subunit, alpha-helical;</definition>
    <entry_features accession="TESTTEST026180">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.603400E-01"/>
        <property id="chisprob" value="7.169500E-01"/>
        <property id="f_one" value="0.00921299188007495"/>
        <property id="f_two" value="0.01003861003861"/>
        <property id="f_zero" value="0.00945074494107183"/>
        <property id="pool1_count" value="59"/>
        <property id="pool2_count" value="26"/>
        <property id="qvalue" value="8.544765E-01"/>
        <property id="rank" value="105"/>
        <property id="rstat" value="0.0657162055116758"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST018164" confidence="" id="18164" length="964" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008144:Guanylate kinase;</definition>
    <entry_features accession="TESTTEST018164">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="0.9926"/>
        <property id="chisprob" value="9.926000E-01"/>
        <property id="f_one" value="0.00890068707058089"/>
        <property id="f_two" value="0.00888030888030888"/>
        <property id="f_zero" value="0.0088948187680676"/>
        <property id="pool1_count" value="57"/>
        <property id="pool2_count" value="23"/>
        <property id="qvalue" value="0.9926"/>
        <property id="rank" value="126"/>
        <property id="rstat" value="4.3062882562464e-05"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004342" confidence="" id="4342" length="1181" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002573:Choline/ethanolamine kinase;</definition>
    <entry_features accession="TESTTEST004342">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.672751E-01"/>
        <property id="chisprob" value="5.906800E-01"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.0044474093840338"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="10"/>
        <property id="qvalue" value="7.672751E-01"/>
        <property id="rank" value="97"/>
        <property id="rstat" value="0.14463913803978"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007767" confidence="" id="7767" length="1068" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001844:Chaperonin Cpn60; IPR002423:Chaperonin Cpn60/TCP-1; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST007767">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.896120E-02"/>
        <property id="chisprob" value="2.106800E-03"/>
        <property id="f_one" value="0.0157713928794503"/>
        <property id="f_two" value="0.0258687258687259"/>
        <property id="f_zero" value="0.018679119412942"/>
        <property id="pool1_count" value="101"/>
        <property id="pool2_count" value="67"/>
        <property id="qvalue" value="1.896120E-02"/>
        <property id="rank" value="14"/>
        <property id="rstat" value="4.72704082171686"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008330" confidence="" id="8330" length="1706" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST008330">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.138058E-03"/>
        <property id="chisprob" value="4.532100E-04"/>
        <property id="f_one" value="0.0157713928794503"/>
        <property id="f_two" value="0.00694980694980695"/>
        <property id="f_zero" value="0.0132310429175006"/>
        <property id="pool1_count" value="101"/>
        <property id="pool2_count" value="18"/>
        <property id="qvalue" value="6.496280E-03"/>
        <property id="rank" value="8"/>
        <property id="rstat" value="6.14948900491221"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003951" confidence="" id="3951" length="861" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <entry_features accession="TESTTEST003951">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.087810E-01"/>
        <property id="chisprob" value="3.431400E-01"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.00400266844563042"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="13"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="61"/>
        <property id="rstat" value="0.449326937155447"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003779" confidence="" id="3779" length="792" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST003779">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.585453E-01"/>
        <property id="chisprob" value="3.397400E-02"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.00115830115830116"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="3"/>
        <property id="qvalue" value="1.585453E-01"/>
        <property id="rank" value="27"/>
        <property id="rstat" value="2.24799582565054"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST030037" confidence="" id="30037" length="772" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST030037">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="4.130609E-01"/>
        <property id="chisprob" value="1.508000E-01"/>
        <property id="f_one" value="0.00577763897564022"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00511452079163887"/>
        <property id="pool1_count" value="37"/>
        <property id="pool2_count" value="9"/>
        <property id="qvalue" value="3.995712E-01"/>
        <property id="rank" value="46"/>
        <property id="rstat" value="1.03206908801728"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000617" confidence="" id="617" length="1565" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST000617">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.463849E-01"/>
        <property id="chisprob" value="8.337200E-01"/>
        <property id="f_one" value="0.0109306683322923"/>
        <property id="f_two" value="0.0104247104247104"/>
        <property id="f_zero" value="0.010784967756282"/>
        <property id="pool1_count" value="70"/>
        <property id="pool2_count" value="27"/>
        <property id="qvalue" value="9.463849E-01"/>
        <property id="rank" value="111"/>
        <property id="rstat" value="0.0220348769280747"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000830" confidence="" id="830" length="1105" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015824:Phosphoglycerate kinase, N-terminal; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST000830">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.617041E-01"/>
        <property id="chisprob" value="6.975700E-01"/>
        <property id="f_one" value="0.0304497189256715"/>
        <property id="f_two" value="0.032046332046332"/>
        <property id="f_zero" value="0.0309094952190349"/>
        <property id="pool1_count" value="195"/>
        <property id="pool2_count" value="83"/>
        <property id="qvalue" value="8.544765E-01"/>
        <property id="rank" value="102"/>
        <property id="rstat" value="0.0755033866671444"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006838" confidence="" id="6838" length="1066" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008656:Inositol 1, 3, 4-trisphosphate 56-kinase;</definition>
    <entry_features accession="TESTTEST006838">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.625500E-01"/>
        <property id="chisprob" value="8.556000E-01"/>
        <property id="f_one" value="0.00452841973766396"/>
        <property id="f_two" value="0.00424710424710425"/>
        <property id="f_zero" value="0.0044474093840338"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="11"/>
        <property id="qvalue" value="9.530985E-01"/>
        <property id="rank" value="112"/>
        <property id="rstat" value="0.0165587480475075"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000857" confidence="" id="857" length="1447" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001805:Adenosine kinase; IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000857">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.506680E-01"/>
        <property id="chisprob" value="4.885300E-01"/>
        <property id="f_one" value="0.122579637726421"/>
        <property id="f_two" value="0.116988416988417"/>
        <property id="f_zero" value="0.120969535245719"/>
        <property id="pool1_count" value="785"/>
        <property id="pool2_count" value="303"/>
        <property id="qvalue" value="7.468469E-01"/>
        <property id="rank" value="82"/>
        <property id="rstat" value="0.239879902102601"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009902" confidence="" id="9902" length="670" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR015940:Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST009902">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.029831E-01"/>
        <property id="chisprob" value="3.626500E-01"/>
        <property id="f_one" value="0.00530918176139913"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00489215032243718"/>
        <property id="pool1_count" value="34"/>
        <property id="pool2_count" value="10"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="65"/>
        <property id="rstat" value="0.414349370134754"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001446" confidence="" id="1446" length="1219" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR008351:JNK MAP kinase; IPR011009:Protein kinase-like; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001446">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.691860E-01"/>
        <property id="chisprob" value="7.312200E-01"/>
        <property id="f_one" value="0.00593379138038726"/>
        <property id="f_two" value="0.00656370656370656"/>
        <property id="f_zero" value="0.00611518790304648"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="17"/>
        <property id="qvalue" value="8.544765E-01"/>
        <property id="rank" value="106"/>
        <property id="rstat" value="0.0589984877364138"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST035440" confidence="" id="35440" length="731" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST035440">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.760787E-01"/>
        <property id="chisprob" value="5.728200E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="7.672751E-01"/>
        <property id="rank" value="93"/>
        <property id="rstat" value="0.158992286830921"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002924" confidence="" id="2924" length="1482" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL doma</definition>
    <entry_features accession="TESTTEST002924">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.681400E-01"/>
        <property id="chisprob" value="7.096700E-01"/>
        <property id="f_one" value="0.00515302935665209"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.00533689126084056"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="15"/>
        <property id="qvalue" value="8.544765E-01"/>
        <property id="rank" value="103"/>
        <property id="rstat" value="0.0693026869678408"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001547" confidence="" id="1547" length="1145" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001547">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.164608E-01"/>
        <property id="chisprob" value="4.037200E-01"/>
        <property id="f_one" value="0.00374765771392879"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.00411385368023127"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="13"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="71"/>
        <property id="rstat" value="0.348605808933408"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003609" confidence="" id="3609" length="698" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015824:Phosphoglycerate kinase, N-terminal; IPR015911:Phosphoglycerate kinase, conserved site;</definition>
    <entry_features accession="TESTTEST003609">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.226138E-01"/>
        <property id="chisprob" value="2.866000E-01"/>
        <property id="f_one" value="0.00671455340412242"/>
        <property id="f_two" value="0.00888030888030888"/>
        <property id="f_zero" value="0.00733822548365577"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="23"/>
        <property id="qvalue" value="6.226138E-01"/>
        <property id="rank" value="58"/>
        <property id="rstat" value="0.567755066306174"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003288" confidence="" id="3288" length="778" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST003288">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.215584E-02"/>
        <property id="chisprob" value="2.637600E-03"/>
        <property id="f_one" value="0.00671455340412242"/>
        <property id="f_two" value="0.0135135135135135"/>
        <property id="f_zero" value="0.00867244829886591"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="35"/>
        <property id="qvalue" value="2.215584E-02"/>
        <property id="rank" value="15"/>
        <property id="rstat" value="4.52129249566597"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005404" confidence="" id="5404" length="1001" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001805:Adenosine kinase; IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST005404">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.031200E-01"/>
        <property id="chisprob" value="3.515600E-01"/>
        <property id="f_one" value="0.014053716427233"/>
        <property id="f_two" value="0.0115830115830116"/>
        <property id="f_zero" value="0.0133422281521014"/>
        <property id="pool1_count" value="90"/>
        <property id="pool2_count" value="30"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="63"/>
        <property id="rstat" value="0.433917414119343"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008959" confidence="" id="8959" length="1190" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST008959">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.947182E-01"/>
        <property id="chisprob" value="3.639000E-01"/>
        <property id="f_one" value="0.0148344784509681"/>
        <property id="f_two" value="0.0123552123552124"/>
        <property id="f_zero" value="0.0141205247943073"/>
        <property id="pool1_count" value="95"/>
        <property id="pool2_count" value="32"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="66"/>
        <property id="rstat" value="0.412202471122243"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001387" confidence="" id="1387" length="1222" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR005935:Diphosphomevalonate decarboxylase; IPR006204:GHMP kinase;</definition>
    <entry_features accession="TESTTEST001387">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.702365E-01"/>
        <property id="chisprob" value="3.242600E-02"/>
        <property id="f_one" value="0.00546533416614616"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00455859461863465"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="6"/>
        <property id="qvalue" value="1.585453E-01"/>
        <property id="rank" value="24"/>
        <property id="rstat" value="2.28790437093526"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000534" confidence="" id="534" length="2048" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site; IPR002655:Acyl-CoA oxidase, C-terminal; IPR006089:Acyl-CoA dehydrogenase, conserved site; IPR006090:Acyl-CoA oxidase/dehydrogenase, type 1; I</definition>
    <entry_features accession="TESTTEST000534">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.338280E-09"/>
        <property id="chisprob" value="2.223400E-10"/>
        <property id="f_one" value="0.0135852592129919"/>
        <property id="f_two" value="0.00115830115830116"/>
        <property id="f_zero" value="0.0100066711140761"/>
        <property id="pool1_count" value="87"/>
        <property id="pool2_count" value="3"/>
        <property id="qvalue" value="9.338280E-09"/>
        <property id="rank" value="3"/>
        <property id="rstat" value="20.1299080067626"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020362" confidence="" id="20362" length="751" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST020362">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.113477E-01"/>
        <property id="chisprob" value="4.121300E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00378029797642873"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="73"/>
        <property id="rstat" value="0.336321336743339"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000814" confidence="" id="814" length="583" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000814">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.779975E-01"/>
        <property id="chisprob" value="9.469500E-01"/>
        <property id="f_one" value="0.00452841973766396"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00455859461863465"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="9.779975E-01"/>
        <property id="rank" value="122"/>
        <property id="rstat" value="0.00221378703933683"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016392" confidence="" id="16392" length="811" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase;</definition>
    <entry_features accession="TESTTEST016392">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.851856E-01"/>
        <property id="chisprob" value="3.233400E-02"/>
        <property id="f_one" value="0.00374765771392879"/>
        <property id="f_two" value="0.00733590733590734"/>
        <property id="f_zero" value="0.00478096508783634"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="19"/>
        <property id="qvalue" value="1.585453E-01"/>
        <property id="rank" value="22"/>
        <property id="rstat" value="2.29036143493134"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000469" confidence="" id="469" length="1179" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR011990:Tetratricopeptide-like helical;</definition>
    <entry_features accession="TESTTEST000469">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.530985E-01"/>
        <property id="chisprob" value="8.850200E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00308880308880309"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="8"/>
        <property id="qvalue" value="9.530985E-01"/>
        <property id="rank" value="117"/>
        <property id="rstat" value="0.0104557146143752"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002489" confidence="" id="2489" length="961" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR014746:Glutamine synthetase/guanido kinase, catalytic region;</definition>
    <entry_features accession="TESTTEST002489">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="3.765682E-01"/>
        <property id="chisprob" value="1.315000E-01"/>
        <property id="f_one" value="0.00405996252342286"/>
        <property id="f_two" value="0.00656370656370656"/>
        <property id="f_zero" value="0.00478096508783634"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="17"/>
        <property id="qvalue" value="3.765682E-01"/>
        <property id="rank" value="44"/>
        <property id="rstat" value="1.13733590108644"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003730" confidence="" id="3730" length="1142" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <entry_features accession="TESTTEST003730">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.922195E-01"/>
        <property id="chisprob" value="9.764700E-01"/>
        <property id="f_one" value="0.00390381011867583"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00389148321102958"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="10"/>
        <property id="qvalue" value="9.847555E-01"/>
        <property id="rank" value="124"/>
        <property id="rstat" value="0.000434856237875633"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020686" confidence="" id="20686" length="579" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST020686">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.563558E-01"/>
        <property id="chisprob" value="5.102400E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="6"/>
        <property id="qvalue" value="7.468469E-01"/>
        <property id="rank" value="85"/>
        <property id="rstat" value="0.216789037992981"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009956" confidence="" id="9956" length="620" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011611:Carbohydrate/purine kinase;</definition>
    <entry_features accession="TESTTEST009956">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.055664E-01"/>
        <property id="chisprob" value="4.199800E-01"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="9"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="75"/>
        <property id="rstat" value="0.32518355698947"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000971" confidence="" id="971" length="1250" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST000971">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.880802E-01"/>
        <property id="chisprob" value="4.478100E-02"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.00772200772200772"/>
        <property id="f_zero" value="0.00522570602623972"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="20"/>
        <property id="qvalue" value="1.880802E-01"/>
        <property id="rank" value="30"/>
        <property id="rstat" value="2.01344194234462"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003711" confidence="" id="3711" length="1471" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase; IPR001057:Glutamate 5-kinase;</definition>
    <entry_features accession="TESTTEST003711">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.880582E-01"/>
        <property id="chisprob" value="4.204800E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.00424710424710425"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="11"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="77"/>
        <property id="rstat" value="0.324485936111073"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001519" confidence="" id="1519" length="689" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST001519">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.750109E-01"/>
        <property id="chisprob" value="9.363200E-01"/>
        <property id="f_one" value="0.0106183635227983"/>
        <property id="f_two" value="0.0108108108108108"/>
        <property id="f_zero" value="0.0106737825216811"/>
        <property id="pool1_count" value="68"/>
        <property id="pool2_count" value="28"/>
        <property id="qvalue" value="9.750109E-01"/>
        <property id="rank" value="121"/>
        <property id="rstat" value="0.00319134836186136"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004389" confidence="" id="4389" length="852" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST004389">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="4.108650E-01"/>
        <property id="chisprob" value="1.565200E-01"/>
        <property id="f_one" value="0.00671455340412242"/>
        <property id="f_two" value="0.00965250965250965"/>
        <property id="f_zero" value="0.00756059595285746"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="25"/>
        <property id="qvalue" value="3.995712E-01"/>
        <property id="rank" value="48"/>
        <property id="rstat" value="1.00377236868372"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST010712" confidence="" id="10712" length="639" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR009286:Inositol-pentakisphosphate 2-kinase;</definition>
    <entry_features accession="TESTTEST010712">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.496550E-01"/>
        <property id="chisprob" value="4.997700E-01"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00333555703802535"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="7.468469E-01"/>
        <property id="rank" value="84"/>
        <property id="rstat" value="0.227717792275552"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000063" confidence="" id="63" length="2073" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000063">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.522206E-01"/>
        <property id="chisprob" value="2.416200E-02"/>
        <property id="f_one" value="0.0287320424734541"/>
        <property id="f_two" value="0.0382239382239382"/>
        <property id="f_zero" value="0.0314654213920391"/>
        <property id="pool1_count" value="184"/>
        <property id="pool2_count" value="99"/>
        <property id="qvalue" value="1.522206E-01"/>
        <property id="rank" value="20"/>
        <property id="rstat" value="2.54147433279609"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016344" confidence="" id="16344" length="908" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR018483:Carbohydrate kinase, FGGY, conserved site;</definition>
    <entry_features accession="TESTTEST016344">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.120604E-01"/>
        <property id="chisprob" value="1.689800E-02"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00154440154440154"/>
        <property id="f_zero" value="0.00378029797642873"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="4"/>
        <property id="qvalue" value="1.120604E-01"/>
        <property id="rank" value="19"/>
        <property id="rstat" value="2.85348710436444"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026919" confidence="" id="26919" length="494" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST026919">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.666106E-01"/>
        <property id="chisprob" value="9.129100E-01"/>
        <property id="f_one" value="0.00484072454715803"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.00489215032243718"/>
        <property id="pool1_count" value="31"/>
        <property id="pool2_count" value="13"/>
        <property id="qvalue" value="9.666106E-01"/>
        <property id="rank" value="119"/>
        <property id="rstat" value="0.00598034755338916"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011337" confidence="" id="11337" length="1040" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST011337">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="4.091442E-02"/>
        <property id="chisprob" value="5.520200E-03"/>
        <property id="f_one" value="0.00733916302311056"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00600400266844563"/>
        <property id="pool1_count" value="47"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="4.091442E-02"/>
        <property id="rank" value="17"/>
        <property id="rstat" value="3.85030847880885"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006591" confidence="" id="6591" length="686" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <entry_features accession="TESTTEST006591">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.019600E-01"/>
        <property id="chisprob" value="5.610000E-02"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00115830115830116"/>
        <property id="f_zero" value="0.00266844563042028"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="3"/>
        <property id="qvalue" value="2.019600E-01"/>
        <property id="rank" value="35"/>
        <property id="rstat" value="1.82454832525172"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009115" confidence="" id="9115" length="723" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal; IPR015994:Phosphoenolpyruv</definition>
    <entry_features accession="TESTTEST009115">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.325750E-03"/>
        <property id="chisprob" value="1.107500E-04"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0"/>
        <property id="f_zero" value="0.00244607516121859"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="0"/>
        <property id="qvalue" value="2.325750E-03"/>
        <property id="rank" value="6"/>
        <property id="rstat" value="7.47196765070904"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016716" confidence="" id="16716" length="590" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST016716">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.406820E-01"/>
        <property id="chisprob" value="6.738800E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="10"/>
        <property id="qvalue" value="8.406820E-01"/>
        <property id="rank" value="101"/>
        <property id="rstat" value="0.0885496669584942"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001164" confidence="" id="1164" length="735" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core;</definition>
    <entry_features accession="TESTTEST001164">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="3.772440E-01"/>
        <property id="chisprob" value="1.347300E-01"/>
        <property id="f_one" value="0.00562148657089319"/>
        <property id="f_two" value="0.00849420849420849"/>
        <property id="f_zero" value="0.00644874360684901"/>
        <property id="pool1_count" value="36"/>
        <property id="pool2_count" value="22"/>
        <property id="qvalue" value="3.772440E-01"/>
        <property id="rank" value="45"/>
        <property id="rstat" value="1.11857318033182"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000348" confidence="" id="348" length="1510" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000348">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.071159E-01"/>
        <property id="chisprob" value="3.591700E-01"/>
        <property id="f_one" value="0.00733916302311056"/>
        <property id="f_two" value="0.00926640926640927"/>
        <property id="f_zero" value="0.00789415165666"/>
        <property id="pool1_count" value="47"/>
        <property id="pool2_count" value="24"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="64"/>
        <property id="rstat" value="0.420393423139942"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000756" confidence="" id="756" length="1433" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000756">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.833857E-01"/>
        <property id="chisprob" value="6.093000E-01"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.0044474093840338"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="13"/>
        <property id="qvalue" value="7.784382E-01"/>
        <property id="rank" value="98"/>
        <property id="rstat" value="0.130598545620591"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001621" confidence="" id="1621" length="1838" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001621">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.155775E-01"/>
        <property id="chisprob" value="2.735900E-01"/>
        <property id="f_one" value="0.00655840099937539"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00600400266844563"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="6.155775E-01"/>
        <property id="rank" value="56"/>
        <property id="rstat" value="0.599328517521477"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003722" confidence="" id="3722" length="1245" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase;</definition>
    <entry_features accession="TESTTEST003722">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="3.171258E-01"/>
        <property id="chisprob" value="9.815800E-02"/>
        <property id="f_one" value="0.0113991255465334"/>
        <property id="f_two" value="0.0158301158301158"/>
        <property id="f_zero" value="0.0126751167444963"/>
        <property id="pool1_count" value="73"/>
        <property id="pool2_count" value="41"/>
        <property id="qvalue" value="3.141716E-01"/>
        <property id="rank" value="39"/>
        <property id="rstat" value="1.36761034448199"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST046970" confidence="" id="46970" length="432" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase;</definition>
    <entry_features accession="TESTTEST046970">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.900115E-01"/>
        <property id="chisprob" value="4.271500E-01"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.00308880308880309"/>
        <property id="f_zero" value="0.00389148321102958"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="8"/>
        <property id="qvalue" value="6.900115E-01"/>
        <property id="rank" value="78"/>
        <property id="rstat" value="0.315286181301933"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST012447" confidence="" id="12447" length="799" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006204:GHMP kinase; IPR018260:Ribosomal protein L22/L17, conserved site;</definition>
    <entry_features accession="TESTTEST012447">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="3.995712E-01"/>
        <property id="chisprob" value="1.585600E-01"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.00422503891483211"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="15"/>
        <property id="qvalue" value="3.995712E-01"/>
        <property id="rank" value="50"/>
        <property id="rstat" value="0.993945646780058"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003801" confidence="" id="3801" length="717" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001564:Nucleoside diphosphate kinase, core;</definition>
    <entry_features accession="TESTTEST003801">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.926377E-01"/>
        <property id="chisprob" value="4.739500E-02"/>
        <property id="f_one" value="0.0171767645221736"/>
        <property id="f_two" value="0.0115830115830116"/>
        <property id="f_zero" value="0.0155659328441183"/>
        <property id="pool1_count" value="110"/>
        <property id="pool2_count" value="30"/>
        <property id="qvalue" value="1.926377E-01"/>
        <property id="rank" value="31"/>
        <property id="rstat" value="1.96565515438514"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001295" confidence="" id="1295" length="1564" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001295">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.876966E-01"/>
        <property id="chisprob" value="4.320000E-02"/>
        <property id="f_one" value="0.00593379138038726"/>
        <property id="f_two" value="0.01003861003861"/>
        <property id="f_zero" value="0.00711585501445408"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="26"/>
        <property id="qvalue" value="1.876966E-01"/>
        <property id="rank" value="29"/>
        <property id="rstat" value="2.0437877938398"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002129" confidence="" id="2129" length="788" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST002129">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.847555E-01"/>
        <property id="chisprob" value="9.769400E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="9"/>
        <property id="qvalue" value="9.847555E-01"/>
        <property id="rank" value="125"/>
        <property id="rstat" value="0.000417795312056601"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007751" confidence="" id="7751" length="1579" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase; IPR011183:Pyrophosphate-dependent phosphofructokinase PfpB;</definition>
    <entry_features accession="TESTTEST007751">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.232800E-01"/>
        <property id="chisprob" value="2.819600E-01"/>
        <property id="f_one" value="0.00405996252342286"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.00455859461863465"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="15"/>
        <property id="qvalue" value="6.226138E-01"/>
        <property id="rank" value="57"/>
        <property id="rstat" value="0.578812683336337"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000946" confidence="" id="946" length="946" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000946">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.784382E-01"/>
        <property id="chisprob" value="6.116300E-01"/>
        <property id="f_one" value="0.00921299188007495"/>
        <property id="f_two" value="0.00810810810810811"/>
        <property id="f_zero" value="0.0088948187680676"/>
        <property id="pool1_count" value="59"/>
        <property id="pool2_count" value="21"/>
        <property id="qvalue" value="7.784382E-01"/>
        <property id="rank" value="99"/>
        <property id="rstat" value="0.128904373726038"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002173" confidence="" id="2173" length="1621" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase; IPR011183:Pyrophosphate-dependent phosphofructokinase PfpB;</definition>
    <entry_features accession="TESTTEST002173">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.014613E-01"/>
        <property id="chisprob" value="7.869900E-01"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="9.014613E-01"/>
        <property id="rank" value="110"/>
        <property id="rstat" value="0.0365108489407913"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002113" confidence="" id="2113" length="906" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006828:5-AMP-activated protein kinase, beta subunit, complex-interacting region;</definition>
    <entry_features accession="TESTTEST002113">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.490928E-01"/>
        <property id="chisprob" value="4.934500E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00424710424710425"/>
        <property id="f_zero" value="0.00355792750722704"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="11"/>
        <property id="qvalue" value="7.468469E-01"/>
        <property id="rank" value="83"/>
        <property id="rstat" value="0.234500999885469"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004870" confidence="" id="4870" length="986" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004870">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.634415E-01"/>
        <property id="chisprob" value="7.332400E-01"/>
        <property id="f_one" value="0.00437226733291693"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00422503891483211"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="10"/>
        <property id="qvalue" value="8.544765E-01"/>
        <property id="rank" value="107"/>
        <property id="rstat" value="0.0580782816075229"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002561" confidence="" id="2561" length="1778" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <entry_features accession="TESTTEST002561">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="3.300300E-01"/>
        <property id="chisprob" value="1.100100E-01"/>
        <property id="f_one" value="0.00796377264209869"/>
        <property id="f_two" value="0.0115830115830116"/>
        <property id="f_zero" value="0.00900600400266845"/>
        <property id="pool1_count" value="51"/>
        <property id="pool2_count" value="30"/>
        <property id="qvalue" value="3.300300E-01"/>
        <property id="rank" value="42"/>
        <property id="rstat" value="1.27702112336623"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000312" confidence="" id="312" length="1016" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016149:Casein kinase II, regulatory subunit, alpha-helical; IPR016150:Casein kinase II, regulatory subunit, beta-sheet;</definition>
    <entry_features accession="TESTTEST000312">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="3.329473E-01"/>
        <property id="chisprob" value="1.083400E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.00154440154440154"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="4"/>
        <property id="qvalue" value="3.300300E-01"/>
        <property id="rank" value="41"/>
        <property id="rstat" value="1.2891683310613"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002401" confidence="" id="2401" length="817" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <entry_features accession="TESTTEST002401">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.911420E-02"/>
        <property id="chisprob" value="1.820400E-03"/>
        <property id="f_one" value="0.0123360399750156"/>
        <property id="f_two" value="0.00540540540540541"/>
        <property id="f_zero" value="0.0103402268178786"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="14"/>
        <property id="qvalue" value="1.865091E-02"/>
        <property id="rank" value="12"/>
        <property id="rstat" value="4.86118403708424"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001539" confidence="" id="1539" length="1356" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001539">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.468469E-01"/>
        <property id="chisprob" value="5.156800E-01"/>
        <property id="f_one" value="0.0121798875702686"/>
        <property id="f_two" value="0.0138996138996139"/>
        <property id="f_zero" value="0.0126751167444963"/>
        <property id="pool1_count" value="78"/>
        <property id="pool2_count" value="36"/>
        <property id="qvalue" value="7.468469E-01"/>
        <property id="rank" value="87"/>
        <property id="rstat" value="0.211262074865829"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001889" confidence="" id="1889" length="961" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008145:Guanylate kinase/L-type calcium channel region;</definition>
    <entry_features accession="TESTTEST001889">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.073681E-01"/>
        <property id="chisprob" value="3.480700E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00366911274182789"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="62"/>
        <property id="rstat" value="0.440231970393868"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004574" confidence="" id="4574" length="1450" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004574">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.909849E-01"/>
        <property id="chisprob" value="9.673900E-01"/>
        <property id="f_one" value="0.00687070580886946"/>
        <property id="f_two" value="0.00694980694980695"/>
        <property id="f_zero" value="0.00689348454525239"/>
        <property id="pool1_count" value="44"/>
        <property id="pool2_count" value="18"/>
        <property id="qvalue" value="9.847555E-01"/>
        <property id="rank" value="123"/>
        <property id="rstat" value="0.000835590624113203"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST012608" confidence="" id="12608" length="644" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006206:Mevalonate/galactokinase; IPR014721:Ribosomal protein S5 domain 2-type fold, subgroup;</definition>
    <entry_features accession="TESTTEST012608">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.690065E-01"/>
        <property id="chisprob" value="3.755700E-02"/>
        <property id="f_one" value="0.0193628981886321"/>
        <property id="f_two" value="0.0131274131274131"/>
        <property id="f_zero" value="0.0175672670669335"/>
        <property id="pool1_count" value="124"/>
        <property id="pool2_count" value="34"/>
        <property id="qvalue" value="1.690065E-01"/>
        <property id="rank" value="28"/>
        <property id="rstat" value="2.16247714191554"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011700" confidence="" id="11700" length="564" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST011700">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.819560E-01"/>
        <property id="chisprob" value="6.206000E-01"/>
        <property id="f_one" value="0.00530918176139913"/>
        <property id="f_two" value="0.00617760617760618"/>
        <property id="f_zero" value="0.00555926173004225"/>
        <property id="pool1_count" value="34"/>
        <property id="pool2_count" value="16"/>
        <property id="qvalue" value="7.819560E-01"/>
        <property id="rank" value="100"/>
        <property id="rstat" value="0.122510492849409"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001627" confidence="" id="1627" length="1256" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST001627">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.092556E-01"/>
        <property id="chisprob" value="4.559500E-01"/>
        <property id="f_one" value="0.00593379138038726"/>
        <property id="f_two" value="0.00733590733590734"/>
        <property id="f_zero" value="0.00633755837224817"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="19"/>
        <property id="qvalue" value="7.092556E-01"/>
        <property id="rank" value="81"/>
        <property id="rstat" value="0.277914789433787"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001720" confidence="" id="1720" length="648" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000623:Shikimate kinase;</definition>
    <entry_features accession="TESTTEST001720">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.718072E-03"/>
        <property id="chisprob" value="1.078600E-04"/>
        <property id="f_one" value="0.0138975640224859"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.0113408939292862"/>
        <property id="pool1_count" value="89"/>
        <property id="pool2_count" value="13"/>
        <property id="qvalue" value="2.325750E-03"/>
        <property id="rank" value="5"/>
        <property id="rstat" value="7.49695465849689"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006552" confidence="" id="6552" length="759" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001772:Kinase-associated KA1;</definition>
    <entry_features accession="TESTTEST006552">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.532250E-01"/>
        <property id="chisprob" value="7.235000E-02"/>
        <property id="f_one" value="0.00452841973766396"/>
        <property id="f_two" value="0.00772200772200772"/>
        <property id="f_zero" value="0.00544807649544141"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="20"/>
        <property id="qvalue" value="2.532250E-01"/>
        <property id="rank" value="36"/>
        <property id="rstat" value="1.61443808921563"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001383" confidence="" id="1383" length="1357" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001412:Aminoacyl-tRNA synthetase, class I, conserved site; IPR011147:Bifunctional aspartokinase/homoserine dehydrogenase I; IPR016040:NAD(P)-binding domain;</definition>
    <entry_features accession="TESTTEST001383">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.865091E-02"/>
        <property id="chisprob" value="1.924300E-03"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.01003861003861"/>
        <property id="f_zero" value="0.00589281743384479"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="26"/>
        <property id="qvalue" value="1.865091E-02"/>
        <property id="rank" value="13"/>
        <property id="rstat" value="4.81017119775605"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002989" confidence="" id="2989" length="800" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <entry_features accession="TESTTEST002989">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.591480E-01"/>
        <property id="chisprob" value="3.138800E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.00193050193050193"/>
        <property id="f_zero" value="0.00277963086502112"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="5"/>
        <property id="qvalue" value="6.591480E-01"/>
        <property id="rank" value="60"/>
        <property id="rstat" value="0.507136339011599"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005798" confidence="" id="5798" length="804" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST005798">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="4.042723E-01"/>
        <property id="chisprob" value="1.508000E-01"/>
        <property id="f_one" value="0.00577763897564022"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00511452079163887"/>
        <property id="pool1_count" value="37"/>
        <property id="pool2_count" value="9"/>
        <property id="qvalue" value="3.995712E-01"/>
        <property id="rank" value="47"/>
        <property id="rstat" value="1.03206908801728"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002143" confidence="" id="2143" length="680" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016150:Casein kinase II, regulatory subunit, beta-sheet;</definition>
    <entry_features accession="TESTTEST002143">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.780360E-01"/>
        <property id="chisprob" value="5.557400E-01"/>
        <property id="f_one" value="0.00562148657089319"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00533689126084056"/>
        <property id="pool1_count" value="36"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="7.672751E-01"/>
        <property id="rank" value="90"/>
        <property id="rstat" value="0.173566965647737"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST015237" confidence="" id="15237" length="558" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <entry_features accession="TESTTEST015237">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.851628E-11"/>
        <property id="chisprob" value="5.437800E-13"/>
        <property id="f_one" value="0.000468457214241099"/>
        <property id="f_two" value="0.0108108108108108"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="28"/>
        <property id="qvalue" value="6.851628E-11"/>
        <property id="rank" value="1"/>
        <property id="rstat" value="26.0200592453506"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004597" confidence="" id="4597" length="999" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004597">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.118700E-01"/>
        <property id="chisprob" value="2.622300E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00193050193050193"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="5"/>
        <property id="qvalue" value="6.118700E-01"/>
        <property id="rank" value="54"/>
        <property id="rstat" value="0.628482586484194"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003485" confidence="" id="3485" length="578" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST003485">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.643940E-01"/>
        <property id="chisprob" value="2.739900E-02"/>
        <property id="f_one" value="0.00437226733291693"/>
        <property id="f_two" value="0.00154440154440154"/>
        <property id="f_zero" value="0.00355792750722704"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="4"/>
        <property id="qvalue" value="1.585453E-01"/>
        <property id="rank" value="21"/>
        <property id="rstat" value="2.43273110033563"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002218" confidence="" id="2218" length="841" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST002218">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.046077E-01"/>
        <property id="chisprob" value="4.473700E-01"/>
        <property id="f_one" value="0.00765146783260462"/>
        <property id="f_two" value="0.00926640926640927"/>
        <property id="f_zero" value="0.00811652212586168"/>
        <property id="pool1_count" value="49"/>
        <property id="pool2_count" value="24"/>
        <property id="qvalue" value="7.046077E-01"/>
        <property id="rank" value="80"/>
        <property id="rstat" value="0.288652602716833"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000388" confidence="" id="388" length="1195" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST000388">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.772765E-01"/>
        <property id="chisprob" value="3.236000E-02"/>
        <property id="f_one" value="0.00515302935665209"/>
        <property id="f_two" value="0.00926640926640927"/>
        <property id="f_zero" value="0.00633755837224817"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="24"/>
        <property id="qvalue" value="1.585453E-01"/>
        <property id="rank" value="23"/>
        <property id="rstat" value="2.28966616952841"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001183" confidence="" id="1183" length="1661" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001183">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.985032E-01"/>
        <property id="chisprob" value="3.769700E-01"/>
        <property id="f_one" value="0.00983760149906309"/>
        <property id="f_two" value="0.011969111969112"/>
        <property id="f_zero" value="0.0104514120524794"/>
        <property id="pool1_count" value="63"/>
        <property id="pool2_count" value="31"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="68"/>
        <property id="rstat" value="0.39027403255986"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004119" confidence="" id="4119" length="1118" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004119">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.778860E-01"/>
        <property id="chisprob" value="9.313200E-01"/>
        <property id="f_one" value="0.00640224859462836"/>
        <property id="f_two" value="0.00656370656370656"/>
        <property id="f_zero" value="0.00644874360684901"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="17"/>
        <property id="qvalue" value="9.750109E-01"/>
        <property id="rank" value="120"/>
        <property id="rstat" value="0.00371440874609852"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003221" confidence="" id="3221" length="1430" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST003221">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.634270E-01"/>
        <property id="chisprob" value="3.242600E-02"/>
        <property id="f_one" value="0.00546533416614616"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00455859461863465"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="6"/>
        <property id="qvalue" value="1.585453E-01"/>
        <property id="rank" value="25"/>
        <property id="rstat" value="2.28790437093526"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST015285" confidence="" id="15285" length="540" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST015285">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.623883E-01"/>
        <property id="chisprob" value="7.391900E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00300200133422282"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="8.544765E-01"/>
        <property id="rank" value="108"/>
        <property id="rstat" value="0.0554176850905632"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003927" confidence="" id="3927" length="939" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <entry_features accession="TESTTEST003927">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.911420E-09"/>
        <property id="chisprob" value="3.034000E-11"/>
        <property id="f_one" value="0.00374765771392879"/>
        <property id="f_two" value="0.0185328185328185"/>
        <property id="f_zero" value="0.00800533689126084"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="48"/>
        <property id="qvalue" value="1.911420E-09"/>
        <property id="rank" value="2"/>
        <property id="rstat" value="22.0774083264899"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000737" confidence="" id="737" length="1211" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL domain;</definition>
    <entry_features accession="TESTTEST000737">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.243174E-01"/>
        <property id="chisprob" value="3.966500E-01"/>
        <property id="f_one" value="0.00608994378513429"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.0056704469646431"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="69"/>
        <property id="rstat" value="0.359235314564282"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001017" confidence="" id="1017" length="1032" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR003594:ATP-binding region, ATPase-like; IPR004358:Signal transduction histidine kinase-related protein, C-terminal;</definition>
    <entry_features accession="TESTTEST001017">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.139700E-01"/>
        <property id="chisprob" value="3.966500E-01"/>
        <property id="f_one" value="0.00608994378513429"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.0056704469646431"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="12"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="70"/>
        <property id="rstat" value="0.359235314564282"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000339" confidence="" id="339" length="1588" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000339">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.685337E-01"/>
        <property id="chisprob" value="5.794500E-01"/>
        <property id="f_one" value="0.00640224859462836"/>
        <property id="f_two" value="0.00540540540540541"/>
        <property id="f_zero" value="0.00611518790304648"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="14"/>
        <property id="qvalue" value="7.672751E-01"/>
        <property id="rank" value="95"/>
        <property id="rstat" value="0.153560160399251"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008417" confidence="" id="8417" length="822" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST008417">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="3.141716E-01"/>
        <property id="chisprob" value="9.973700E-02"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.00400266844563042"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="15"/>
        <property id="qvalue" value="3.141716E-01"/>
        <property id="rank" value="40"/>
        <property id="rstat" value="1.3548723713561"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001448" confidence="" id="1448" length="1192" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001448">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.601638E-01"/>
        <property id="chisprob" value="8.763400E-01"/>
        <property id="f_one" value="0.0123360399750156"/>
        <property id="f_two" value="0.0127413127413127"/>
        <property id="f_zero" value="0.0124527462752946"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="33"/>
        <property id="qvalue" value="9.530985E-01"/>
        <property id="rank" value="115"/>
        <property id="rstat" value="0.012106669170998"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000518" confidence="" id="518" length="1351" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000518">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.103970E-01"/>
        <property id="chisprob" value="1.577100E-02"/>
        <property id="f_one" value="0.00640224859462836"/>
        <property id="f_two" value="0.0115830115830116"/>
        <property id="f_zero" value="0.00789415165666"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="30"/>
        <property id="qvalue" value="1.103970E-01"/>
        <property id="rank" value="18"/>
        <property id="rstat" value="2.9141299156959"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002069" confidence="" id="2069" length="608" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000789:Cyclin-dependent kinase, regulatory subunit;</definition>
    <entry_features accession="TESTTEST002069">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.222260E-01"/>
        <property id="chisprob" value="2.617300E-01"/>
        <property id="f_one" value="0.0387257963772642"/>
        <property id="f_two" value="0.044015444015444"/>
        <property id="f_zero" value="0.0402490549255059"/>
        <property id="pool1_count" value="248"/>
        <property id="pool2_count" value="114"/>
        <property id="qvalue" value="6.118700E-01"/>
        <property id="rank" value="53"/>
        <property id="rstat" value="0.629779642668607"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000533" confidence="" id="533" length="2542" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000533">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="4.059771E-01"/>
        <property id="chisprob" value="1.578800E-01"/>
        <property id="f_one" value="0.00640224859462836"/>
        <property id="f_two" value="0.00926640926640927"/>
        <property id="f_zero" value="0.00722704024905493"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="24"/>
        <property id="qvalue" value="3.995712E-01"/>
        <property id="rank" value="49"/>
        <property id="rstat" value="0.997200245076505"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST014790" confidence="" id="14790" length="992" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST014790">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.010769E-01"/>
        <property id="chisprob" value="5.266300E-02"/>
        <property id="f_one" value="0.00374765771392879"/>
        <property id="f_two" value="0.00694980694980695"/>
        <property id="f_zero" value="0.00466977985323549"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="18"/>
        <property id="qvalue" value="2.010769E-01"/>
        <property id="rank" value="33"/>
        <property id="rstat" value="1.87729366718457"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST014061" confidence="" id="14061" length="499" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core;</definition>
    <entry_features accession="TESTTEST014061">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="6.962826E-01"/>
        <property id="chisprob" value="4.199800E-01"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="9"/>
        <property id="qvalue" value="6.880582E-01"/>
        <property id="rank" value="76"/>
        <property id="rstat" value="0.32518355698947"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003004" confidence="" id="3004" length="692" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006259:Adenylate kinase, subfamily; IPR007862:Adenylate kinase, zinc-finger lid region;</definition>
    <entry_features accession="TESTTEST003004">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.550120E-01"/>
        <property id="chisprob" value="5.273100E-01"/>
        <property id="f_one" value="0.014053716427233"/>
        <property id="f_two" value="0.0123552123552124"/>
        <property id="f_zero" value="0.0135645986213031"/>
        <property id="pool1_count" value="90"/>
        <property id="pool2_count" value="32"/>
        <property id="qvalue" value="7.550120E-01"/>
        <property id="rank" value="88"/>
        <property id="rstat" value="0.19978615550828"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001542" confidence="" id="1542" length="1285" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001542">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.722822E-01"/>
        <property id="chisprob" value="9.105500E-01"/>
        <property id="f_one" value="0.0134291068082448"/>
        <property id="f_two" value="0.0131274131274131"/>
        <property id="f_zero" value="0.0133422281521014"/>
        <property id="pool1_count" value="86"/>
        <property id="pool2_count" value="34"/>
        <property id="qvalue" value="9.666106E-01"/>
        <property id="rank" value="118"/>
        <property id="rstat" value="0.00631062697407236"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003103" confidence="" id="3103" length="928" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase;</definition>
    <entry_features accession="TESTTEST003103">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.481030E-01"/>
        <property id="chisprob" value="5.106100E-01"/>
        <property id="f_one" value="0.00608994378513429"/>
        <property id="f_two" value="0.00733590733590734"/>
        <property id="f_zero" value="0.00644874360684901"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="19"/>
        <property id="qvalue" value="7.468469E-01"/>
        <property id="rank" value="86"/>
        <property id="rstat" value="0.216407466978429"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003590" confidence="" id="3590" length="805" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST003590">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="2.050687E-01"/>
        <property id="chisprob" value="5.533600E-02"/>
        <property id="f_one" value="0.00390381011867583"/>
        <property id="f_two" value="0.00154440154440154"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="4"/>
        <property id="qvalue" value="2.019600E-01"/>
        <property id="rank" value="34"/>
        <property id="rstat" value="1.8359655774763"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST043433" confidence="" id="43433" length="685" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006204:GHMP kinase;</definition>
    <entry_features accession="TESTTEST043433">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="8.544765E-01"/>
        <property id="chisprob" value="7.391900E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00300200133422282"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="8.544765E-01"/>
        <property id="rank" value="109"/>
        <property id="rstat" value="0.0554176850905632"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005297" confidence="" id="5297" length="513" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST005297">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.678226E-01"/>
        <property id="chisprob" value="5.728200E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="qvalue" value="7.672751E-01"/>
        <property id="rank" value="94"/>
        <property id="rstat" value="0.158992286830921"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005971" confidence="" id="5971" length="540" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST005971">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="1.938431E-01"/>
        <property id="chisprob" value="4.923000E-02"/>
        <property id="f_one" value="0.00515302935665209"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="6"/>
        <property id="qvalue" value="1.938431E-01"/>
        <property id="rank" value="32"/>
        <property id="rstat" value="1.93375249659195"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST029496" confidence="" id="29496" length="316" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011611:Carbohydrate/purine kinase;</definition>
    <entry_features accession="TESTTEST029496">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="9.610433E-01"/>
        <property id="chisprob" value="8.847700E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00333555703802535"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="9"/>
        <property id="qvalue" value="9.530985E-01"/>
        <property id="rank" value="116"/>
        <property id="rstat" value="0.0105020095818172"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST010564" confidence="" id="10564" length="801" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase;</definition>
    <entry_features accession="TESTTEST010564">
      <pattern definition="Herbert2008" type="test">
        <property id="adjustp" value="7.086782E-01"/>
        <property id="chisprob" value="4.443300E-01"/>
        <property id="f_one" value="0.00624609618988132"/>
        <property id="f_two" value="0.00772200772200772"/>
        <property id="f_zero" value="0.0066711140760507"/>
        <property id="pool1_count" value="40"/>
        <property id="pool2_count" value="20"/>
        <property id="qvalue" value="7.046077E-01"/>
        <property id="rank" value="79"/>
        <property id="rstat" value="0.292541883614513"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
</entry_db>
BIOSTestDifferentialGeneExpressionFromTable_Stekel2000 2017.05.28 02:04:19 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSTestDifferentialGeneExpressionFromTable_Stekel2000.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

statistics

Format

Show or HideShow perl code used to test statistics format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Stekel2000/test/BIOSTestDifferentialGeneExpressionFromTable_Stekel2000.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Stekel2000/test/BIOSTestDifferentialGeneExpressionFromTable_Stekel2000.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test statistics content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Stekel2000/test/BIOSTestDifferentialGeneExpressionFromTable_Stekel2000.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Stekel2000/test/BIOSTestDifferentialGeneExpressionFromTable_Stekel2000.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for statistics

<?xml version="1.0"?>
<entry_db>
  <entry accession="TESTTEST000710" confidence="" id="710" length="1329" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000710">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.357500E-02"/>
        <property id="f_one" value="0.00546533416614616"/>
        <property id="f_two" value="0.00965250965250965"/>
        <property id="f_zero" value="0.0066711140760507"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="25"/>
        <property id="rstat" value="2.25812061892685"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008428" confidence="" id="8428" length="806" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015865:Riboflavin kinase;</definition>
    <entry_features accession="TESTTEST008428">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.334100E-01"/>
        <property id="f_one" value="0.00437226733291693"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00389148321102958"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="0.709990874616239"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020565" confidence="" id="20565" length="628" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal;</definition>
    <entry_features accession="TESTTEST020565">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="8.988200E-02"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00400266844563042"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="6"/>
        <property id="rstat" value="1.43824215305687"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000743" confidence="" id="743" length="847" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR018485:Carbohydrate kinase, FGGY, C-terminal;</definition>
    <entry_features accession="TESTTEST000743">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="8.671000E-01"/>
        <property id="f_one" value="0.00437226733291693"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.0044474093840338"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.014002679442414"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000481" confidence="" id="481" length="2175" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000481">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="8.644300E-01"/>
        <property id="f_one" value="0.00624609618988132"/>
        <property id="f_two" value="0.00656370656370656"/>
        <property id="f_zero" value="0.00633755837224817"/>
        <property id="pool1_count" value="40"/>
        <property id="pool2_count" value="17"/>
        <property id="rstat" value="0.0145752903358394"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007446" confidence="" id="7446" length="674" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002872:Proline dehydrogenase; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST007446">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.639800E-05"/>
        <property id="f_one" value="0.00405996252342286"/>
        <property id="f_two" value="0"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="0"/>
        <property id="rstat" value="8.83050722356524"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011536" confidence="" id="11536" length="676" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000623:Shikimate kinase;</definition>
    <entry_features accession="TESTTEST011536">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.033600E-03"/>
        <property id="f_one" value="0.00780762023735166"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00622637313764732"/>
        <property id="pool1_count" value="50"/>
        <property id="pool2_count" value="6"/>
        <property id="rstat" value="5.38315594213206"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001902" confidence="" id="1902" length="801" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR013750:GHMP kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST001902">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.898400E-01"/>
        <property id="f_one" value="0.0173329169269207"/>
        <property id="f_two" value="0.0135135135135135"/>
        <property id="f_zero" value="0.0162330442517234"/>
        <property id="pool1_count" value="111"/>
        <property id="pool2_count" value="35"/>
        <property id="rstat" value="0.859434317438162"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000697" confidence="" id="697" length="983" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000697">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.143800E-03"/>
        <property id="f_one" value="0.0109306683322923"/>
        <property id="f_two" value="0.00424710424710425"/>
        <property id="f_zero" value="0.00900600400266845"/>
        <property id="pool1_count" value="70"/>
        <property id="pool2_count" value="11"/>
        <property id="rstat" value="5.28947387976076"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005092" confidence="" id="5092" length="1334" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase; IPR018042:Aspartate kinase, conserved site;</definition>
    <entry_features accession="TESTTEST005092">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.728200E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="0.158992286830921"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST052293" confidence="" id="52293" length="323" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST052293">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.327600E-03"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.000386100386100386"/>
        <property id="f_zero" value="0.00244607516121859"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="1"/>
        <property id="rstat" value="4.30926978844099"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001051" confidence="" id="1051" length="1172" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006082:Phosphoribulokinase;</definition>
    <entry_features accession="TESTTEST001051">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.123900E-01"/>
        <property id="f_one" value="0.00515302935665209"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00478096508783634"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="10"/>
        <property id="rstat" value="0.335945085945378"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002945" confidence="" id="2945" length="1085" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001697:Pyruvate kinase; IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core; IPR018209:Pyruvate kinase, active si</definition>
    <entry_features accession="TESTTEST002945">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.406400E-04"/>
        <property id="f_one" value="0.0145221736414741"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.0120080053368913"/>
        <property id="pool1_count" value="93"/>
        <property id="pool2_count" value="15"/>
        <property id="rstat" value="6.74187560883267"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002171" confidence="" id="2171" length="1756" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST002171">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.470500E-01"/>
        <property id="f_one" value="0.0110868207370394"/>
        <property id="f_two" value="0.00965250965250965"/>
        <property id="f_zero" value="0.0106737825216811"/>
        <property id="pool1_count" value="71"/>
        <property id="pool2_count" value="25"/>
        <property id="rstat" value="0.181313244850242"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001694" confidence="" id="1694" length="1098" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001312:Hexokinase;</definition>
    <entry_features accession="TESTTEST001694">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.741700E-01"/>
        <property id="f_one" value="0.00390381011867583"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00355792750722704"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="0.394888794311634"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009746" confidence="" id="9746" length="891" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase;</definition>
    <entry_features accession="TESTTEST009746">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.100800E-01"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.00308880308880309"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="8"/>
        <property id="rstat" value="0.0690970057892425"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000569" confidence="" id="569" length="761" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001564:Nucleoside diphosphate kinase, core;</definition>
    <entry_features accession="TESTTEST000569">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.640200E-04"/>
        <property id="f_one" value="0.00952529668956902"/>
        <property id="f_two" value="0.0189189189189189"/>
        <property id="f_zero" value="0.012230375806093"/>
        <property id="pool1_count" value="61"/>
        <property id="pool2_count" value="49"/>
        <property id="rstat" value="6.12747939010019"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001861" confidence="" id="1861" length="1486" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001861">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.938100E-02"/>
        <property id="f_one" value="0.00702685821361649"/>
        <property id="f_two" value="0.0108108108108108"/>
        <property id="f_zero" value="0.00811652212586168"/>
        <property id="pool1_count" value="45"/>
        <property id="pool2_count" value="28"/>
        <property id="rstat" value="1.53876406920763"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000597" confidence="" id="597" length="1065" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000597">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.093600E-01"/>
        <property id="f_one" value="0.00546533416614616"/>
        <property id="f_two" value="0.00733590733590734"/>
        <property id="f_zero" value="0.00600400266844563"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="19"/>
        <property id="rstat" value="0.516701944417014"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026720" confidence="" id="26720" length="513" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST026720">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.121300E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00378029797642873"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.336321336743339"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001053" confidence="" id="1053" length="1004" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <entry_features accession="TESTTEST001053">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.735900E-01"/>
        <property id="f_one" value="0.00655840099937539"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00600400266844563"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.599328517521477"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007784" confidence="" id="7784" length="972" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST007784">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.886000E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00333555703802535"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="10"/>
        <property id="rstat" value="0.146270941807257"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006664" confidence="" id="6664" length="563" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006206:Mevalonate/galactokinase; IPR014721:Ribosomal protein S5 domain 2-type fold, subgroup;</definition>
    <entry_features accession="TESTTEST006664">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.169800E-01"/>
        <property id="f_one" value="0.00499687695190506"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="32"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="1.22863100523123"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011563" confidence="" id="11563" length="659" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002891:Adenylylsulphate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST011563">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.728200E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="0.158992286830921"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026180" confidence="" id="26180" length="684" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016149:Casein kinase II, regulatory subunit, alpha-helical;</definition>
    <entry_features accession="TESTTEST026180">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.169500E-01"/>
        <property id="f_one" value="0.00921299188007495"/>
        <property id="f_two" value="0.01003861003861"/>
        <property id="f_zero" value="0.00945074494107183"/>
        <property id="pool1_count" value="59"/>
        <property id="pool2_count" value="26"/>
        <property id="rstat" value="0.0657162055116758"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST018164" confidence="" id="18164" length="964" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008144:Guanylate kinase;</definition>
    <entry_features accession="TESTTEST018164">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.926000E-01"/>
        <property id="f_one" value="0.00890068707058089"/>
        <property id="f_two" value="0.00888030888030888"/>
        <property id="f_zero" value="0.0088948187680676"/>
        <property id="pool1_count" value="57"/>
        <property id="pool2_count" value="23"/>
        <property id="rstat" value="4.3062882562464e-05"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004342" confidence="" id="4342" length="1181" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002573:Choline/ethanolamine kinase;</definition>
    <entry_features accession="TESTTEST004342">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.906800E-01"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.0044474093840338"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="10"/>
        <property id="rstat" value="0.14463913803978"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007767" confidence="" id="7767" length="1068" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001844:Chaperonin Cpn60; IPR002423:Chaperonin Cpn60/TCP-1; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST007767">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.106800E-03"/>
        <property id="f_one" value="0.0157713928794503"/>
        <property id="f_two" value="0.0258687258687259"/>
        <property id="f_zero" value="0.018679119412942"/>
        <property id="pool1_count" value="101"/>
        <property id="pool2_count" value="67"/>
        <property id="rstat" value="4.72704082171686"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008330" confidence="" id="8330" length="1706" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST008330">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.532100E-04"/>
        <property id="f_one" value="0.0157713928794503"/>
        <property id="f_two" value="0.00694980694980695"/>
        <property id="f_zero" value="0.0132310429175006"/>
        <property id="pool1_count" value="101"/>
        <property id="pool2_count" value="18"/>
        <property id="rstat" value="6.14948900491221"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003951" confidence="" id="3951" length="861" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <entry_features accession="TESTTEST003951">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.431400E-01"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.00400266844563042"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="13"/>
        <property id="rstat" value="0.449326937155447"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003779" confidence="" id="3779" length="792" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST003779">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.397400E-02"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.00115830115830116"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="3"/>
        <property id="rstat" value="2.24799582565054"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST030037" confidence="" id="30037" length="772" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST030037">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.508000E-01"/>
        <property id="f_one" value="0.00577763897564022"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00511452079163887"/>
        <property id="pool1_count" value="37"/>
        <property id="pool2_count" value="9"/>
        <property id="rstat" value="1.03206908801728"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000617" confidence="" id="617" length="1565" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST000617">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="8.337200E-01"/>
        <property id="f_one" value="0.0109306683322923"/>
        <property id="f_two" value="0.0104247104247104"/>
        <property id="f_zero" value="0.010784967756282"/>
        <property id="pool1_count" value="70"/>
        <property id="pool2_count" value="27"/>
        <property id="rstat" value="0.0220348769280747"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000830" confidence="" id="830" length="1105" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015824:Phosphoglycerate kinase, N-terminal; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST000830">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="6.975700E-01"/>
        <property id="f_one" value="0.0304497189256715"/>
        <property id="f_two" value="0.032046332046332"/>
        <property id="f_zero" value="0.0309094952190349"/>
        <property id="pool1_count" value="195"/>
        <property id="pool2_count" value="83"/>
        <property id="rstat" value="0.0755033866671444"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006838" confidence="" id="6838" length="1066" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008656:Inositol 1, 3, 4-trisphosphate 56-kinase;</definition>
    <entry_features accession="TESTTEST006838">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="8.556000E-01"/>
        <property id="f_one" value="0.00452841973766396"/>
        <property id="f_two" value="0.00424710424710425"/>
        <property id="f_zero" value="0.0044474093840338"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="11"/>
        <property id="rstat" value="0.0165587480475075"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000857" confidence="" id="857" length="1447" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001805:Adenosine kinase; IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000857">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.885300E-01"/>
        <property id="f_one" value="0.122579637726421"/>
        <property id="f_two" value="0.116988416988417"/>
        <property id="f_zero" value="0.120969535245719"/>
        <property id="pool1_count" value="785"/>
        <property id="pool2_count" value="303"/>
        <property id="rstat" value="0.239879902102601"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009902" confidence="" id="9902" length="670" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR015940:Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST009902">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.626500E-01"/>
        <property id="f_one" value="0.00530918176139913"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00489215032243718"/>
        <property id="pool1_count" value="34"/>
        <property id="pool2_count" value="10"/>
        <property id="rstat" value="0.414349370134754"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001446" confidence="" id="1446" length="1219" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR008351:JNK MAP kinase; IPR011009:Protein kinase-like; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001446">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.312200E-01"/>
        <property id="f_one" value="0.00593379138038726"/>
        <property id="f_two" value="0.00656370656370656"/>
        <property id="f_zero" value="0.00611518790304648"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="17"/>
        <property id="rstat" value="0.0589984877364138"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST035440" confidence="" id="35440" length="731" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST035440">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.728200E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="0.158992286830921"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002924" confidence="" id="2924" length="1482" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL doma</definition>
    <entry_features accession="TESTTEST002924">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.096700E-01"/>
        <property id="f_one" value="0.00515302935665209"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.00533689126084056"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="15"/>
        <property id="rstat" value="0.0693026869678408"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001547" confidence="" id="1547" length="1145" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001547">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.037200E-01"/>
        <property id="f_one" value="0.00374765771392879"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.00411385368023127"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="13"/>
        <property id="rstat" value="0.348605808933408"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003609" confidence="" id="3609" length="698" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015824:Phosphoglycerate kinase, N-terminal; IPR015911:Phosphoglycerate kinase, conserved site;</definition>
    <entry_features accession="TESTTEST003609">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.866000E-01"/>
        <property id="f_one" value="0.00671455340412242"/>
        <property id="f_two" value="0.00888030888030888"/>
        <property id="f_zero" value="0.00733822548365577"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="23"/>
        <property id="rstat" value="0.567755066306174"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003288" confidence="" id="3288" length="778" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST003288">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.637600E-03"/>
        <property id="f_one" value="0.00671455340412242"/>
        <property id="f_two" value="0.0135135135135135"/>
        <property id="f_zero" value="0.00867244829886591"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="35"/>
        <property id="rstat" value="4.52129249566597"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005404" confidence="" id="5404" length="1001" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001805:Adenosine kinase; IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST005404">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.515600E-01"/>
        <property id="f_one" value="0.014053716427233"/>
        <property id="f_two" value="0.0115830115830116"/>
        <property id="f_zero" value="0.0133422281521014"/>
        <property id="pool1_count" value="90"/>
        <property id="pool2_count" value="30"/>
        <property id="rstat" value="0.433917414119343"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008959" confidence="" id="8959" length="1190" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST008959">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.639000E-01"/>
        <property id="f_one" value="0.0148344784509681"/>
        <property id="f_two" value="0.0123552123552124"/>
        <property id="f_zero" value="0.0141205247943073"/>
        <property id="pool1_count" value="95"/>
        <property id="pool2_count" value="32"/>
        <property id="rstat" value="0.412202471122243"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001387" confidence="" id="1387" length="1222" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR005935:Diphosphomevalonate decarboxylase; IPR006204:GHMP kinase;</definition>
    <entry_features accession="TESTTEST001387">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.242600E-02"/>
        <property id="f_one" value="0.00546533416614616"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00455859461863465"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="6"/>
        <property id="rstat" value="2.28790437093526"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000534" confidence="" id="534" length="2048" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site; IPR002655:Acyl-CoA oxidase, C-terminal; IPR006089:Acyl-CoA dehydrogenase, conserved site; IPR006090:Acyl-CoA oxidase/dehydrogenase, type 1; I</definition>
    <entry_features accession="TESTTEST000534">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.223400E-10"/>
        <property id="f_one" value="0.0135852592129919"/>
        <property id="f_two" value="0.00115830115830116"/>
        <property id="f_zero" value="0.0100066711140761"/>
        <property id="pool1_count" value="87"/>
        <property id="pool2_count" value="3"/>
        <property id="rstat" value="20.1299080067626"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020362" confidence="" id="20362" length="751" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST020362">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.121300E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00378029797642873"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.336321336743339"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000814" confidence="" id="814" length="583" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000814">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.469500E-01"/>
        <property id="f_one" value="0.00452841973766396"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00455859461863465"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.00221378703933683"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016392" confidence="" id="16392" length="811" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase;</definition>
    <entry_features accession="TESTTEST016392">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.233400E-02"/>
        <property id="f_one" value="0.00374765771392879"/>
        <property id="f_two" value="0.00733590733590734"/>
        <property id="f_zero" value="0.00478096508783634"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="19"/>
        <property id="rstat" value="2.29036143493134"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000469" confidence="" id="469" length="1179" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR011990:Tetratricopeptide-like helical;</definition>
    <entry_features accession="TESTTEST000469">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="8.850200E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00308880308880309"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="8"/>
        <property id="rstat" value="0.0104557146143752"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002489" confidence="" id="2489" length="961" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR014746:Glutamine synthetase/guanido kinase, catalytic region;</definition>
    <entry_features accession="TESTTEST002489">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.315000E-01"/>
        <property id="f_one" value="0.00405996252342286"/>
        <property id="f_two" value="0.00656370656370656"/>
        <property id="f_zero" value="0.00478096508783634"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="17"/>
        <property id="rstat" value="1.13733590108644"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003730" confidence="" id="3730" length="1142" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <entry_features accession="TESTTEST003730">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.764700E-01"/>
        <property id="f_one" value="0.00390381011867583"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00389148321102958"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="10"/>
        <property id="rstat" value="0.000434856237875633"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020686" confidence="" id="20686" length="579" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST020686">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.102400E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="6"/>
        <property id="rstat" value="0.216789037992981"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009956" confidence="" id="9956" length="620" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011611:Carbohydrate/purine kinase;</definition>
    <entry_features accession="TESTTEST009956">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.199800E-01"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="9"/>
        <property id="rstat" value="0.32518355698947"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000971" confidence="" id="971" length="1250" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST000971">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.478100E-02"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.00772200772200772"/>
        <property id="f_zero" value="0.00522570602623972"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="20"/>
        <property id="rstat" value="2.01344194234462"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003711" confidence="" id="3711" length="1471" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase; IPR001057:Glutamate 5-kinase;</definition>
    <entry_features accession="TESTTEST003711">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.204800E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.00424710424710425"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="11"/>
        <property id="rstat" value="0.324485936111073"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001519" confidence="" id="1519" length="689" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST001519">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.363200E-01"/>
        <property id="f_one" value="0.0106183635227983"/>
        <property id="f_two" value="0.0108108108108108"/>
        <property id="f_zero" value="0.0106737825216811"/>
        <property id="pool1_count" value="68"/>
        <property id="pool2_count" value="28"/>
        <property id="rstat" value="0.00319134836186136"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004389" confidence="" id="4389" length="852" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST004389">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.565200E-01"/>
        <property id="f_one" value="0.00671455340412242"/>
        <property id="f_two" value="0.00965250965250965"/>
        <property id="f_zero" value="0.00756059595285746"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="25"/>
        <property id="rstat" value="1.00377236868372"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST010712" confidence="" id="10712" length="639" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR009286:Inositol-pentakisphosphate 2-kinase;</definition>
    <entry_features accession="TESTTEST010712">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.997700E-01"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00333555703802535"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="0.227717792275552"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000063" confidence="" id="63" length="2073" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000063">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.416200E-02"/>
        <property id="f_one" value="0.0287320424734541"/>
        <property id="f_two" value="0.0382239382239382"/>
        <property id="f_zero" value="0.0314654213920391"/>
        <property id="pool1_count" value="184"/>
        <property id="pool2_count" value="99"/>
        <property id="rstat" value="2.54147433279609"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016344" confidence="" id="16344" length="908" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR018483:Carbohydrate kinase, FGGY, conserved site;</definition>
    <entry_features accession="TESTTEST016344">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.689800E-02"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00154440154440154"/>
        <property id="f_zero" value="0.00378029797642873"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="4"/>
        <property id="rstat" value="2.85348710436444"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026919" confidence="" id="26919" length="494" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST026919">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.129100E-01"/>
        <property id="f_one" value="0.00484072454715803"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.00489215032243718"/>
        <property id="pool1_count" value="31"/>
        <property id="pool2_count" value="13"/>
        <property id="rstat" value="0.00598034755338916"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011337" confidence="" id="11337" length="1040" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST011337">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.520200E-03"/>
        <property id="f_one" value="0.00733916302311056"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00600400266844563"/>
        <property id="pool1_count" value="47"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="3.85030847880885"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006591" confidence="" id="6591" length="686" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <entry_features accession="TESTTEST006591">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.610000E-02"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00115830115830116"/>
        <property id="f_zero" value="0.00266844563042028"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="3"/>
        <property id="rstat" value="1.82454832525172"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009115" confidence="" id="9115" length="723" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal; IPR015994:Phosphoenolpyruv</definition>
    <entry_features accession="TESTTEST009115">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.107500E-04"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0"/>
        <property id="f_zero" value="0.00244607516121859"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="0"/>
        <property id="rstat" value="7.47196765070904"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016716" confidence="" id="16716" length="590" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST016716">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="6.738800E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="10"/>
        <property id="rstat" value="0.0885496669584942"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001164" confidence="" id="1164" length="735" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core;</definition>
    <entry_features accession="TESTTEST001164">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.347300E-01"/>
        <property id="f_one" value="0.00562148657089319"/>
        <property id="f_two" value="0.00849420849420849"/>
        <property id="f_zero" value="0.00644874360684901"/>
        <property id="pool1_count" value="36"/>
        <property id="pool2_count" value="22"/>
        <property id="rstat" value="1.11857318033182"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000348" confidence="" id="348" length="1510" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000348">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.591700E-01"/>
        <property id="f_one" value="0.00733916302311056"/>
        <property id="f_two" value="0.00926640926640927"/>
        <property id="f_zero" value="0.00789415165666"/>
        <property id="pool1_count" value="47"/>
        <property id="pool2_count" value="24"/>
        <property id="rstat" value="0.420393423139942"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000756" confidence="" id="756" length="1433" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000756">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="6.093000E-01"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.0044474093840338"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="13"/>
        <property id="rstat" value="0.130598545620591"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001621" confidence="" id="1621" length="1838" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001621">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.735900E-01"/>
        <property id="f_one" value="0.00655840099937539"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00600400266844563"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.599328517521477"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003722" confidence="" id="3722" length="1245" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase;</definition>
    <entry_features accession="TESTTEST003722">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.815800E-02"/>
        <property id="f_one" value="0.0113991255465334"/>
        <property id="f_two" value="0.0158301158301158"/>
        <property id="f_zero" value="0.0126751167444963"/>
        <property id="pool1_count" value="73"/>
        <property id="pool2_count" value="41"/>
        <property id="rstat" value="1.36761034448199"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST046970" confidence="" id="46970" length="432" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase;</definition>
    <entry_features accession="TESTTEST046970">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.271500E-01"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.00308880308880309"/>
        <property id="f_zero" value="0.00389148321102958"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="8"/>
        <property id="rstat" value="0.315286181301933"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST012447" confidence="" id="12447" length="799" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006204:GHMP kinase; IPR018260:Ribosomal protein L22/L17, conserved site;</definition>
    <entry_features accession="TESTTEST012447">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.585600E-01"/>
        <property id="f_one" value="0.00359150530918176"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.00422503891483211"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="15"/>
        <property id="rstat" value="0.993945646780058"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003801" confidence="" id="3801" length="717" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001564:Nucleoside diphosphate kinase, core;</definition>
    <entry_features accession="TESTTEST003801">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.739500E-02"/>
        <property id="f_one" value="0.0171767645221736"/>
        <property id="f_two" value="0.0115830115830116"/>
        <property id="f_zero" value="0.0155659328441183"/>
        <property id="pool1_count" value="110"/>
        <property id="pool2_count" value="30"/>
        <property id="rstat" value="1.96565515438514"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001295" confidence="" id="1295" length="1564" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001295">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.320000E-02"/>
        <property id="f_one" value="0.00593379138038726"/>
        <property id="f_two" value="0.01003861003861"/>
        <property id="f_zero" value="0.00711585501445408"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="26"/>
        <property id="rstat" value="2.0437877938398"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002129" confidence="" id="2129" length="788" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST002129">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.769400E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="9"/>
        <property id="rstat" value="0.000417795312056601"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007751" confidence="" id="7751" length="1579" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase; IPR011183:Pyrophosphate-dependent phosphofructokinase PfpB;</definition>
    <entry_features accession="TESTTEST007751">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.819600E-01"/>
        <property id="f_one" value="0.00405996252342286"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.00455859461863465"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="15"/>
        <property id="rstat" value="0.578812683336337"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000946" confidence="" id="946" length="946" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000946">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="6.116300E-01"/>
        <property id="f_one" value="0.00921299188007495"/>
        <property id="f_two" value="0.00810810810810811"/>
        <property id="f_zero" value="0.0088948187680676"/>
        <property id="pool1_count" value="59"/>
        <property id="pool2_count" value="21"/>
        <property id="rstat" value="0.128904373726038"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002173" confidence="" id="2173" length="1621" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase; IPR011183:Pyrophosphate-dependent phosphofructokinase PfpB;</definition>
    <entry_features accession="TESTTEST002173">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.869900E-01"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.0365108489407913"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002113" confidence="" id="2113" length="906" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006828:5-AMP-activated protein kinase, beta subunit, complex-interacting region;</definition>
    <entry_features accession="TESTTEST002113">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.934500E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00424710424710425"/>
        <property id="f_zero" value="0.00355792750722704"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="11"/>
        <property id="rstat" value="0.234500999885469"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004870" confidence="" id="4870" length="986" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004870">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.332400E-01"/>
        <property id="f_one" value="0.00437226733291693"/>
        <property id="f_two" value="0.00386100386100386"/>
        <property id="f_zero" value="0.00422503891483211"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="10"/>
        <property id="rstat" value="0.0580782816075229"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002561" confidence="" id="2561" length="1778" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <entry_features accession="TESTTEST002561">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.100100E-01"/>
        <property id="f_one" value="0.00796377264209869"/>
        <property id="f_two" value="0.0115830115830116"/>
        <property id="f_zero" value="0.00900600400266845"/>
        <property id="pool1_count" value="51"/>
        <property id="pool2_count" value="30"/>
        <property id="rstat" value="1.27702112336623"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000312" confidence="" id="312" length="1016" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016149:Casein kinase II, regulatory subunit, alpha-helical; IPR016150:Casein kinase II, regulatory subunit, beta-sheet;</definition>
    <entry_features accession="TESTTEST000312">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.083400E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.00154440154440154"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="4"/>
        <property id="rstat" value="1.2891683310613"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002401" confidence="" id="2401" length="817" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <entry_features accession="TESTTEST002401">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.820400E-03"/>
        <property id="f_one" value="0.0123360399750156"/>
        <property id="f_two" value="0.00540540540540541"/>
        <property id="f_zero" value="0.0103402268178786"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="14"/>
        <property id="rstat" value="4.86118403708424"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001539" confidence="" id="1539" length="1356" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001539">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.156800E-01"/>
        <property id="f_one" value="0.0121798875702686"/>
        <property id="f_two" value="0.0138996138996139"/>
        <property id="f_zero" value="0.0126751167444963"/>
        <property id="pool1_count" value="78"/>
        <property id="pool2_count" value="36"/>
        <property id="rstat" value="0.211262074865829"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001889" confidence="" id="1889" length="961" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008145:Guanylate kinase/L-type calcium channel region;</definition>
    <entry_features accession="TESTTEST001889">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.480700E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00366911274182789"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.440231970393868"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004574" confidence="" id="4574" length="1450" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004574">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.673900E-01"/>
        <property id="f_one" value="0.00687070580886946"/>
        <property id="f_two" value="0.00694980694980695"/>
        <property id="f_zero" value="0.00689348454525239"/>
        <property id="pool1_count" value="44"/>
        <property id="pool2_count" value="18"/>
        <property id="rstat" value="0.000835590624113203"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST012608" confidence="" id="12608" length="644" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006206:Mevalonate/galactokinase; IPR014721:Ribosomal protein S5 domain 2-type fold, subgroup;</definition>
    <entry_features accession="TESTTEST012608">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.755700E-02"/>
        <property id="f_one" value="0.0193628981886321"/>
        <property id="f_two" value="0.0131274131274131"/>
        <property id="f_zero" value="0.0175672670669335"/>
        <property id="pool1_count" value="124"/>
        <property id="pool2_count" value="34"/>
        <property id="rstat" value="2.16247714191554"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011700" confidence="" id="11700" length="564" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST011700">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="6.206000E-01"/>
        <property id="f_one" value="0.00530918176139913"/>
        <property id="f_two" value="0.00617760617760618"/>
        <property id="f_zero" value="0.00555926173004225"/>
        <property id="pool1_count" value="34"/>
        <property id="pool2_count" value="16"/>
        <property id="rstat" value="0.122510492849409"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001627" confidence="" id="1627" length="1256" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST001627">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.559500E-01"/>
        <property id="f_one" value="0.00593379138038726"/>
        <property id="f_two" value="0.00733590733590734"/>
        <property id="f_zero" value="0.00633755837224817"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="19"/>
        <property id="rstat" value="0.277914789433787"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001720" confidence="" id="1720" length="648" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000623:Shikimate kinase;</definition>
    <entry_features accession="TESTTEST001720">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.078600E-04"/>
        <property id="f_one" value="0.0138975640224859"/>
        <property id="f_two" value="0.00501930501930502"/>
        <property id="f_zero" value="0.0113408939292862"/>
        <property id="pool1_count" value="89"/>
        <property id="pool2_count" value="13"/>
        <property id="rstat" value="7.49695465849689"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006552" confidence="" id="6552" length="759" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001772:Kinase-associated KA1;</definition>
    <entry_features accession="TESTTEST006552">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.235000E-02"/>
        <property id="f_one" value="0.00452841973766396"/>
        <property id="f_two" value="0.00772200772200772"/>
        <property id="f_zero" value="0.00544807649544141"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="20"/>
        <property id="rstat" value="1.61443808921563"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001383" confidence="" id="1383" length="1357" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001412:Aminoacyl-tRNA synthetase, class I, conserved site; IPR011147:Bifunctional aspartokinase/homoserine dehydrogenase I; IPR016040:NAD(P)-binding domain;</definition>
    <entry_features accession="TESTTEST001383">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.924300E-03"/>
        <property id="f_one" value="0.00421611492816989"/>
        <property id="f_two" value="0.01003861003861"/>
        <property id="f_zero" value="0.00589281743384479"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="26"/>
        <property id="rstat" value="4.81017119775605"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002989" confidence="" id="2989" length="800" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <entry_features accession="TESTTEST002989">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.138800E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.00193050193050193"/>
        <property id="f_zero" value="0.00277963086502112"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="5"/>
        <property id="rstat" value="0.507136339011599"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005798" confidence="" id="5798" length="804" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST005798">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.508000E-01"/>
        <property id="f_one" value="0.00577763897564022"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00511452079163887"/>
        <property id="pool1_count" value="37"/>
        <property id="pool2_count" value="9"/>
        <property id="rstat" value="1.03206908801728"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002143" confidence="" id="2143" length="680" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016150:Casein kinase II, regulatory subunit, beta-sheet;</definition>
    <entry_features accession="TESTTEST002143">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.557400E-01"/>
        <property id="f_one" value="0.00562148657089319"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.00533689126084056"/>
        <property id="pool1_count" value="36"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.173566965647737"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST015237" confidence="" id="15237" length="558" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <entry_features accession="TESTTEST015237">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.437800E-13"/>
        <property id="f_one" value="0.000468457214241099"/>
        <property id="f_two" value="0.0108108108108108"/>
        <property id="f_zero" value="0.0034467422726262"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="28"/>
        <property id="rstat" value="26.0200592453506"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004597" confidence="" id="4597" length="999" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004597">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.622300E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00193050193050193"/>
        <property id="f_zero" value="0.00289081609962197"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="5"/>
        <property id="rstat" value="0.628482586484194"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003485" confidence="" id="3485" length="578" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST003485">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.739900E-02"/>
        <property id="f_one" value="0.00437226733291693"/>
        <property id="f_two" value="0.00154440154440154"/>
        <property id="f_zero" value="0.00355792750722704"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="4"/>
        <property id="rstat" value="2.43273110033563"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002218" confidence="" id="2218" length="841" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST002218">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.473700E-01"/>
        <property id="f_one" value="0.00765146783260462"/>
        <property id="f_two" value="0.00926640926640927"/>
        <property id="f_zero" value="0.00811652212586168"/>
        <property id="pool1_count" value="49"/>
        <property id="pool2_count" value="24"/>
        <property id="rstat" value="0.288652602716833"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000388" confidence="" id="388" length="1195" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST000388">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.236000E-02"/>
        <property id="f_one" value="0.00515302935665209"/>
        <property id="f_two" value="0.00926640926640927"/>
        <property id="f_zero" value="0.00633755837224817"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="24"/>
        <property id="rstat" value="2.28966616952841"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001183" confidence="" id="1183" length="1661" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001183">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.769700E-01"/>
        <property id="f_one" value="0.00983760149906309"/>
        <property id="f_two" value="0.011969111969112"/>
        <property id="f_zero" value="0.0104514120524794"/>
        <property id="pool1_count" value="63"/>
        <property id="pool2_count" value="31"/>
        <property id="rstat" value="0.39027403255986"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004119" confidence="" id="4119" length="1118" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004119">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.313200E-01"/>
        <property id="f_one" value="0.00640224859462836"/>
        <property id="f_two" value="0.00656370656370656"/>
        <property id="f_zero" value="0.00644874360684901"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="17"/>
        <property id="rstat" value="0.00371440874609852"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003221" confidence="" id="3221" length="1430" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST003221">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.242600E-02"/>
        <property id="f_one" value="0.00546533416614616"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00455859461863465"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="6"/>
        <property id="rstat" value="2.28790437093526"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST015285" confidence="" id="15285" length="540" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST015285">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.391900E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00300200133422282"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="0.0554176850905632"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003927" confidence="" id="3927" length="939" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <entry_features accession="TESTTEST003927">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.034000E-11"/>
        <property id="f_one" value="0.00374765771392879"/>
        <property id="f_two" value="0.0185328185328185"/>
        <property id="f_zero" value="0.00800533689126084"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="48"/>
        <property id="rstat" value="22.0774083264899"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000737" confidence="" id="737" length="1211" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL domain;</definition>
    <entry_features accession="TESTTEST000737">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.966500E-01"/>
        <property id="f_one" value="0.00608994378513429"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.0056704469646431"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.359235314564282"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001017" confidence="" id="1017" length="1032" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR003594:ATP-binding region, ATPase-like; IPR004358:Signal transduction histidine kinase-related protein, C-terminal;</definition>
    <entry_features accession="TESTTEST001017">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="3.966500E-01"/>
        <property id="f_one" value="0.00608994378513429"/>
        <property id="f_two" value="0.00463320463320463"/>
        <property id="f_zero" value="0.0056704469646431"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="12"/>
        <property id="rstat" value="0.359235314564282"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000339" confidence="" id="339" length="1588" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000339">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.794500E-01"/>
        <property id="f_one" value="0.00640224859462836"/>
        <property id="f_two" value="0.00540540540540541"/>
        <property id="f_zero" value="0.00611518790304648"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="14"/>
        <property id="rstat" value="0.153560160399251"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008417" confidence="" id="8417" length="822" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST008417">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.973700E-02"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00579150579150579"/>
        <property id="f_zero" value="0.00400266844563042"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="15"/>
        <property id="rstat" value="1.3548723713561"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001448" confidence="" id="1448" length="1192" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001448">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="8.763400E-01"/>
        <property id="f_one" value="0.0123360399750156"/>
        <property id="f_two" value="0.0127413127413127"/>
        <property id="f_zero" value="0.0124527462752946"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="33"/>
        <property id="rstat" value="0.012106669170998"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000518" confidence="" id="518" length="1351" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000518">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.577100E-02"/>
        <property id="f_one" value="0.00640224859462836"/>
        <property id="f_two" value="0.0115830115830116"/>
        <property id="f_zero" value="0.00789415165666"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="30"/>
        <property id="rstat" value="2.9141299156959"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002069" confidence="" id="2069" length="608" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000789:Cyclin-dependent kinase, regulatory subunit;</definition>
    <entry_features accession="TESTTEST002069">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="2.617300E-01"/>
        <property id="f_one" value="0.0387257963772642"/>
        <property id="f_two" value="0.044015444015444"/>
        <property id="f_zero" value="0.0402490549255059"/>
        <property id="pool1_count" value="248"/>
        <property id="pool2_count" value="114"/>
        <property id="rstat" value="0.629779642668607"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000533" confidence="" id="533" length="2542" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000533">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="1.578800E-01"/>
        <property id="f_one" value="0.00640224859462836"/>
        <property id="f_two" value="0.00926640926640927"/>
        <property id="f_zero" value="0.00722704024905493"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="24"/>
        <property id="rstat" value="0.997200245076505"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST014790" confidence="" id="14790" length="992" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST014790">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.266300E-02"/>
        <property id="f_one" value="0.00374765771392879"/>
        <property id="f_two" value="0.00694980694980695"/>
        <property id="f_zero" value="0.00466977985323549"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="18"/>
        <property id="rstat" value="1.87729366718457"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST014061" confidence="" id="14061" length="499" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core;</definition>
    <entry_features accession="TESTTEST014061">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.199800E-01"/>
        <property id="f_one" value="0.00468457214241099"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="9"/>
        <property id="rstat" value="0.32518355698947"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003004" confidence="" id="3004" length="692" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006259:Adenylate kinase, subfamily; IPR007862:Adenylate kinase, zinc-finger lid region;</definition>
    <entry_features accession="TESTTEST003004">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.273100E-01"/>
        <property id="f_one" value="0.014053716427233"/>
        <property id="f_two" value="0.0123552123552124"/>
        <property id="f_zero" value="0.0135645986213031"/>
        <property id="pool1_count" value="90"/>
        <property id="pool2_count" value="32"/>
        <property id="rstat" value="0.19978615550828"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001542" confidence="" id="1542" length="1285" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001542">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="9.105500E-01"/>
        <property id="f_one" value="0.0134291068082448"/>
        <property id="f_two" value="0.0131274131274131"/>
        <property id="f_zero" value="0.0133422281521014"/>
        <property id="pool1_count" value="86"/>
        <property id="pool2_count" value="34"/>
        <property id="rstat" value="0.00631062697407236"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003103" confidence="" id="3103" length="928" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase;</definition>
    <entry_features accession="TESTTEST003103">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.106100E-01"/>
        <property id="f_one" value="0.00608994378513429"/>
        <property id="f_two" value="0.00733590733590734"/>
        <property id="f_zero" value="0.00644874360684901"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="19"/>
        <property id="rstat" value="0.216407466978429"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003590" confidence="" id="3590" length="805" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST003590">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.533600E-02"/>
        <property id="f_one" value="0.00390381011867583"/>
        <property id="f_two" value="0.00154440154440154"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="4"/>
        <property id="rstat" value="1.8359655774763"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST043433" confidence="" id="43433" length="685" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006204:GHMP kinase;</definition>
    <entry_features accession="TESTTEST043433">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="7.391900E-01"/>
        <property id="f_one" value="0.00312304809494066"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00300200133422282"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="0.0554176850905632"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005297" confidence="" id="5297" length="513" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST005297">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="5.728200E-01"/>
        <property id="f_one" value="0.00343535290443473"/>
        <property id="f_two" value="0.0027027027027027"/>
        <property id="f_zero" value="0.00322437180342451"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="rstat" value="0.158992286830921"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005971" confidence="" id="5971" length="540" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST005971">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.923000E-02"/>
        <property id="f_one" value="0.00515302935665209"/>
        <property id="f_two" value="0.00231660231660232"/>
        <property id="f_zero" value="0.00433622414943296"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="6"/>
        <property id="rstat" value="1.93375249659195"/>
        <property id="up" value="UP1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST029496" confidence="" id="29496" length="316" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011611:Carbohydrate/purine kinase;</definition>
    <entry_features accession="TESTTEST029496">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="8.847700E-01"/>
        <property id="f_one" value="0.0032792004996877"/>
        <property id="f_two" value="0.00347490347490347"/>
        <property id="f_zero" value="0.00333555703802535"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="9"/>
        <property id="rstat" value="0.0105020095818172"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST010564" confidence="" id="10564" length="801" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase;</definition>
    <entry_features accession="TESTTEST010564">
      <pattern definition="Stekel2000" type="test">
        <property id="chisprob" value="4.443300E-01"/>
        <property id="f_one" value="0.00624609618988132"/>
        <property id="f_two" value="0.00772200772200772"/>
        <property id="f_zero" value="0.0066711140760507"/>
        <property id="pool1_count" value="40"/>
        <property id="pool2_count" value="20"/>
        <property id="rstat" value="0.292541883614513"/>
        <property id="up" value="UP2"/>
      </pattern>
    </entry_features>
  </entry>
</entry_db>
BIOSTestDifferentialGeneExpressionFromTable_Susko2004 2017.05.28 02:04:39 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSTestDifferentialGeneExpressionFromTable_Susko2004.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

statistics

Format

Show or HideShow perl code used to test statistics format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Susko2004/test/BIOSTestDifferentialGeneExpressionFromTable_Susko2004.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Susko2004/test/BIOSTestDifferentialGeneExpressionFromTable_Susko2004.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test statistics content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Susko2004/test/BIOSTestDifferentialGeneExpressionFromTable_Susko2004.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromTable_Susko2004/test/BIOSTestDifferentialGeneExpressionFromTable_Susko2004.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for statistics

<?xml version="1.0"?>
<entry_db>
  <entry accession="TESTTEST000710" confidence="" id="710" length="1329" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000710">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="8.333333e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.833333e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.463910e-02"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="25"/>
        <property id="rank" value="22"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008428" confidence="" id="8428" length="806" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015865:Riboflavin kinase;</definition>
    <entry_features accession="TESTTEST008428">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.063492e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.000000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.365079e-01"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="51"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020565" confidence="" id="20565" length="628" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal;</definition>
    <entry_features accession="TESTTEST020565">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.587302e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.333333e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.446609e-01"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="6"/>
        <property id="rank" value="40"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000743" confidence="" id="743" length="847" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR018485:Carbohydrate kinase, FGGY, C-terminal;</definition>
    <entry_features accession="TESTTEST000743">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.484127e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.000000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="9.852638e-01"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="104"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000481" confidence="" id="481" length="2175" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000481">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.444444e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.017544e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="9.634022e-01"/>
        <property id="pool1_count" value="40"/>
        <property id="pool2_count" value="17"/>
        <property id="rank" value="103"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007446" confidence="" id="7446" length="674" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002872:Proline dehydrogenase; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST007446">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.587302e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="1.000000e+00"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.924081e-04"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="0"/>
        <property id="rank" value="5"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011536" confidence="" id="11536" length="676" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000623:Shikimate kinase;</definition>
    <entry_features accession="TESTTEST011536">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.968254e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.928571e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.146668e-03"/>
        <property id="pool1_count" value="50"/>
        <property id="pool2_count" value="6"/>
        <property id="rank" value="11"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001902" confidence="" id="1902" length="801" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR013750:GHMP kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST001902">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.984127e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.602740e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.292241e-01"/>
        <property id="pool1_count" value="111"/>
        <property id="pool2_count" value="35"/>
        <property id="rank" value="49"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000697" confidence="" id="697" length="983" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000697">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.571429e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.641975e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.031761e-03"/>
        <property id="pool1_count" value="70"/>
        <property id="pool2_count" value="11"/>
        <property id="rank" value="10"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005092" confidence="" id="5092" length="1334" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase; IPR018042:Aspartate kinase, conserved site;</definition>
    <entry_features accession="TESTTEST005092">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.849206e-02"/>
        <property id="N_count1count2" value="4"/>
        <property id="P_gene" value="7.586207e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.475916e-01"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="92"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST052293" confidence="" id="52293" length="323" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST052293">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="6.349206e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="9.545455e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.125963e-02"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="1"/>
        <property id="rank" value="17"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001051" confidence="" id="1051" length="1172" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006082:Phosphoribulokinase;</definition>
    <entry_features accession="TESTTEST001051">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.095238e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.674419e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.361310e-01"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="10"/>
        <property id="rank" value="74"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002945" confidence="" id="2945" length="1085" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001697:Pyruvate kinase; IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core; IPR018209:Pyruvate kinase, active si</definition>
    <entry_features accession="TESTTEST002945">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.984127e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.611111e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.186417e-04"/>
        <property id="pool1_count" value="93"/>
        <property id="pool2_count" value="15"/>
        <property id="rank" value="6"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002171" confidence="" id="2171" length="1756" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST002171">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.412698e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.395833e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.377832e-01"/>
        <property id="pool1_count" value="71"/>
        <property id="pool2_count" value="25"/>
        <property id="rank" value="81"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001694" confidence="" id="1694" length="1098" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001312:Hexokinase;</definition>
    <entry_features accession="TESTTEST001694">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.896825e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.812500e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.139180e-01"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="69"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009746" confidence="" id="9746" length="891" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase;</definition>
    <entry_features accession="TESTTEST009746">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.166667e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.419355e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="8.878272e-01"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="8"/>
        <property id="rank" value="97"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000569" confidence="" id="569" length="761" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001564:Nucleoside diphosphate kinase, core;</definition>
    <entry_features accession="TESTTEST000569">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.380952e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.545455e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.390139e-04"/>
        <property id="pool1_count" value="61"/>
        <property id="pool2_count" value="49"/>
        <property id="rank" value="7"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001861" confidence="" id="1861" length="1486" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001861">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.349206e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.164384e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="9.947648e-02"/>
        <property id="pool1_count" value="45"/>
        <property id="pool2_count" value="28"/>
        <property id="rank" value="34"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000597" confidence="" id="597" length="1065" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000597">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.261905e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.481481e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.728391e-01"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="19"/>
        <property id="rank" value="55"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026720" confidence="" id="26720" length="513" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST026720">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.777778e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="6.470588e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.078159e-01"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="67"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001053" confidence="" id="1053" length="1004" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <entry_features accession="TESTTEST001053">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.182540e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="7.777778e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.610619e-01"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="54"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007784" confidence="" id="7784" length="972" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST007784">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.611111e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.666667e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.102020e-01"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="10"/>
        <property id="rank" value="86"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006664" confidence="" id="6664" length="563" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006206:Mevalonate/galactokinase; IPR014721:Ribosomal protein S5 domain 2-type fold, subgroup;</definition>
    <entry_features accession="TESTTEST006664">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.706349e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.205128e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.791613e-01"/>
        <property id="pool1_count" value="32"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="43"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011563" confidence="" id="11563" length="659" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002891:Adenylylsulphate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST011563">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.849206e-02"/>
        <property id="N_count1count2" value="4"/>
        <property id="P_gene" value="7.586207e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.475916e-01"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="92"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026180" confidence="" id="26180" length="684" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016149:Casein kinase II, regulatory subunit, alpha-helical;</definition>
    <entry_features accession="TESTTEST026180">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.007937e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.941176e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.943441e-01"/>
        <property id="pool1_count" value="59"/>
        <property id="pool2_count" value="26"/>
        <property id="rank" value="93"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST018164" confidence="" id="18164" length="964" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008144:Guanylate kinase;</definition>
    <entry_features accession="TESTTEST018164">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.960317e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.125000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="57"/>
        <property id="pool2_count" value="23"/>
        <property id="rank" value="116"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004342" confidence="" id="4342" length="1181" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002573:Choline/ethanolamine kinase;</definition>
    <entry_features accession="TESTTEST004342">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.769841e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.500000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.391541e-01"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="10"/>
        <property id="rank" value="90"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007767" confidence="" id="7767" length="1068" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001844:Chaperonin Cpn60; IPR002423:Chaperonin Cpn60/TCP-1; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST007767">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.365079e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.011905e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.660178e-03"/>
        <property id="pool1_count" value="101"/>
        <property id="pool2_count" value="67"/>
        <property id="rank" value="12"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008330" confidence="" id="8330" length="1706" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST008330">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.777778e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.487395e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.446531e-04"/>
        <property id="pool1_count" value="101"/>
        <property id="pool2_count" value="18"/>
        <property id="rank" value="8"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003951" confidence="" id="3951" length="861" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <entry_features accession="TESTTEST003951">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.420635e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.388889e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.266660e-01"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="13"/>
        <property id="rank" value="59"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003779" confidence="" id="3779" length="792" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST003779">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.190476e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.846154e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.920448e-02"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="3"/>
        <property id="rank" value="30"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST030037" confidence="" id="30037" length="772" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST030037">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.904762e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="8.043478e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.171206e-01"/>
        <property id="pool1_count" value="37"/>
        <property id="pool2_count" value="9"/>
        <property id="rank" value="48"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000617" confidence="" id="617" length="1565" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST000617">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.365079e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.216495e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="9.352763e-01"/>
        <property id="pool1_count" value="70"/>
        <property id="pool2_count" value="27"/>
        <property id="rank" value="101"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000830" confidence="" id="830" length="1105" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015824:Phosphoglycerate kinase, N-terminal; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST000830">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.809524e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.014388e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.398481e-01"/>
        <property id="pool1_count" value="195"/>
        <property id="pool2_count" value="83"/>
        <property id="rank" value="91"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006838" confidence="" id="6838" length="1066" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008656:Inositol 1, 3, 4-trisphosphate 56-kinase;</definition>
    <entry_features accession="TESTTEST006838">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.642857e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.250000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="11"/>
        <property id="rank" value="108"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000857" confidence="" id="857" length="1447" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001805:Adenosine kinase; IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000857">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.857143e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.215074e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.130143e-01"/>
        <property id="pool1_count" value="785"/>
        <property id="pool2_count" value="303"/>
        <property id="rank" value="68"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009902" confidence="" id="9902" length="670" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR015940:Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST009902">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.619048e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.727273e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.773831e-01"/>
        <property id="pool1_count" value="34"/>
        <property id="pool2_count" value="10"/>
        <property id="rank" value="64"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001446" confidence="" id="1446" length="1219" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR008351:JNK MAP kinase; IPR011009:Protein kinase-like; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001446">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.126984e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.909091e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="8.281371e-01"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="17"/>
        <property id="rank" value="96"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST035440" confidence="" id="35440" length="731" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST035440">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.849206e-02"/>
        <property id="N_count1count2" value="4"/>
        <property id="P_gene" value="7.586207e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.475916e-01"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="92"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002924" confidence="" id="2924" length="1482" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL doma</definition>
    <entry_features accession="TESTTEST002924">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.087302e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.875000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="8.124981e-01"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="15"/>
        <property id="rank" value="95"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001547" confidence="" id="1547" length="1145" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001547">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.658730e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.486486e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.942734e-01"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="13"/>
        <property id="rank" value="65"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003609" confidence="" id="3609" length="698" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015824:Phosphoglycerate kinase, N-terminal; IPR015911:Phosphoglycerate kinase, conserved site;</definition>
    <entry_features accession="TESTTEST003609">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.103175e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.515152e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.410803e-01"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="23"/>
        <property id="rank" value="52"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003288" confidence="" id="3288" length="778" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST003288">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="5.555556e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.512821e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.675415e-03"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="35"/>
        <property id="rank" value="15"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005404" confidence="" id="5404" length="1001" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001805:Adenosine kinase; IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST005404">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.341270e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.500000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.162799e-01"/>
        <property id="pool1_count" value="90"/>
        <property id="pool2_count" value="30"/>
        <property id="rank" value="57"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008959" confidence="" id="8959" length="1190" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST008959">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.460317e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.480315e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.278939e-01"/>
        <property id="pool1_count" value="95"/>
        <property id="pool2_count" value="32"/>
        <property id="rank" value="60"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001387" confidence="" id="1387" length="1222" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR005935:Diphosphomevalonate decarboxylase; IPR006204:GHMP kinase;</definition>
    <entry_features accession="TESTTEST001387">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="9.920635e-03"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="8.536585e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.619910e-02"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="6"/>
        <property id="rank" value="26"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000534" confidence="" id="534" length="2048" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site; IPR002655:Acyl-CoA oxidase, C-terminal; IPR006089:Acyl-CoA dehydrogenase, conserved site; IPR006090:Acyl-CoA oxidase/dehydrogenase, type 1; I</definition>
    <entry_features accession="TESTTEST000534">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="7.936508e-04"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="9.666667e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="8.983976e-10"/>
        <property id="pool1_count" value="87"/>
        <property id="pool2_count" value="3"/>
        <property id="rank" value="3"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020362" confidence="" id="20362" length="751" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST020362">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.777778e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="6.470588e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.078159e-01"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="67"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000814" confidence="" id="814" length="583" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <entry_features accession="TESTTEST000814">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.761905e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.073171e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="111"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016392" confidence="" id="16392" length="811" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase;</definition>
    <entry_features accession="TESTTEST016392">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="8.730159e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.581395e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.523778e-02"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="19"/>
        <property id="rank" value="23"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000469" confidence="" id="469" length="1179" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR011990:Tetratricopeptide-like helical;</definition>
    <entry_features accession="TESTTEST000469">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.880952e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.241379e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="8"/>
        <property id="rank" value="114"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002489" confidence="" id="2489" length="961" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR014746:Glutamine synthetase/guanido kinase, catalytic region;</definition>
    <entry_features accession="TESTTEST002489">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.666667e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.046512e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.708845e-01"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="17"/>
        <property id="rank" value="42"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003730" confidence="" id="3730" length="1142" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <entry_features accession="TESTTEST003730">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.523810e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.142857e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="10"/>
        <property id="rank" value="105"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST020686" confidence="" id="20686" length="579" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST020686">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.531746e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.692308e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.888929e-01"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="6"/>
        <property id="rank" value="84"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009956" confidence="" id="9956" length="620" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011611:Carbohydrate/purine kinase;</definition>
    <entry_features accession="TESTTEST009956">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.134921e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="7.692308e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.517689e-01"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="9"/>
        <property id="rank" value="75"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000971" confidence="" id="971" length="1250" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST000971">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.111111e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.744681e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.084703e-02"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="20"/>
        <property id="rank" value="28"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003711" confidence="" id="3711" length="1471" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase; IPR001057:Glutamate 5-kinase;</definition>
    <entry_features accession="TESTTEST003711">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.015873e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.451613e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.219505e-01"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="11"/>
        <property id="rank" value="72"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001519" confidence="" id="1519" length="689" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST001519">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.841270e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.083333e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="68"/>
        <property id="pool2_count" value="28"/>
        <property id="rank" value="113"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004389" confidence="" id="4389" length="852" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST004389">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.785714e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.323529e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.916671e-01"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="25"/>
        <property id="rank" value="45"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST010712" confidence="" id="10712" length="639" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR009286:Inositol-pentakisphosphate 2-kinase;</definition>
    <entry_features accession="TESTTEST010712">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.452381e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.666667e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.636239e-01"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="82"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000063" confidence="" id="63" length="2073" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000063">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="7.142857e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.501767e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.782854e-02"/>
        <property id="pool1_count" value="184"/>
        <property id="pool2_count" value="99"/>
        <property id="rank" value="19"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016344" confidence="" id="16344" length="908" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR018483:Carbohydrate kinase, FGGY, conserved site;</definition>
    <entry_features accession="TESTTEST016344">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="7.539683e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.823529e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.367485e-02"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="4"/>
        <property id="rank" value="20"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST026919" confidence="" id="26919" length="494" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST026919">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.603175e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.045455e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="31"/>
        <property id="pool2_count" value="13"/>
        <property id="rank" value="107"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011337" confidence="" id="11337" length="1040" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST011337">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="5.952381e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.703704e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.020958e-02"/>
        <property id="pool1_count" value="47"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="16"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006591" confidence="" id="6591" length="686" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <entry_features accession="TESTTEST006591">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.428571e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.750000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.094358e-01"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="3"/>
        <property id="rank" value="36"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST009115" confidence="" id="9115" length="723" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal; IPR015994:Phosphoenolpyruv</definition>
    <entry_features accession="TESTTEST009115">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.174603e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="1.000000e+00"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.137616e-03"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="0"/>
        <property id="rank" value="9"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST016716" confidence="" id="16716" length="590" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST016716">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.047619e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.774194e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.998456e-01"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="10"/>
        <property id="rank" value="94"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001164" confidence="" id="1164" length="735" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core;</definition>
    <entry_features accession="TESTTEST001164">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.626984e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.206897e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.689201e-01"/>
        <property id="pool1_count" value="36"/>
        <property id="pool2_count" value="22"/>
        <property id="rank" value="41"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000348" confidence="" id="348" length="1510" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000348">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.380952e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.619718e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.196500e-01"/>
        <property id="pool1_count" value="47"/>
        <property id="pool2_count" value="24"/>
        <property id="rank" value="58"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000756" confidence="" id="756" length="1433" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000756">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.690476e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.750000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.159143e-01"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="13"/>
        <property id="rank" value="88"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001621" confidence="" id="1621" length="1838" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001621">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.182540e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="7.777778e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.610619e-01"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="54"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003722" confidence="" id="3722" length="1245" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase;</definition>
    <entry_features accession="TESTTEST003722">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.468254e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.403509e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.169443e-01"/>
        <property id="pool1_count" value="73"/>
        <property id="pool2_count" value="41"/>
        <property id="rank" value="37"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST046970" confidence="" id="46970" length="432" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase;</definition>
    <entry_features accession="TESTTEST046970">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.214286e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.714286e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.682432e-01"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="8"/>
        <property id="rank" value="76"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST012447" confidence="" id="12447" length="799" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006204:GHMP kinase; IPR018260:Ribosomal protein L22/L17, conserved site;</definition>
    <entry_features accession="TESTTEST012447">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.865079e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.052632e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.068611e-01"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="15"/>
        <property id="rank" value="47"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003801" confidence="" id="3801" length="717" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001564:Nucleoside diphosphate kinase, core;</definition>
    <entry_features accession="TESTTEST003801">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.150794e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.857143e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.165516e-02"/>
        <property id="pool1_count" value="110"/>
        <property id="pool2_count" value="30"/>
        <property id="rank" value="29"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001295" confidence="" id="1295" length="1564" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001295">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.071429e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.937500e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.636814e-02"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="26"/>
        <property id="rank" value="27"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002129" confidence="" id="2129" length="788" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST002129">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.563492e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.096774e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="9"/>
        <property id="rank" value="106"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST007751" confidence="" id="7751" length="1579" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase; IPR011183:Pyrophosphate-dependent phosphofructokinase PfpB;</definition>
    <entry_features accession="TESTTEST007751">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.142857e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.341463e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.509814e-01"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="15"/>
        <property id="rank" value="53"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000946" confidence="" id="946" length="946" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000946">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.650794e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.375000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.157477e-01"/>
        <property id="pool1_count" value="59"/>
        <property id="pool2_count" value="21"/>
        <property id="rank" value="87"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002173" confidence="" id="2173" length="1621" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000023:Phosphofructokinase; IPR011183:Pyrophosphate-dependent phosphofructokinase PfpB;</definition>
    <entry_features accession="TESTTEST002173">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.246032e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.923077e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="9.044590e-01"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="99"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002113" confidence="" id="2113" length="906" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006828:5-AMP-activated protein kinase, beta subunit, complex-interacting region;</definition>
    <entry_features accession="TESTTEST002113">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.333333e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.562500e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.019759e-01"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="11"/>
        <property id="rank" value="79"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004870" confidence="" id="4870" length="986" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004870">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.206349e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.368421e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="8.940833e-01"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="10"/>
        <property id="rank" value="98"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002561" confidence="" id="2561" length="1778" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <entry_features accession="TESTTEST002561">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.507937e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.296296e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.345742e-01"/>
        <property id="pool1_count" value="51"/>
        <property id="pool2_count" value="30"/>
        <property id="rank" value="38"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000312" confidence="" id="312" length="1016" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016149:Casein kinase II, regulatory subunit, alpha-helical; IPR016150:Casein kinase II, regulatory subunit, beta-sheet;</definition>
    <entry_features accession="TESTTEST000312">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.746032e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.461538e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.861610e-01"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="4"/>
        <property id="rank" value="44"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002401" confidence="" id="2401" length="817" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <entry_features accession="TESTTEST002401">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="5.158730e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.494624e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.017263e-03"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="14"/>
        <property id="rank" value="14"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001539" confidence="" id="1539" length="1356" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001539">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.253968e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.842105e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.738016e-01"/>
        <property id="pool1_count" value="78"/>
        <property id="pool2_count" value="36"/>
        <property id="rank" value="77"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001889" confidence="" id="1889" length="961" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008145:Guanylate kinase/L-type calcium channel region;</definition>
    <entry_features accession="TESTTEST001889">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.539683e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.363636e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.362145e-01"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="62"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004574" confidence="" id="4574" length="1450" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004574">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.920635e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.096774e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="44"/>
        <property id="pool2_count" value="18"/>
        <property id="rank" value="115"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST012608" confidence="" id="12608" length="644" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006206:Mevalonate/galactokinase; IPR014721:Ribosomal protein S5 domain 2-type fold, subgroup;</definition>
    <entry_features accession="TESTTEST012608">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="9.126984e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.848101e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.855899e-02"/>
        <property id="pool1_count" value="124"/>
        <property id="pool2_count" value="34"/>
        <property id="rank" value="24"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST011700" confidence="" id="11700" length="564" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <entry_features accession="TESTTEST011700">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.730159e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.800000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.165474e-01"/>
        <property id="pool1_count" value="34"/>
        <property id="pool2_count" value="16"/>
        <property id="rank" value="89"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001627" confidence="" id="1627" length="1256" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <entry_features accession="TESTTEST001627">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.055556e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.666667e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.335087e-01"/>
        <property id="pool1_count" value="38"/>
        <property id="pool2_count" value="19"/>
        <property id="rank" value="73"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001720" confidence="" id="1720" length="648" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000623:Shikimate kinase;</definition>
    <entry_features accession="TESTTEST001720">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.190476e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.725490e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.984569e-04"/>
        <property id="pool1_count" value="89"/>
        <property id="pool2_count" value="13"/>
        <property id="rank" value="4"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST006552" confidence="" id="6552" length="759" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001772:Kinase-associated KA1;</definition>
    <entry_features accession="TESTTEST006552">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.309524e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.918367e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="9.548242e-02"/>
        <property id="pool1_count" value="29"/>
        <property id="pool2_count" value="20"/>
        <property id="rank" value="33"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001383" confidence="" id="1383" length="1357" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001412:Aminoacyl-tRNA synthetase, class I, conserved site; IPR011147:Bifunctional aspartokinase/homoserine dehydrogenase I; IPR016040:NAD(P)-binding domain;</definition>
    <entry_features accession="TESTTEST001383">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.761905e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.094340e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.903600e-03"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="26"/>
        <property id="rank" value="13"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002989" confidence="" id="2989" length="800" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <entry_features accession="TESTTEST002989">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.579365e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.000000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.622727e-01"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="5"/>
        <property id="rank" value="63"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005798" confidence="" id="5798" length="804" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST005798">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.904762e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="8.043478e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.171206e-01"/>
        <property id="pool1_count" value="37"/>
        <property id="pool2_count" value="9"/>
        <property id="rank" value="48"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002143" confidence="" id="2143" length="680" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000704:Casein kinase II, regulatory subunit; IPR016150:Casein kinase II, regulatory subunit, beta-sheet;</definition>
    <entry_features accession="TESTTEST002143">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.492063e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.500000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.876844e-01"/>
        <property id="pool1_count" value="36"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="83"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST015237" confidence="" id="15237" length="558" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <entry_features accession="TESTTEST015237">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.968254e-04"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="9.677419e-02"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.461750e-12"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="28"/>
        <property id="rank" value="1"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004597" confidence="" id="4597" length="999" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004597">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.301587e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.076923e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="3.942866e-01"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="5"/>
        <property id="rank" value="56"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003485" confidence="" id="3485" length="578" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST003485">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="9.523810e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.750000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.278556e-02"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="4"/>
        <property id="rank" value="25"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002218" confidence="" id="2218" length="841" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001576:Phosphoglycerate kinase; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <entry_features accession="TESTTEST002218">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.936508e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.712329e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.150391e-01"/>
        <property id="pool1_count" value="49"/>
        <property id="pool2_count" value="24"/>
        <property id="rank" value="70"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000388" confidence="" id="388" length="1195" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <entry_features accession="TESTTEST000388">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="7.936508e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.789474e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.339617e-02"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="24"/>
        <property id="rank" value="21"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001183" confidence="" id="1183" length="1661" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001183">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.500000e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.702128e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="4.309063e-01"/>
        <property id="pool1_count" value="63"/>
        <property id="pool2_count" value="31"/>
        <property id="rank" value="61"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST004119" confidence="" id="4119" length="1118" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST004119">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.722222e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.068966e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="17"/>
        <property id="rank" value="110"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003221" confidence="" id="3221" length="1430" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST003221">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="9.920635e-03"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="8.536585e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.619910e-02"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="6"/>
        <property id="rank" value="26"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST015285" confidence="" id="15285" length="540" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST015285">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.285714e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="7.407407e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="9.312863e-01"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="100"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003927" confidence="" id="3927" length="939" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <entry_features accession="TESTTEST003927">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.968254e-04"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="3.333333e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.373219e-11"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="48"/>
        <property id="rank" value="2"/>
        <property id="rejection" value="1"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000737" confidence="" id="737" length="1211" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL domain;</definition>
    <entry_features accession="TESTTEST000737">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.698413e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="7.647059e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.070695e-01"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="66"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001017" confidence="" id="1017" length="1032" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR003594:ATP-binding region, ATPase-like; IPR004358:Signal transduction histidine kinase-related protein, C-terminal;</definition>
    <entry_features accession="TESTTEST001017">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.698413e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="7.647059e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.070695e-01"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="12"/>
        <property id="rank" value="66"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000339" confidence="" id="339" length="1588" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000339">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.571429e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.454545e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.039795e-01"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="14"/>
        <property id="rank" value="85"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST008417" confidence="" id="8417" length="822" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST008417">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.547619e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.833333e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.349037e-01"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="15"/>
        <property id="rank" value="39"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001448" confidence="" id="1448" length="1192" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001448">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.404762e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.053571e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="9.470957e-01"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="33"/>
        <property id="rank" value="102"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000518" confidence="" id="518" length="1351" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000518">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="6.746032e-03"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.774648e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.107674e-02"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="30"/>
        <property id="rank" value="18"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST002069" confidence="" id="2069" length="608" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000789:Cyclin-dependent kinase, regulatory subunit;</definition>
    <entry_features accession="TESTTEST002069">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.023810e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.850829e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="2.832088e-01"/>
        <property id="pool1_count" value="248"/>
        <property id="pool2_count" value="114"/>
        <property id="rank" value="50"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST000533" confidence="" id="533" length="2542" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST000533">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.825397e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.307692e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.941038e-01"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="24"/>
        <property id="rank" value="46"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST014790" confidence="" id="14790" length="992" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST014790">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.230159e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="5.714286e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.217585e-02"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="18"/>
        <property id="rank" value="31"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST014061" confidence="" id="14061" length="499" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core;</definition>
    <entry_features accession="TESTTEST014061">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.134921e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="7.692308e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.517689e-01"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="9"/>
        <property id="rank" value="75"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003004" confidence="" id="3004" length="692" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase; IPR006259:Adenylate kinase, subfamily; IPR007862:Adenylate kinase, zinc-finger lid region;</definition>
    <entry_features accession="TESTTEST003004">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.373016e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.377049e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="6.060537e-01"/>
        <property id="pool1_count" value="90"/>
        <property id="pool2_count" value="32"/>
        <property id="rank" value="80"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST001542" confidence="" id="1542" length="1285" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST001542">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.801587e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.166667e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="86"/>
        <property id="pool2_count" value="34"/>
        <property id="rank" value="112"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003103" confidence="" id="3103" length="928" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000850:Adenylate kinase;</definition>
    <entry_features accession="TESTTEST003103">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.293651e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.724138e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.921059e-01"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="19"/>
        <property id="rank" value="78"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST003590" confidence="" id="3590" length="805" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <entry_features accession="TESTTEST003590">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.388889e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.620690e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.009436e-01"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="4"/>
        <property id="rank" value="35"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST043433" confidence="" id="43433" length="685" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR006204:GHMP kinase;</definition>
    <entry_features accession="TESTTEST043433">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.285714e-02"/>
        <property id="N_count1count2" value="2"/>
        <property id="P_gene" value="7.407407e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="9.312863e-01"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="100"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005297" confidence="" id="5297" length="513" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <entry_features accession="TESTTEST005297">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="3.849206e-02"/>
        <property id="N_count1count2" value="4"/>
        <property id="P_gene" value="7.586207e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="7.475916e-01"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="rank" value="92"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST005971" confidence="" id="5971" length="540" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <entry_features accession="TESTTEST005971">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="1.269841e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="8.461538e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="8.291342e-02"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="6"/>
        <property id="rank" value="32"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST029496" confidence="" id="29496" length="316" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR011611:Carbohydrate/purine kinase;</definition>
    <entry_features accession="TESTTEST029496">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="4.682540e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="7.000000e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="1.000000e+00"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="9"/>
        <property id="rank" value="109"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TESTTEST010564" confidence="" id="10564" length="801" locus_tag="" type="mRNA" version="20010101" xmlfile="">
    <definition id="product" ontology="NONE">IPR001048:Aspartate/glutamate/uridylate kinase;</definition>
    <entry_features accession="TESTTEST010564">
      <pattern definition="Susko2004" type="test">
        <property id="B-H_cutoff" value="2.976190e-02"/>
        <property id="N_count1count2" value="1"/>
        <property id="P_gene" value="6.666667e-01"/>
        <property id="P_random" value="7.120302e-01"/>
        <property id="p-value" value="5.188399e-01"/>
        <property id="pool1_count" value="40"/>
        <property id="pool2_count" value="20"/>
        <property id="rank" value="71"/>
        <property id="rejection" value="0"/>
      </pattern>
    </entry_features>
  </entry>
</entry_db>
BIOSTestDifferentialGeneExpressionFromXml_DESeq 2017.05.28 02:05:31 Execution time: 50 s.
Show or Hide

BioMOBY

  • URI: bios.toulouse.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.toulouse.inra.fr/playmoby/rdf/inra_BIOSTestDifferentialGeneExpressionFromXml_DESeq.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr

statistics

Format

Show or HideShow perl code used to test statistics format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromXml_DESeq/test/BIOSTestDifferentialGeneExpressionFromXml_DESeq.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromXml_DESeq/test/BIOSTestDifferentialGeneExpressionFromXml_DESeq.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test statistics content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromXml_DESeq/test/BIOSTestDifferentialGeneExpressionFromXml_DESeq.xml and http://bios.toulouse.inra.fr/playmoby/services/BIOSTestDifferentialGeneExpressionFromXml_DESeq/test/BIOSTestDifferentialGeneExpressionFromXml_DESeq.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for statistics

<?xml version="1.0"?>
<entry_db>
  <entry accession="TEST003951" version="20010101" id="53449" confidence="" type="mRNA" locus_tag="" length="861" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST003951">
      <pattern type="pool" definition="pool1">
        <property id="count" value="23"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="13"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST003951">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="17.3241161390704"/>
        <property id="baseMeanA" value="16.2634559672906"/>
        <property id="baseMeanB" value="18.3847763108502"/>
        <property id="foldChange" value="1.1304347826087"/>
        <property id="log2FoldChange" value="0.176877762084079"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="13"/>
        <property id="pval" value="0.945165552703669"/>
        <property id="rank" value="481"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST016716" version="20010101" id="32" confidence="" type="mRNA" locus_tag="" length="590" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST016716">
      <pattern type="pool" definition="pool1">
        <property id="count" value="21"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="10"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST016716">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="14.4956890143242"/>
        <property id="baseMeanA" value="14.8492424049175"/>
        <property id="baseMeanB" value="14.1421356237309"/>
        <property id="foldChange" value="0.952380952380952"/>
        <property id="log2FoldChange" value="-0.0703893278913982"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="1"/>
        <property id="rank" value="696"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST058791" version="20010101" id="54519" confidence="" type="mRNA" locus_tag="" length="477" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000023:Phosphofructokinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST058791">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST058791">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="756"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST026919" version="20010101" id="26734" confidence="" type="mRNA" locus_tag="" length="494" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST026919">
      <pattern type="pool" definition="pool1">
        <property id="count" value="31"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="13"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST026919">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="20.1525432638166"/>
        <property id="baseMeanA" value="21.920310216783"/>
        <property id="baseMeanB" value="18.3847763108502"/>
        <property id="foldChange" value="0.838709677419355"/>
        <property id="log2FoldChange" value="-0.253756592245783"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="31"/>
        <property id="pool2_count" value="13"/>
        <property id="pval" value="0.911399062942818"/>
        <property id="rank" value="413"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST056776" version="20010101" id="25113" confidence="" type="mRNA" locus_tag="" length="708" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST056776">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST056776">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.76776695296637"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.692910641955849"/>
        <property id="rank" value="185"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST020916" version="20010101" id="4863" confidence="" type="mRNA" locus_tag="" length="519" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST020916">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST020916">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.82842712474619"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="828"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST004140" version="20010101" id="35162" confidence="" type="mRNA" locus_tag="" length="960" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST004140">
      <pattern type="pool" definition="pool1">
        <property id="count" value="19"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="7"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST004140">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="11.667261889578"/>
        <property id="baseMeanA" value="13.4350288425444"/>
        <property id="baseMeanB" value="9.89949493661167"/>
        <property id="foldChange" value="0.736842105263158"/>
        <property id="log2FoldChange" value="-0.440572591385982"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="19"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.872063761184108"/>
        <property id="rank" value="348"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001383" version="20010101" id="6638" confidence="" type="mRNA" locus_tag="" length="1357" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001412:Aminoacyl-tRNA synthetase, class I, conserved site; IPR011147:Bifunctional aspartokinase/homoserine dehydrogenase I; IPR016040:NAD(P)-binding domain;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001383">
      <pattern type="pool" definition="pool1">
        <property id="count" value="27"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="26"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001383">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="27.9307178568686"/>
        <property id="baseMeanA" value="19.0918830920368"/>
        <property id="baseMeanB" value="36.7695526217005"/>
        <property id="foldChange" value="1.92592592592593"/>
        <property id="log2FoldChange" value="0.945552215977623"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="26"/>
        <property id="pval" value="0.46900325549312"/>
        <property id="rank" value="53"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST031525" version="20010101" id="48524" confidence="" type="mRNA" locus_tag="" length="466" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST031525">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST031525">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="453"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST043282" version="20010101" id="39789" confidence="" type="mRNA" locus_tag="" length="830" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST043282">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST043282">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="745"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST035754" version="20010101" id="28053" confidence="" type="mRNA" locus_tag="" length="593" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST035754">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST035754">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="5.65685424949238"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="1.66666666666667"/>
        <property id="log2FoldChange" value="0.736965594166206"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.834815784757622"/>
        <property id="rank" value="321"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST036043" version="20010101" id="10374" confidence="" type="mRNA" locus_tag="" length="530" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST036043">
      <pattern type="pool" definition="pool1">
        <property id="count" value="10"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST036043">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="5.65685424949238"/>
        <property id="baseMeanA" value="7.07106781186548"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="0.6"/>
        <property id="log2FoldChange" value="-0.736965594166206"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="10"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.869625927119118"/>
        <property id="rank" value="347"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002026" version="20010101" id="3830" confidence="" type="mRNA" locus_tag="" length="1245" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002026">
      <pattern type="pool" definition="pool1">
        <property id="count" value="7"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="7"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002026">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="7.42462120245875"/>
        <property id="baseMeanA" value="4.94974746830583"/>
        <property id="baseMeanB" value="9.89949493661167"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="7"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.690847042594158"/>
        <property id="rank" value="182"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST035607" version="20010101" id="24464" confidence="" type="mRNA" locus_tag="" length="646" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST035607">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST035607">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.947017326726345"/>
        <property id="rank" value="500"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002989" version="20010101" id="42321" confidence="" type="mRNA" locus_tag="" length="800" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002989">
      <pattern type="pool" definition="pool1">
        <property id="count" value="20"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002989">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="10.6066017177982"/>
        <property id="baseMeanA" value="14.142135623731"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="0.5"/>
        <property id="log2FoldChange" value="-1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.650887702156305"/>
        <property id="rank" value="139"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006906" version="20010101" id="35591" confidence="" type="mRNA" locus_tag="" length="808" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006906">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006906">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="6"/>
        <property id="log2FoldChange" value="2.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.643057173399087"/>
        <property id="rank" value="136"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST003590" version="20010101" id="49280" confidence="" type="mRNA" locus_tag="" length="805" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST003590">
      <pattern type="pool" definition="pool1">
        <property id="count" value="25"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST003590">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="11.667261889578"/>
        <property id="baseMeanA" value="17.6776695296637"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="0.32"/>
        <property id="log2FoldChange" value="-1.64385618977472"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="25"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.409523159836387"/>
        <property id="rank" value="41"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST019816" version="20010101" id="12560" confidence="" type="mRNA" locus_tag="" length="399" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST019816">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST019816">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="462"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST049500" version="20010101" id="20984" confidence="" type="mRNA" locus_tag="" length="388" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST049500">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST049500">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="444"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST000551" version="20010101" id="37193" confidence="" type="mRNA" locus_tag="" length="1851" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL domain;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST000551">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST000551">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="739"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST069969" version="20010101" id="28659" confidence="" type="mRNA" locus_tag="" length="354" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001564:Nucleoside diphosphate kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST069969">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST069969">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="5.65685424949238"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="3"/>
        <property id="log2FoldChange" value="1.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.575860836724453"/>
        <property id="rank" value="88"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST000830" version="20010101" id="51196" confidence="" type="mRNA" locus_tag="" length="1105" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001576:Phosphoglycerate kinase; IPR015824:Phosphoglycerate kinase, N-terminal; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST000830">
      <pattern type="pool" definition="pool1">
        <property id="count" value="195"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="83"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST000830">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="127.632774004172"/>
        <property id="baseMeanA" value="137.885822331377"/>
        <property id="baseMeanB" value="117.379725676967"/>
        <property id="foldChange" value="0.851282051282051"/>
        <property id="log2FoldChange" value="-0.232290882402686"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="195"/>
        <property id="pool2_count" value="83"/>
        <property id="pval" value="0.82516067898171"/>
        <property id="rank" value="300"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST000388" version="20010101" id="16813" confidence="" type="mRNA" locus_tag="" length="1195" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST000388">
      <pattern type="pool" definition="pool1">
        <property id="count" value="33"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="24"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST000388">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="28.6378246380552"/>
        <property id="baseMeanA" value="23.3345237791561"/>
        <property id="baseMeanB" value="33.9411254969543"/>
        <property id="foldChange" value="1.45454545454545"/>
        <property id="log2FoldChange" value="0.540568381362702"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="33"/>
        <property id="pool2_count" value="24"/>
        <property id="pval" value="0.685722248712097"/>
        <property id="rank" value="174"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST059831" version="20010101" id="11083" confidence="" type="mRNA" locus_tag="" length="464" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST059831">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST059831">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="765"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST070179" version="20010101" id="18511" confidence="" type="mRNA" locus_tag="" length="354" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST070179">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST070179">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="780"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST028107" version="20010101" id="24578" confidence="" type="mRNA" locus_tag="" length="431" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000023:Phosphofructokinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST028107">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST028107">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="702"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST027544" version="20010101" id="52200" confidence="" type="mRNA" locus_tag="" length="458" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST027544">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST027544">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="719"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006665" version="20010101" id="21818" confidence="" type="mRNA" locus_tag="" length="563" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006665">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006665">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.94974746830583"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="6"/>
        <property id="log2FoldChange" value="2.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.400571602410249"/>
        <property id="rank" value="34"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015726" version="20010101" id="2160" confidence="" type="mRNA" locus_tag="" length="455" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR013035:Phosphoenolpyruvate carboxykinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015726">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015726">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.61023348063865"/>
        <property id="rank" value="103"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST014229" version="20010101" id="3785" confidence="" type="mRNA" locus_tag="" length="474" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST014229">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST014229">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.18198051533946"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.868174454535692"/>
        <property id="rank" value="343"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST020686" version="20010101" id="43074" confidence="" type="mRNA" locus_tag="" length="579" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST020686">
      <pattern type="pool" definition="pool1">
        <property id="count" value="20"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST020686">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="11.3137084989848"/>
        <property id="baseMeanA" value="14.142135623731"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="0.6"/>
        <property id="log2FoldChange" value="-0.736965594166206"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.74496053025916"/>
        <property id="rank" value="217"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST060664" version="20010101" id="10734" confidence="" type="mRNA" locus_tag="" length="451" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST060664">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST060664">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="573"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001053" version="20010101" id="11698" confidence="" type="mRNA" locus_tag="" length="1004" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000850:Adenylate kinase; IPR006266:UMP-CMP kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001053">
      <pattern type="pool" definition="pool1">
        <property id="count" value="42"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="12"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001053">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="23.3345237791561"/>
        <property id="baseMeanA" value="29.698484809835"/>
        <property id="baseMeanB" value="16.9705627484771"/>
        <property id="foldChange" value="0.571428571428571"/>
        <property id="log2FoldChange" value="-0.807354922057604"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.588498939926583"/>
        <property id="rank" value="94"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST065967" version="20010101" id="45819" confidence="" type="mRNA" locus_tag="" length="392" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000961:AGC-kinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST065967">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST065967">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="744"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST065341" version="20010101" id="42116" confidence="" type="mRNA" locus_tag="" length="406" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST065341">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST065341">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="628"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST000063" version="20010101" id="25026" confidence="" type="mRNA" locus_tag="" length="2073" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST000063">
      <pattern type="pool" definition="pool1">
        <property id="count" value="184"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="99"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST000063">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="135.057395206631"/>
        <property id="baseMeanA" value="130.107647738325"/>
        <property id="baseMeanB" value="140.007142674936"/>
        <property id="foldChange" value="1.07608695652174"/>
        <property id="log2FoldChange" value="0.105794664022597"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="184"/>
        <property id="pool2_count" value="99"/>
        <property id="pval" value="0.912478886795147"/>
        <property id="rank" value="417"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST027581" version="20010101" id="30160" confidence="" type="mRNA" locus_tag="" length="456" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST027581">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST027581">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.18198051533946"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="8"/>
        <property id="log2FoldChange" value="3"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.496692621619262"/>
        <property id="rank" value="66"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006510" version="20010101" id="15" confidence="" type="mRNA" locus_tag="" length="867" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006510">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006510">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="804"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST018199" version="20010101" id="33366" confidence="" type="mRNA" locus_tag="" length="838" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST018199">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST018199">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.947017326726345"/>
        <property id="rank" value="491"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST047099" version="20010101" id="9377" confidence="" type="mRNA" locus_tag="" length="429" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST047099">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST047099">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="623"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002113" version="20010101" id="29719" confidence="" type="mRNA" locus_tag="" length="906" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR006828:5-AMP-activated protein kinase, beta subunit, complex-interacting region;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002113">
      <pattern type="pool" definition="pool1">
        <property id="count" value="21"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="11"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002113">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="15.2027957955108"/>
        <property id="baseMeanA" value="14.8492424049175"/>
        <property id="baseMeanB" value="15.556349186104"/>
        <property id="foldChange" value="1.04761904761905"/>
        <property id="log2FoldChange" value="0.0671141958585367"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="11"/>
        <property id="pval" value="1"/>
        <property id="rank" value="798"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST020386" version="20010101" id="23671" confidence="" type="mRNA" locus_tag="" length="729" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST020386">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST020386">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.658232834533712"/>
        <property id="rank" value="150"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002489" version="20010101" id="2236" confidence="" type="mRNA" locus_tag="" length="961" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR014746:Glutamine synthetase/guanido kinase, catalytic region;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002489">
      <pattern type="pool" definition="pool1">
        <property id="count" value="26"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="17"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002489">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="21.2132034355964"/>
        <property id="baseMeanA" value="18.3847763108502"/>
        <property id="baseMeanB" value="24.0416305603426"/>
        <property id="foldChange" value="1.30769230769231"/>
        <property id="log2FoldChange" value="0.387023123109247"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="17"/>
        <property id="pval" value="0.808036219636551"/>
        <property id="rank" value="278"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST012410" version="20010101" id="43952" confidence="" type="mRNA" locus_tag="" length="857" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST012410">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="7"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST012410">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="9.89949493661167"/>
        <property id="foldChange" value="4.66666666666667"/>
        <property id="log2FoldChange" value="2.22239242133645"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.406548338691495"/>
        <property id="rank" value="39"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST011337" version="20010101" id="10976" confidence="" type="mRNA" locus_tag="" length="1040" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST011337">
      <pattern type="pool" definition="pool1">
        <property id="count" value="47"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="7"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST011337">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="21.5667568261897"/>
        <property id="baseMeanA" value="33.2340187157677"/>
        <property id="baseMeanB" value="9.89949493661167"/>
        <property id="foldChange" value="0.297872340425532"/>
        <property id="log2FoldChange" value="-1.74723392962003"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="47"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.243387866525943"/>
        <property id="rank" value="18"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST011629" version="20010101" id="17545" confidence="" type="mRNA" locus_tag="" length="618" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR014746:Glutamine synthetase/guanido kinase, catalytic region;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST011629">
      <pattern type="pool" definition="pool1">
        <property id="count" value="19"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST011629">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="9.54594154601839"/>
        <property id="baseMeanA" value="13.4350288425444"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="0.421052631578947"/>
        <property id="log2FoldChange" value="-1.24792751344359"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="19"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.585645788863143"/>
        <property id="rank" value="92"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST029079" version="20010101" id="42742" confidence="" type="mRNA" locus_tag="" length="372" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001206:Diacylglycerol kinase, catalytic region;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST029079">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST029079">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="581"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST043800" version="20010101" id="36494" confidence="" type="mRNA" locus_tag="" length="569" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST043800">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST043800">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="468"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST017330" version="20010101" id="46974" confidence="" type="mRNA" locus_tag="" length="460" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST017330">
      <pattern type="pool" definition="pool1">
        <property id="count" value="7"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST017330">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.88908729652601"/>
        <property id="baseMeanA" value="4.94974746830583"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="0.571428571428571"/>
        <property id="log2FoldChange" value="-0.807354922057604"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="7"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.917022298340045"/>
        <property id="rank" value="419"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST018474" version="20010101" id="16639" confidence="" type="mRNA" locus_tag="" length="625" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST018474">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST018474">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="586"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST038552" version="20010101" id="49893" confidence="" type="mRNA" locus_tag="" length="427" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR008656:Inositol 1, 3, 4-trisphosphate 56-kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST038552">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST038552">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="650"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST018288" version="20010101" id="35301" confidence="" type="mRNA" locus_tag="" length="742" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST018288">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST018288">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="615"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST003779" version="20010101" id="20310" confidence="" type="mRNA" locus_tag="" length="792" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST003779">
      <pattern type="pool" definition="pool1">
        <property id="count" value="23"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST003779">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="10.2530483272049"/>
        <property id="baseMeanA" value="16.2634559672906"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="0.260869565217391"/>
        <property id="log2FoldChange" value="-1.93859945533586"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.366363543840374"/>
        <property id="rank" value="28"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002401" version="20010101" id="6003" confidence="" type="mRNA" locus_tag="" length="817" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002401">
      <pattern type="pool" definition="pool1">
        <property id="count" value="79"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="14"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002401">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="37.8302127934803"/>
        <property id="baseMeanA" value="55.8614357137373"/>
        <property id="baseMeanB" value="19.7989898732233"/>
        <property id="foldChange" value="0.354430379746835"/>
        <property id="log2FoldChange" value="-1.4964258261195"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="14"/>
        <property id="pval" value="0.225527835396113"/>
        <property id="rank" value="17"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST014638" version="20010101" id="23423" confidence="" type="mRNA" locus_tag="" length="395" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000850:Adenylate kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST014638">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST014638">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="574"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST011921" version="20010101" id="32292" confidence="" type="mRNA" locus_tag="" length="482" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002498:Phosphatidylinositol-4-phosphate 5-kinase, core; IPR016034:Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST011921">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST011921">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.94974746830583"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="6"/>
        <property id="log2FoldChange" value="2.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.400571602410249"/>
        <property id="rank" value="35"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST014883" version="20010101" id="26448" confidence="" type="mRNA" locus_tag="" length="774" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST014883">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST014883">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.24264068711929"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-3.20342650381492e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="1"/>
        <property id="rank" value="663"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST008622" version="20010101" id="44484" confidence="" type="mRNA" locus_tag="" length="590" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST008622">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST008622">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.36396103067893"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.723430102972947"/>
        <property id="rank" value="209"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST004342" version="20010101" id="20047" confidence="" type="mRNA" locus_tag="" length="1181" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002573:Choline/ethanolamine kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST004342">
      <pattern type="pool" definition="pool1">
        <property id="count" value="30"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="10"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST004342">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="17.6776695296637"/>
        <property id="baseMeanA" value="21.2132034355964"/>
        <property id="baseMeanB" value="14.1421356237309"/>
        <property id="foldChange" value="0.666666666666667"/>
        <property id="log2FoldChange" value="-0.584962500721156"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="0.745074367117374"/>
        <property id="rank" value="218"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST028085" version="20010101" id="7437" confidence="" type="mRNA" locus_tag="" length="434" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST028085">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST028085">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.18198051533946"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.868174454535692"/>
        <property id="rank" value="339"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001720" version="20010101" id="29583" confidence="" type="mRNA" locus_tag="" length="648" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000623:Shikimate kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001720">
      <pattern type="pool" definition="pool1">
        <property id="count" value="89"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="13"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001720">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="40.6586399182265"/>
        <property id="baseMeanA" value="62.9325035256027"/>
        <property id="baseMeanB" value="18.3847763108502"/>
        <property id="foldChange" value="0.292134831460674"/>
        <property id="log2FoldChange" value="-1.77529371282531"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="89"/>
        <property id="pool2_count" value="13"/>
        <property id="pval" value="0.144569946610131"/>
        <property id="rank" value="7"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST066380" version="20010101" id="24815" confidence="" type="mRNA" locus_tag="" length="387" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR003152:PIK-related kinase, FATC;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST066380">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST066380">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="589"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST014316" version="20010101" id="33668" confidence="" type="mRNA" locus_tag="" length="460" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST014316">
      <pattern type="pool" definition="pool1">
        <property id="count" value="10"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST014316">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="7.07106781186548"/>
        <property id="baseMeanA" value="7.07106781186548"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="10"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="1"/>
        <property id="rank" value="796"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST031695" version="20010101" id="9355" confidence="" type="mRNA" locus_tag="" length="463" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST031695">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST031695">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="582"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST035320" version="20010101" id="44230" confidence="" type="mRNA" locus_tag="" length="935" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST035320">
      <pattern type="pool" definition="pool1">
        <property id="count" value="8"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST035320">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.82842712474619"/>
        <property id="baseMeanA" value="5.65685424949238"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="8"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.472592970272236"/>
        <property id="rank" value="59"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002321" version="20010101" id="30321" confidence="" type="mRNA" locus_tag="" length="685" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002321">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002321">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1.33333333333333"/>
        <property id="log2FoldChange" value="0.415037499278843"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="797"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST023219" version="20010101" id="18215" confidence="" type="mRNA" locus_tag="" length="595" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR008144:Guanylate kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST023219">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST023219">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.947017326726345"/>
        <property id="rank" value="488"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006921" version="20010101" id="38628" confidence="" type="mRNA" locus_tag="" length="786" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002192:Pyruvate phosphate dikinase, PEP/pyruvate-binding; IPR013815:ATP-grasp fold, subdomain 1;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006921">
      <pattern type="pool" definition="pool1">
        <property id="count" value="11"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006921">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.59619407771256"/>
        <property id="baseMeanA" value="7.77817459305202"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.181818181818182"/>
        <property id="log2FoldChange" value="-2.4594316186373"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="11"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.520401136644474"/>
        <property id="rank" value="71"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST019021" version="20010101" id="19503" confidence="" type="mRNA" locus_tag="" length="479" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST019021">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST019021">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.76776695296637"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.666666666666667"/>
        <property id="log2FoldChange" value="-0.584962500721157"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="806"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST018185" version="20010101" id="15048" confidence="" type="mRNA" locus_tag="" length="871" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST018185">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST018185">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="6"/>
        <property id="log2FoldChange" value="2.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.643057173399087"/>
        <property id="rank" value="134"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST005777" version="20010101" id="3439" confidence="" type="mRNA" locus_tag="" length="882" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST005777">
      <pattern type="pool" definition="pool1">
        <property id="count" value="10"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST005777">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.36396103067893"/>
        <property id="baseMeanA" value="7.07106781186548"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="0.8"/>
        <property id="log2FoldChange" value="-0.321928094887363"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="10"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.992160097148744"/>
        <property id="rank" value="609"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST062713" version="20010101" id="993" confidence="" type="mRNA" locus_tag="" length="428" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST062713">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST062713">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="580"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST016996" version="20010101" id="20833" confidence="" type="mRNA" locus_tag="" length="500" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR003175:Cyclin-dependent kinase inhibitor;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST016996">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST016996">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="2.4"/>
        <property id="log2FoldChange" value="1.26303440583379"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.652301387183059"/>
        <property id="rank" value="142"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST043863" version="20010101" id="41849" confidence="" type="mRNA" locus_tag="" length="557" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR013926:Kinase binding protein CGI-121;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST043863">
      <pattern type="pool" definition="pool1">
        <property id="count" value="7"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST043863">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.7175144212722"/>
        <property id="baseMeanA" value="4.94974746830583"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="1.71428571428571"/>
        <property id="log2FoldChange" value="0.777607578663552"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="7"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.790137474602546"/>
        <property id="rank" value="274"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST013723" version="20010101" id="22225" confidence="" type="mRNA" locus_tag="" length="651" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015865:Riboflavin kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST013723">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST013723">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="614"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST046067" version="20010101" id="27193" confidence="" type="mRNA" locus_tag="" length="451" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST046067">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST046067">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="794"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST039167" version="20010101" id="10789" confidence="" type="mRNA" locus_tag="" length="408" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST039167">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST039167">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.4142135623731"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.785144262346599"/>
        <property id="rank" value="257"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015224" version="20010101" id="41564" confidence="" type="mRNA" locus_tag="" length="562" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015224">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015224">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="727"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001448" version="20010101" id="28422" confidence="" type="mRNA" locus_tag="" length="1192" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001448">
      <pattern type="pool" definition="pool1">
        <property id="count" value="79"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="33"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001448">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="51.2652416360247"/>
        <property id="baseMeanA" value="55.8614357137373"/>
        <property id="baseMeanB" value="46.6690475583121"/>
        <property id="foldChange" value="0.835443037974683"/>
        <property id="log2FoldChange" value="-0.25938662881865"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="79"/>
        <property id="pool2_count" value="33"/>
        <property id="pval" value="0.842398408311554"/>
        <property id="rank" value="325"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST035744" version="20010101" id="38674" confidence="" type="mRNA" locus_tag="" length="598" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST035744">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST035744">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.76776695296637"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.692910641955849"/>
        <property id="rank" value="191"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST003927" version="20010101" id="11881" confidence="" type="mRNA" locus_tag="" length="939" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST003927">
      <pattern type="pool" definition="pool1">
        <property id="count" value="24"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="48"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST003927">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="42.4264068711929"/>
        <property id="baseMeanA" value="16.9705627484771"/>
        <property id="baseMeanB" value="67.8822509939086"/>
        <property id="foldChange" value="4"/>
        <property id="log2FoldChange" value="2"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="24"/>
        <property id="pool2_count" value="48"/>
        <property id="pval" value="0.0881250939473103"/>
        <property id="rank" value="4"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST044145" version="20010101" id="32828" confidence="" type="mRNA" locus_tag="" length="514" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST044145">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST044145">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.88908729652601"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="1.2"/>
        <property id="log2FoldChange" value="0.263034405833794"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="1"/>
        <property id="rank" value="629"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST031314" version="20010101" id="51396" confidence="" type="mRNA" locus_tag="" length="477" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015794:Pyruvate kinase, alpha/beta;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST031314">
      <pattern type="pool" definition="pool1">
        <property id="count" value="9"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST031314">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="6.36396103067893"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="0.888888888888889"/>
        <property id="log2FoldChange" value="-0.169925001442313"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="9"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="1"/>
        <property id="rank" value="741"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST005092" version="20010101" id="47726" confidence="" type="mRNA" locus_tag="" length="1334" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001048:Aspartate/glutamate/uridylate kinase; IPR018042:Aspartate kinase, conserved site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST005092">
      <pattern type="pool" definition="pool1">
        <property id="count" value="22"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="7"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST005092">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.7279220613579"/>
        <property id="baseMeanA" value="15.556349186104"/>
        <property id="baseMeanB" value="9.89949493661167"/>
        <property id="foldChange" value="0.636363636363636"/>
        <property id="log2FoldChange" value="-0.652076696579693"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.762440587291346"/>
        <property id="rank" value="237"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST019266" version="20010101" id="40812" confidence="" type="mRNA" locus_tag="" length="456" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015275:Actin-fragmin kinase, catalytic;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST019266">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST019266">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.465228580373767"/>
        <property id="rank" value="50"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST030280" version="20010101" id="23836" confidence="" type="mRNA" locus_tag="" length="634" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR006567:PUG domain; IPR010513:Ribonuclease L; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST030280">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST030280">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="783"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST043797" version="20010101" id="2807" confidence="" type="mRNA" locus_tag="" length="568" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000961:AGC-kinase, C-terminal; IPR017892:Protein kinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST043797">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST043797">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="854"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015603" version="20010101" id="47472" confidence="" type="mRNA" locus_tag="" length="469" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015603">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015603">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1.33333333333333"/>
        <property id="log2FoldChange" value="0.415037499278843"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="661"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001387" version="20010101" id="36866" confidence="" type="mRNA" locus_tag="" length="1222" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR005935:Diphosphomevalonate decarboxylase; IPR006204:GHMP kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001387">
      <pattern type="pool" definition="pool1">
        <property id="count" value="35"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001387">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="16.6170093578839"/>
        <property id="baseMeanA" value="24.7487373415292"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="0.342857142857143"/>
        <property id="log2FoldChange" value="-1.54432051622381"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="35"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.354985746229498"/>
        <property id="rank" value="27"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST003848" version="20010101" id="27732" confidence="" type="mRNA" locus_tag="" length="534" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST003848">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST003848">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="861"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST043433" version="20010101" id="11386" confidence="" type="mRNA" locus_tag="" length="685" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR006204:GHMP kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST043433">
      <pattern type="pool" definition="pool1">
        <property id="count" value="20"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="7"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST043433">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.0208152801713"/>
        <property id="baseMeanA" value="14.142135623731"/>
        <property id="baseMeanB" value="9.89949493661167"/>
        <property id="foldChange" value="0.7"/>
        <property id="log2FoldChange" value="-0.514573172829758"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.834024350836267"/>
        <property id="rank" value="319"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST020997" version="20010101" id="54158" confidence="" type="mRNA" locus_tag="" length="504" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST020997">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST020997">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="6"/>
        <property id="log2FoldChange" value="2.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.643057173399087"/>
        <property id="rank" value="129"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST044727" version="20010101" id="18973" confidence="" type="mRNA" locus_tag="" length="494" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000850:Adenylate kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST044727">
      <pattern type="pool" definition="pool1">
        <property id="count" value="12"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST044727">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.36396103067893"/>
        <property id="baseMeanA" value="8.48528137423857"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="0.5"/>
        <property id="log2FoldChange" value="-1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="12"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.762843296874059"/>
        <property id="rank" value="240"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015273" version="20010101" id="34586" confidence="" type="mRNA" locus_tag="" length="543" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015273">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015273">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="792"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST011546" version="20010101" id="1354" confidence="" type="mRNA" locus_tag="" length="669" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST011546">
      <pattern type="pool" definition="pool1">
        <property id="count" value="7"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST011546">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="4.94974746830583"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="1.42857142857143"/>
        <property id="log2FoldChange" value="0.514573172829758"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="7"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.902568282752711"/>
        <property id="rank" value="409"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST026137" version="20010101" id="46154" confidence="" type="mRNA" locus_tag="" length="707" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST026137">
      <pattern type="pool" definition="pool1">
        <property id="count" value="10"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST026137">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.36396103067893"/>
        <property id="baseMeanA" value="7.07106781186548"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="0.8"/>
        <property id="log2FoldChange" value="-0.321928094887363"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="10"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.992160097148744"/>
        <property id="rank" value="606"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST004371" version="20010101" id="9908" confidence="" type="mRNA" locus_tag="" length="953" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core; IPR018209:Pyruvate kinase, active site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST004371">
      <pattern type="pool" definition="pool1">
        <property id="count" value="8"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST004371">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="7.07106781186548"/>
        <property id="baseMeanA" value="5.65685424949238"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="1.5"/>
        <property id="log2FoldChange" value="0.584962500721156"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="8"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.853020152244589"/>
        <property id="rank" value="333"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST007502" version="20010101" id="160" confidence="" type="mRNA" locus_tag="" length="625" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST007502">
      <pattern type="pool" definition="pool1">
        <property id="count" value="14"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST007502">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.36396103067893"/>
        <property id="baseMeanA" value="9.89949493661167"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="0.285714285714286"/>
        <property id="log2FoldChange" value="-1.8073549220576"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="14"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.538734479875294"/>
        <property id="rank" value="77"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST005116" version="20010101" id="24299" confidence="" type="mRNA" locus_tag="" length="1002" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST005116">
      <pattern type="pool" definition="pool1">
        <property id="count" value="9"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST005116">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.59619407771256"/>
        <property id="baseMeanA" value="6.36396103067893"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="0.444444444444444"/>
        <property id="log2FoldChange" value="-1.16992500144231"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="9"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.789115707757947"/>
        <property id="rank" value="273"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST037563" version="20010101" id="12235" confidence="" type="mRNA" locus_tag="" length="457" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST037563">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST037563">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.24264068711928"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="5"/>
        <property id="log2FoldChange" value="2.32192809488736"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.498413779188869"/>
        <property id="rank" value="67"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST020650" version="20010101" id="11435" confidence="" type="mRNA" locus_tag="" length="594" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST020650">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST020650">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.4142135623731"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.785144262346599"/>
        <property id="rank" value="260"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST014976" version="20010101" id="2776" confidence="" type="mRNA" locus_tag="" length="697" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST014976">
      <pattern type="pool" definition="pool1">
        <property id="count" value="14"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST014976">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="5.65685424949238"/>
        <property id="baseMeanA" value="9.89949493661167"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.142857142857143"/>
        <property id="log2FoldChange" value="-2.8073549220576"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="14"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.393515021996595"/>
        <property id="rank" value="32"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST046637" version="20010101" id="25951" confidence="" type="mRNA" locus_tag="" length="441" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST046637">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST046637">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.53553390593274"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="0.666666666666667"/>
        <property id="log2FoldChange" value="-0.584962500721157"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.9881182608981"/>
        <property id="rank" value="547"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST018710" version="20010101" id="52690" confidence="" type="mRNA" locus_tag="" length="527" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR011611:Carbohydrate/purine kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST018710">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST018710">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="565"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST003570" version="20010101" id="48982" confidence="" type="mRNA" locus_tag="" length="877" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST003570">
      <pattern type="pool" definition="pool1">
        <property id="count" value="11"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST003570">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="7.77817459305202"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="0.545454545454545"/>
        <property id="log2FoldChange" value="-0.874469117916141"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="11"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.814598398550168"/>
        <property id="rank" value="288"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST000737" version="20010101" id="31351" confidence="" type="mRNA" locus_tag="" length="1211" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR004041:NAF; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL domain;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST000737">
      <pattern type="pool" definition="pool1">
        <property id="count" value="39"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="12"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST000737">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="22.2738636073762"/>
        <property id="baseMeanA" value="27.5771644662754"/>
        <property id="baseMeanB" value="16.9705627484771"/>
        <property id="foldChange" value="0.615384615384615"/>
        <property id="log2FoldChange" value="-0.700439718141092"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="39"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.651015423714173"/>
        <property id="rank" value="141"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST037673" version="20010101" id="20788" confidence="" type="mRNA" locus_tag="" length="454" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST037673">
      <pattern type="pool" definition="pool1">
        <property id="count" value="14"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST037673">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.36396103067893"/>
        <property id="baseMeanA" value="9.89949493661167"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="0.285714285714286"/>
        <property id="log2FoldChange" value="-1.8073549220576"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="14"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.538734479875294"/>
        <property id="rank" value="79"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015790" version="20010101" id="38470" confidence="" type="mRNA" locus_tag="" length="447" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015790">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015790">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.18198051533946"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.868174454535692"/>
        <property id="rank" value="344"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST023746" version="20010101" id="36943" confidence="" type="mRNA" locus_tag="" length="488" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR005522:Inositol polyphosphate kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST023746">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST023746">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.5"/>
        <property id="log2FoldChange" value="-1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.985537978420011"/>
        <property id="rank" value="532"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST021367" version="20010101" id="23623" confidence="" type="mRNA" locus_tag="" length="469" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST021367">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST021367">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="690"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST043481" version="20010101" id="1396" confidence="" type="mRNA" locus_tag="" length="667" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST043481">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST043481">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="438"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST037627" version="20010101" id="391" confidence="" type="mRNA" locus_tag="" length="454" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST037627">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST037627">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="753"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002607" version="20010101" id="778" confidence="" type="mRNA" locus_tag="" length="833" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002607">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002607">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="626"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST000339" version="20010101" id="52244" confidence="" type="mRNA" locus_tag="" length="1588" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST000339">
      <pattern type="pool" definition="pool1">
        <property id="count" value="41"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="14"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST000339">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="24.3951839509359"/>
        <property id="baseMeanA" value="28.9913780286485"/>
        <property id="baseMeanB" value="19.7989898732233"/>
        <property id="foldChange" value="0.682926829268293"/>
        <property id="log2FoldChange" value="-0.55019708256048"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="41"/>
        <property id="pool2_count" value="14"/>
        <property id="pval" value="0.720872846247782"/>
        <property id="rank" value="208"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST012785" version="20010101" id="47523" confidence="" type="mRNA" locus_tag="" length="543" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST012785">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST012785">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.76776695296637"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.692910641955849"/>
        <property id="rank" value="195"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST020451" version="20010101" id="26052" confidence="" type="mRNA" locus_tag="" length="685" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST020451">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST020451">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.82842712474619"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="729"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST044368" version="20010101" id="52795" confidence="" type="mRNA" locus_tag="" length="497" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST044368">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST044368">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.947017326726345"/>
        <property id="rank" value="483"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST020472" version="20010101" id="49455" confidence="" type="mRNA" locus_tag="" length="677" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001345:Phosphoglycerate/bisphosphoglycerate mutase, active site; IPR003094:Fructose-2,6-bisphosphatase; IPR013079:6-phosphofructo-2-kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST020472">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST020472">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="684"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002173" version="20010101" id="43326" confidence="" type="mRNA" locus_tag="" length="1621" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000023:Phosphofructokinase; IPR011183:Pyrophosphate-dependent phosphofructokinase PfpB;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002173">
      <pattern type="pool" definition="pool1">
        <property id="count" value="27"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="12"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002173">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.031222920257"/>
        <property id="baseMeanA" value="19.0918830920368"/>
        <property id="baseMeanB" value="16.9705627484771"/>
        <property id="foldChange" value="0.888888888888889"/>
        <property id="log2FoldChange" value="-0.169925001442313"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="27"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.967265371073643"/>
        <property id="rank" value="523"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST005538" version="20010101" id="13612" confidence="" type="mRNA" locus_tag="" length="647" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR003152:PIK-related kinase, FATC;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST005538">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST005538">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.53553390593274"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="1.5"/>
        <property id="log2FoldChange" value="0.584962500721156"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.956602039388895"/>
        <property id="rank" value="506"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST011411" version="20010101" id="33222" confidence="" type="mRNA" locus_tag="" length="813" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST011411">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST011411">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.94974746830583"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="6"/>
        <property id="log2FoldChange" value="2.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.400571602410249"/>
        <property id="rank" value="36"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST025298" version="20010101" id="14158" confidence="" type="mRNA" locus_tag="" length="383" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST025298">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST025298">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.5"/>
        <property id="log2FoldChange" value="-1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.985537978420011"/>
        <property id="rank" value="546"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST045732" version="20010101" id="9683" confidence="" type="mRNA" locus_tag="" length="460" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000704:Casein kinase II, regulatory subunit; IPR016150:Casein kinase II, regulatory subunit, beta-sheet;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST045732">
      <pattern type="pool" definition="pool1">
        <property id="count" value="9"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST045732">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="6.36396103067893"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="0.888888888888889"/>
        <property id="log2FoldChange" value="-0.169925001442313"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="9"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="1"/>
        <property id="rank" value="630"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST012447" version="20010101" id="40636" confidence="" type="mRNA" locus_tag="" length="799" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR006204:GHMP kinase; IPR018260:Ribosomal protein L22/L17, conserved site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST012447">
      <pattern type="pool" definition="pool1">
        <property id="count" value="23"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="15"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST012447">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="18.7383297014435"/>
        <property id="baseMeanA" value="16.2634559672906"/>
        <property id="baseMeanB" value="21.2132034355964"/>
        <property id="foldChange" value="1.30434782608696"/>
        <property id="log2FoldChange" value="0.383328639551505"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="23"/>
        <property id="pool2_count" value="15"/>
        <property id="pval" value="0.82263356971934"/>
        <property id="rank" value="290"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST034043" version="20010101" id="17922" confidence="" type="mRNA" locus_tag="" length="361" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST034043">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST034043">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="566"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006982" version="20010101" id="55758" confidence="" type="mRNA" locus_tag="" length="677" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006982">
      <pattern type="pool" definition="pool1">
        <property id="count" value="8"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="9"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006982">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="9.19238815542512"/>
        <property id="baseMeanA" value="5.65685424949238"/>
        <property id="baseMeanB" value="12.7279220613579"/>
        <property id="foldChange" value="2.25"/>
        <property id="log2FoldChange" value="1.16992500144231"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="8"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="0.583361588982652"/>
        <property id="rank" value="90"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST010922" version="20010101" id="26325" confidence="" type="mRNA" locus_tag="" length="504" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST010922">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST010922">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="738"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002969" version="20010101" id="3162" confidence="" type="mRNA" locus_tag="" length="919" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002969">
      <pattern type="pool" definition="pool1">
        <property id="count" value="11"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="10"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002969">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="10.9601551083915"/>
        <property id="baseMeanA" value="7.77817459305202"/>
        <property id="baseMeanB" value="14.1421356237309"/>
        <property id="foldChange" value="1.81818181818182"/>
        <property id="log2FoldChange" value="0.862496476250065"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="11"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="0.666613859952834"/>
        <property id="rank" value="163"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST018680" version="20010101" id="5072" confidence="" type="mRNA" locus_tag="" length="533" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST018680">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST018680">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.61023348063865"/>
        <property id="rank" value="102"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST060861" version="20010101" id="11675" confidence="" type="mRNA" locus_tag="" length="450" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST060861">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST060861">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="633"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST017142" version="20010101" id="4981" confidence="" type="mRNA" locus_tag="" length="480" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST017142">
      <pattern type="pool" definition="pool1">
        <property id="count" value="8"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST017142">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.82842712474619"/>
        <property id="baseMeanA" value="5.65685424949238"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="8"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.472592970272236"/>
        <property id="rank" value="55"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST067713" version="20010101" id="54570" confidence="" type="mRNA" locus_tag="" length="375" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST067713">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST067713">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="710"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002129" version="20010101" id="33438" confidence="" type="mRNA" locus_tag="" length="788" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002129">
      <pattern type="pool" definition="pool1">
        <property id="count" value="22"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="9"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002129">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="14.142135623731"/>
        <property id="baseMeanA" value="15.556349186104"/>
        <property id="baseMeanB" value="12.7279220613579"/>
        <property id="foldChange" value="0.818181818181818"/>
        <property id="log2FoldChange" value="-0.289506617194985"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="22"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="0.923628451771005"/>
        <property id="rank" value="474"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST069390" version="20010101" id="6631" confidence="" type="mRNA" locus_tag="" length="364" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR016232:cGMP-dependent protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST069390">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST069390">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="631"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST007382" version="20010101" id="5147" confidence="" type="mRNA" locus_tag="" length="765" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST007382">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST007382">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.885600871951716"/>
        <property id="rank" value="373"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST060808" version="20010101" id="45934" confidence="" type="mRNA" locus_tag="" length="450" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002498:Phosphatidylinositol-4-phosphate 5-kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST060808">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST060808">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="826"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006096" version="20010101" id="36059" confidence="" type="mRNA" locus_tag="" length="1199" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001841:Zinc finger, RING-type; IPR013083:; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006096">
      <pattern type="pool" definition="pool1">
        <property id="count" value="11"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006096">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.7175144212722"/>
        <property id="baseMeanA" value="7.77817459305202"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="0.727272727272727"/>
        <property id="log2FoldChange" value="-0.459431618637297"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="11"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.936521121647424"/>
        <property id="rank" value="477"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST037240" version="20010101" id="19716" confidence="" type="mRNA" locus_tag="" length="464" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000623:Shikimate kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST037240">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST037240">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="699"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST024062" version="20010101" id="22801" confidence="" type="mRNA" locus_tag="" length="467" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST024062">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST024062">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="636"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST020887" version="20010101" id="379" confidence="" type="mRNA" locus_tag="" length="524" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001048:Aspartate/glutamate/uridylate kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST020887">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST020887">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="827"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST027904" version="20010101" id="27867" confidence="" type="mRNA" locus_tag="" length="440" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST027904">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST027904">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="819"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST007358" version="20010101" id="50065" confidence="" type="mRNA" locus_tag="" length="808" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR013750:GHMP kinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST007358">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST007358">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1.33333333333333"/>
        <property id="log2FoldChange" value="0.415037499278843"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="879"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST027641" version="20010101" id="44532" confidence="" type="mRNA" locus_tag="" length="459" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST027641">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST027641">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="863"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST004389" version="20010101" id="31614" confidence="" type="mRNA" locus_tag="" length="852" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST004389">
      <pattern type="pool" definition="pool1">
        <property id="count" value="43"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="25"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST004389">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="32.8804653251745"/>
        <property id="baseMeanA" value="30.4055915910215"/>
        <property id="baseMeanB" value="35.3553390593274"/>
        <property id="foldChange" value="1.16279069767442"/>
        <property id="log2FoldChange" value="0.217591435072626"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="43"/>
        <property id="pool2_count" value="25"/>
        <property id="pval" value="0.878816949055425"/>
        <property id="rank" value="351"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST027574" version="20010101" id="40179" confidence="" type="mRNA" locus_tag="" length="458" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST027574">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST027574">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.18198051533946"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="8"/>
        <property id="log2FoldChange" value="3"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.496692621619262"/>
        <property id="rank" value="64"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST059586" version="20010101" id="50636" confidence="" type="mRNA" locus_tag="" length="465" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST059586">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST059586">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.658232834533712"/>
        <property id="rank" value="153"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006156" version="20010101" id="23558" confidence="" type="mRNA" locus_tag="" length="842" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006156">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006156">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="6"/>
        <property id="log2FoldChange" value="2.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.643057173399087"/>
        <property id="rank" value="133"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST003716" version="20010101" id="1871" confidence="" type="mRNA" locus_tag="" length="1334" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR004041:NAF; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL domain;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST003716">
      <pattern type="pool" definition="pool1">
        <property id="count" value="7"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="9"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST003716">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="8.83883476483184"/>
        <property id="baseMeanA" value="4.94974746830583"/>
        <property id="baseMeanB" value="12.7279220613579"/>
        <property id="foldChange" value="2.57142857142857"/>
        <property id="log2FoldChange" value="1.36257007938471"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="7"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="0.52634998951878"/>
        <property id="rank" value="72"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST013880" version="20010101" id="32012" confidence="" type="mRNA" locus_tag="" length="565" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002498:Phosphatidylinositol-4-phosphate 5-kinase, core; IPR016034:Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST013880">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST013880">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.82842712474619"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="3"/>
        <property id="log2FoldChange" value="1.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.76688905582438"/>
        <property id="rank" value="243"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST008330" version="20010101" id="54601" confidence="" type="mRNA" locus_tag="" length="1706" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015793:Pyruvate kinase, barrel; IPR015794:Pyruvate kinase, alpha/beta; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST008330">
      <pattern type="pool" definition="pool1">
        <property id="count" value="101"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="18"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST008330">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="48.4368145112785"/>
        <property id="baseMeanA" value="71.4177848998413"/>
        <property id="baseMeanB" value="25.4558441227157"/>
        <property id="foldChange" value="0.356435643564356"/>
        <property id="log2FoldChange" value="-1.48828648130948"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="101"/>
        <property id="pool2_count" value="18"/>
        <property id="pval" value="0.198350275792917"/>
        <property id="rank" value="14"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015044" version="20010101" id="51158" confidence="" type="mRNA" locus_tag="" length="661" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015044">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015044">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.885600871951716"/>
        <property id="rank" value="374"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST016677" version="20010101" id="48280" confidence="" type="mRNA" locus_tag="" length="604" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST016677">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST016677">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.24264068711928"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.808998248773383"/>
        <property id="rank" value="285"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST009816" version="20010101" id="10433" confidence="" type="mRNA" locus_tag="" length="752" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST009816">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST009816">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.59619407771256"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="1.6"/>
        <property id="log2FoldChange" value="0.678071905112637"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.888916071836602"/>
        <property id="rank" value="394"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST036008" version="20010101" id="52781" confidence="" type="mRNA" locus_tag="" length="536" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR003152:PIK-related kinase, FATC;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST036008">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST036008">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="461"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST017784" version="20010101" id="27968" confidence="" type="mRNA" locus_tag="" length="404" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST017784">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST017784">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.4"/>
        <property id="log2FoldChange" value="-1.32192809488736"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.901843330273052"/>
        <property id="rank" value="405"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015592" version="20010101" id="54647" confidence="" type="mRNA" locus_tag="" length="472" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015592">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015592">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="815"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST069559" version="20010101" id="51751" confidence="" type="mRNA" locus_tag="" length="361" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST069559">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST069559">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.61023348063865"/>
        <property id="rank" value="104"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST043425" version="20010101" id="39029" confidence="" type="mRNA" locus_tag="" length="691" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST043425">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST043425">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="777"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002293" version="20010101" id="3200" confidence="" type="mRNA" locus_tag="" length="998" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002293">
      <pattern type="pool" definition="pool1">
        <property id="count" value="11"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002293">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="8.1317279836453"/>
        <property id="baseMeanA" value="7.77817459305202"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="1.09090909090909"/>
        <property id="log2FoldChange" value="0.125530882083859"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="11"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="1"/>
        <property id="rank" value="726"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST014874" version="20010101" id="46149" confidence="" type="mRNA" locus_tag="" length="784" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST014874">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST014874">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1.33333333333333"/>
        <property id="log2FoldChange" value="0.415037499278843"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="681"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001254" version="20010101" id="765" confidence="" type="mRNA" locus_tag="" length="1123" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR016232:cGMP-dependent protein kinase; IPR017442:Serine/threonine protein kinase-related; IPR017892:Protein kinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001254">
      <pattern type="pool" definition="pool1">
        <property id="count" value="11"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001254">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="7.42462120245875"/>
        <property id="baseMeanA" value="7.77817459305202"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="0.909090909090909"/>
        <property id="log2FoldChange" value="-0.137503523749935"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="11"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="1"/>
        <property id="rank" value="786"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST023631" version="20010101" id="21394" confidence="" type="mRNA" locus_tag="" length="504" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015911:Phosphoglycerate kinase, conserved site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST023631">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST023631">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="472"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST032336" version="20010101" id="54484" confidence="" type="mRNA" locus_tag="" length="436" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST032336">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST032336">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.885600871951716"/>
        <property id="rank" value="367"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015119" version="20010101" id="26667" confidence="" type="mRNA" locus_tag="" length="616" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015119">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015119">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="752"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST026648" version="20010101" id="22091" confidence="" type="mRNA" locus_tag="" length="529" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST026648">
      <pattern type="pool" definition="pool1">
        <property id="count" value="7"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST026648">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="4.94974746830583"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="7"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.53701538200636"/>
        <property id="rank" value="75"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST070427" version="20010101" id="3671" confidence="" type="mRNA" locus_tag="" length="349" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST070427">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST070427">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="740"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST062501" version="20010101" id="53887" confidence="" type="mRNA" locus_tag="" length="428" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR014746:Glutamine synthetase/guanido kinase, catalytic region;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST062501">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST062501">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.76776695296637"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.692910641955849"/>
        <property id="rank" value="190"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006591" version="20010101" id="21963" confidence="" type="mRNA" locus_tag="" length="686" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006591">
      <pattern type="pool" definition="pool1">
        <property id="count" value="21"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006591">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="9.54594154601839"/>
        <property id="baseMeanA" value="14.8492424049175"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="0.285714285714286"/>
        <property id="log2FoldChange" value="-1.8073549220576"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.418874035210124"/>
        <property id="rank" value="42"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006137" version="20010101" id="20739" confidence="" type="mRNA" locus_tag="" length="899" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR013320:Concanavalin A-like lectin/glucanase, subgroup; IPR018483:Carbohydrate kinase, FGGY, conserved site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006137">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006137">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1.33333333333333"/>
        <property id="log2FoldChange" value="0.415037499278843"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="718"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST005600" version="20010101" id="7167" confidence="" type="mRNA" locus_tag="" length="542" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST005600">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST005600">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.885600871951716"/>
        <property id="rank" value="384"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST068017" version="20010101" id="52084" confidence="" type="mRNA" locus_tag="" length="375" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST068017">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST068017">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.24264068711929"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-3.20342650381492e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="1"/>
        <property id="rank" value="735"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST018909" version="20010101" id="29210" confidence="" type="mRNA" locus_tag="" length="491" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST018909">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST018909">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.658232834533712"/>
        <property id="rank" value="151"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST004691" version="20010101" id="41854" confidence="" type="mRNA" locus_tag="" length="716" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST004691">
      <pattern type="pool" definition="pool1">
        <property id="count" value="9"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST004691">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="6.36396103067893"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="0.888888888888889"/>
        <property id="log2FoldChange" value="-0.169925001442313"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="9"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="1"/>
        <property id="rank" value="856"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST027126" version="20010101" id="3819" confidence="" type="mRNA" locus_tag="" length="478" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST027126">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST027126">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.76776695296637"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="4"/>
        <property id="log2FoldChange" value="2"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.828625691559748"/>
        <property id="rank" value="305"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST013878" version="20010101" id="11724" confidence="" type="mRNA" locus_tag="" length="567" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST013878">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST013878">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-1.60171325190746e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="844"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST002858" version="20010101" id="1723" confidence="" type="mRNA" locus_tag="" length="756" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST002858">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST002858">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.24264068711929"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-3.20342650381492e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="1"/>
        <property id="rank" value="866"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST024742" version="20010101" id="30212" confidence="" type="mRNA" locus_tag="" length="423" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR011009:Protein kinase-like;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST024742">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST024742">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.59619407771256"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="1.6"/>
        <property id="log2FoldChange" value="0.678071905112637"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.888916071836602"/>
        <property id="rank" value="390"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST036193" version="20010101" id="2610" confidence="" type="mRNA" locus_tag="" length="513" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST036193">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST036193">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.41421356237309"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.658232834533712"/>
        <property id="rank" value="152"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST038666" version="20010101" id="12458" confidence="" type="mRNA" locus_tag="" length="424" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST038666">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="4"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST038666">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.88908729652601"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="5.65685424949238"/>
        <property id="foldChange" value="2.66666666666667"/>
        <property id="log2FoldChange" value="1.41503749927884"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="4"/>
        <property id="pval" value="0.720375642315134"/>
        <property id="rank" value="202"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST038590" version="20010101" id="4619" confidence="" type="mRNA" locus_tag="" length="424" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST038590">
      <pattern type="pool" definition="pool1">
        <property id="count" value="7"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST038590">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.59619407771256"/>
        <property id="baseMeanA" value="4.94974746830583"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="0.857142857142857"/>
        <property id="log2FoldChange" value="-0.222392421336448"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="7"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="1"/>
        <property id="rank" value="823"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST016668" version="20010101" id="42538" confidence="" type="mRNA" locus_tag="" length="610" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001272:Phosphoenolpyruvate carboxykinase, ATP-utilising; IPR008210:Phosphoenolpyruvate carboxykinase, N-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST016668">
      <pattern type="pool" definition="pool1">
        <property id="count" value="8"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST016668">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.82842712474619"/>
        <property id="baseMeanA" value="5.65685424949238"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="8"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.472592970272236"/>
        <property id="rank" value="56"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST046162" version="20010101" id="53894" confidence="" type="mRNA" locus_tag="" length="452" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR011611:Carbohydrate/purine kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST046162">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST046162">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="439"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST007722" version="20010101" id="51539" confidence="" type="mRNA" locus_tag="" length="406" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR018865:Serine-threonine protein kinase 19;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST007722">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST007722">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.82842712474619"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="3"/>
        <property id="log2FoldChange" value="1.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.76688905582438"/>
        <property id="rank" value="246"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001969" version="20010101" id="35799" confidence="" type="mRNA" locus_tag="" length="849" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015877:Cdk-activating kinase assembly factor, MAT1;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001969">
      <pattern type="pool" definition="pool1">
        <property id="count" value="8"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001969">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.36396103067893"/>
        <property id="baseMeanA" value="5.65685424949238"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="1.25"/>
        <property id="log2FoldChange" value="0.321928094887362"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="8"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.966017108769866"/>
        <property id="rank" value="521"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST007446" version="20010101" id="18133" confidence="" type="mRNA" locus_tag="" length="674" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002872:Proline dehydrogenase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST007446">
      <pattern type="pool" definition="pool1">
        <property id="count" value="26"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST007446">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="9.19238815542512"/>
        <property id="baseMeanA" value="18.3847763108502"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="26"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.0572077425165249"/>
        <property id="rank" value="3"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006981" version="20010101" id="4419" confidence="" type="mRNA" locus_tag="" length="684" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006981">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006981">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="443"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST014376" version="20010101" id="6369" confidence="" type="mRNA" locus_tag="" length="449" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST014376">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST014376">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="751"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015076" version="20010101" id="2845" confidence="" type="mRNA" locus_tag="" length="639" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015076">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015076">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="435"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST030732" version="20010101" id="41618" confidence="" type="mRNA" locus_tag="" length="518" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST030732">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST030732">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="748"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST021974" version="20010101" id="23263" confidence="" type="mRNA" locus_tag="" length="420" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST021974">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST021974">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.82842712474619"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.333333333333333"/>
        <property id="log2FoldChange" value="-1.58496250072116"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.824452293960056"/>
        <property id="rank" value="293"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST060380" version="20010101" id="17591" confidence="" type="mRNA" locus_tag="" length="454" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST060380">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST060380">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="824"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001621" version="20010101" id="15139" confidence="" type="mRNA" locus_tag="" length="1838" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001621">
      <pattern type="pool" definition="pool1">
        <property id="count" value="42"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="12"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001621">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="23.3345237791561"/>
        <property id="baseMeanA" value="29.698484809835"/>
        <property id="baseMeanB" value="16.9705627484771"/>
        <property id="foldChange" value="0.571428571428571"/>
        <property id="log2FoldChange" value="-0.807354922057604"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="42"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.588498939926583"/>
        <property id="rank" value="93"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST021140" version="20010101" id="53289" confidence="" type="mRNA" locus_tag="" length="490" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST021140">
      <pattern type="pool" definition="pool1">
        <property id="count" value="11"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST021140">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="7.77817459305202"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="0.545454545454545"/>
        <property id="log2FoldChange" value="-0.874469117916141"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="11"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.814598398550168"/>
        <property id="rank" value="289"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST013623" version="20010101" id="51852" confidence="" type="mRNA" locus_tag="" length="750" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR011992:EF-Hand type; IPR017442:Serine/threonine protein kinase-related; IPR018247:EF-HAND 1, calcium-binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST013623">
      <pattern type="pool" definition="pool1">
        <property id="count" value="7"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST013623">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="4.94974746830583"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="1.42857142857143"/>
        <property id="log2FoldChange" value="0.514573172829758"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="7"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.902568282752711"/>
        <property id="rank" value="407"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015650" version="20010101" id="46258" confidence="" type="mRNA" locus_tag="" length="464" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015650">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015650">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="758"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST016667" version="20010101" id="36414" confidence="" type="mRNA" locus_tag="" length="611" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR004041:NAF; IPR017442:Serine/threonine protein kinase-related; IPR018451:NAF/FISL domain;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST016667">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST016667">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.4142135623731"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.785144262346599"/>
        <property id="rank" value="258"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST004870" version="20010101" id="47305" confidence="" type="mRNA" locus_tag="" length="986" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST004870">
      <pattern type="pool" definition="pool1">
        <property id="count" value="28"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="10"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST004870">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="16.9705627484771"/>
        <property id="baseMeanA" value="19.7989898732233"/>
        <property id="baseMeanB" value="14.1421356237309"/>
        <property id="foldChange" value="0.714285714285714"/>
        <property id="log2FoldChange" value="-0.485426827170242"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="28"/>
        <property id="pool2_count" value="10"/>
        <property id="pval" value="0.802233566938032"/>
        <property id="rank" value="276"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST010662" version="20010101" id="6780" confidence="" type="mRNA" locus_tag="" length="690" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000961:AGC-kinase, C-terminal; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST010662">
      <pattern type="pool" definition="pool1">
        <property id="count" value="7"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST010662">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.01040764008565"/>
        <property id="baseMeanA" value="4.94974746830583"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="1.42857142857143"/>
        <property id="log2FoldChange" value="0.514573172829758"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="7"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.902568282752711"/>
        <property id="rank" value="410"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST018164" version="20010101" id="30197" confidence="" type="mRNA" locus_tag="" length="964" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR008144:Guanylate kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST018164">
      <pattern type="pool" definition="pool1">
        <property id="count" value="57"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="23"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST018164">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="36.4159992311072"/>
        <property id="baseMeanA" value="40.3050865276332"/>
        <property id="baseMeanB" value="32.5269119345812"/>
        <property id="foldChange" value="0.807017543859649"/>
        <property id="log2FoldChange" value="-0.309328058107729"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="57"/>
        <property id="pool2_count" value="23"/>
        <property id="pval" value="0.830018897222719"/>
        <property id="rank" value="313"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST007340" version="20010101" id="33018" confidence="" type="mRNA" locus_tag="" length="829" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST007340">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST007340">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="457"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST029518" version="20010101" id="7593" confidence="" type="mRNA" locus_tag="" length="309" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000550:7,8-Dihydro-6-hydroxymethylpterin-pyrophosphokinase, HPPK;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST029518">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST029518">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.76776695296637"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.666666666666667"/>
        <property id="log2FoldChange" value="-0.584962500721157"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="817"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST008986" version="20010101" id="54665" confidence="" type="mRNA" locus_tag="" length="1005" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST008986">
      <pattern type="pool" definition="pool1">
        <property id="count" value="18"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="12"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST008986">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="14.8492424049175"/>
        <property id="baseMeanA" value="12.7279220613579"/>
        <property id="baseMeanB" value="16.9705627484771"/>
        <property id="foldChange" value="1.33333333333333"/>
        <property id="log2FoldChange" value="0.415037499278843"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="18"/>
        <property id="pool2_count" value="12"/>
        <property id="pval" value="0.830563785700504"/>
        <property id="rank" value="314"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST046102" version="20010101" id="41417" confidence="" type="mRNA" locus_tag="" length="450" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001312:Hexokinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST046102">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST046102">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1.33333333333333"/>
        <property id="log2FoldChange" value="0.415037499278843"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="622"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST005049" version="20010101" id="13424" confidence="" type="mRNA" locus_tag="" length="468" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST005049">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST005049">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.4142135623731"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.785144262346599"/>
        <property id="rank" value="263"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST011800" version="20010101" id="45608" confidence="" type="mRNA" locus_tag="" length="518" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST011800">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST011800">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="803"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST006553" version="20010101" id="35722" confidence="" type="mRNA" locus_tag="" length="759" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST006553">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST006553">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.18198051533946"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="0.8"/>
        <property id="log2FoldChange" value="-0.321928094887363"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="704"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST021029" version="20010101" id="33682" confidence="" type="mRNA" locus_tag="" length="502" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST021029">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST021029">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.76776695296637"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="4"/>
        <property id="log2FoldChange" value="2"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.828625691559748"/>
        <property id="rank" value="303"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015285" version="20010101" id="13434" confidence="" type="mRNA" locus_tag="" length="540" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015285">
      <pattern type="pool" definition="pool1">
        <property id="count" value="20"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="7"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015285">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.0208152801713"/>
        <property id="baseMeanA" value="14.142135623731"/>
        <property id="baseMeanB" value="9.89949493661167"/>
        <property id="foldChange" value="0.7"/>
        <property id="log2FoldChange" value="-0.514573172829758"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="20"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.834024350836267"/>
        <property id="rank" value="318"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST009956" version="20010101" id="41331" confidence="" type="mRNA" locus_tag="" length="620" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR011611:Carbohydrate/purine kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST009956">
      <pattern type="pool" definition="pool1">
        <property id="count" value="30"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="9"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST009956">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="16.9705627484771"/>
        <property id="baseMeanA" value="21.2132034355964"/>
        <property id="baseMeanB" value="12.7279220613579"/>
        <property id="foldChange" value="0.6"/>
        <property id="log2FoldChange" value="-0.736965594166206"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="30"/>
        <property id="pool2_count" value="9"/>
        <property id="pval" value="0.675274203271952"/>
        <property id="rank" value="167"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST045894" version="20010101" id="27900" confidence="" type="mRNA" locus_tag="" length="460" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002573:Choline/ethanolamine kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST045894">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST045894">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.885600871951716"/>
        <property id="rank" value="359"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST071223" version="20010101" id="9817" confidence="" type="mRNA" locus_tag="" length="342" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000961:AGC-kinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST071223">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST071223">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="598"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST000876" version="20010101" id="17860" confidence="" type="mRNA" locus_tag="" length="1900" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST000876">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST000876">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="0.947017326726345"/>
        <property id="rank" value="487"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001519" version="20010101" id="25419" confidence="" type="mRNA" locus_tag="" length="689" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001576:Phosphoglycerate kinase; IPR015901:Phosphoglycerate kinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001519">
      <pattern type="pool" definition="pool1">
        <property id="count" value="68"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="28"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001519">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="43.8406204335659"/>
        <property id="baseMeanA" value="48.0832611206852"/>
        <property id="baseMeanB" value="39.5979797464467"/>
        <property id="foldChange" value="0.823529411764706"/>
        <property id="log2FoldChange" value="-0.280107919192735"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="68"/>
        <property id="pool2_count" value="28"/>
        <property id="pval" value="0.837110662269193"/>
        <property id="rank" value="322"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST001195" version="20010101" id="51526" confidence="" type="mRNA" locus_tag="" length="1183" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST001195">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST001195">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.53553390593274"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="1.5"/>
        <property id="log2FoldChange" value="0.584962500721156"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.956602039388895"/>
        <property id="rank" value="511"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST063535" version="20010101" id="35651" confidence="" type="mRNA" locus_tag="" length="418" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR015793:Pyruvate kinase, barrel; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core; IPR018209:Pyruvate kinase, active site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST063535">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST063535">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="599"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST043693" version="20010101" id="43264" confidence="" type="mRNA" locus_tag="" length="595" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST043693">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST043693">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="634"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST016379" version="20010101" id="41070" confidence="" type="mRNA" locus_tag="" length="842" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST016379">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST016379">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.885600871951716"/>
        <property id="rank" value="382"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST021291" version="20010101" id="55653" confidence="" type="mRNA" locus_tag="" length="476" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR003594:ATP-binding region, ATPase-like; IPR004358:Signal transduction histidine kinase-related protein, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST021291">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST021291">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.4"/>
        <property id="log2FoldChange" value="-1.32192809488736"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.901843330273052"/>
        <property id="rank" value="400"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST003722" version="20010101" id="32056" confidence="" type="mRNA" locus_tag="" length="1245" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000023:Phosphofructokinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST003722">
      <pattern type="pool" definition="pool1">
        <property id="count" value="73"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="41"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST003722">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="54.8007755419574"/>
        <property id="baseMeanA" value="51.618795026618"/>
        <property id="baseMeanB" value="57.9827560572969"/>
        <property id="foldChange" value="1.12328767123288"/>
        <property id="log2FoldChange" value="0.167727445738066"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="73"/>
        <property id="pool2_count" value="41"/>
        <property id="pval" value="0.888394239177055"/>
        <property id="rank" value="389"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST035408" version="20010101" id="40373" confidence="" type="mRNA" locus_tag="" length="754" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST035408">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="5"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST035408">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="5.30330085889911"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="7.07106781186547"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="5"/>
        <property id="pval" value="0.76204978785266"/>
        <property id="rank" value="231"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST000469" version="20010101" id="29664" confidence="" type="mRNA" locus_tag="" length="1179" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR011990:Tetratricopeptide-like helical;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST000469">
      <pattern type="pool" definition="pool1">
        <property id="count" value="21"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="8"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST000469">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="13.0814754519511"/>
        <property id="baseMeanA" value="14.8492424049175"/>
        <property id="baseMeanB" value="11.3137084989848"/>
        <property id="foldChange" value="0.761904761904762"/>
        <property id="log2FoldChange" value="-0.392317422778761"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="21"/>
        <property id="pool2_count" value="8"/>
        <property id="pval" value="0.880955589256947"/>
        <property id="rank" value="353"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST022051" version="20010101" id="3095" confidence="" type="mRNA" locus_tag="" length="414" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST022051">
      <pattern type="pool" definition="pool1">
        <property id="count" value="14"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST022051">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.94974746830583"/>
        <property id="baseMeanA" value="9.89949493661167"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="14"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.223514013585431"/>
        <property id="rank" value="16"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST058351" version="20010101" id="42645" confidence="" type="mRNA" locus_tag="" length="490" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR008207:Signal transduction histidine kinase, phosphotransfer (Hpt) region;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST058351">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="6"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST058351">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.24264068711928"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="8.48528137423857"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="6"/>
        <property id="pval" value="0.168850258876594"/>
        <property id="rank" value="8"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST018236" version="20010101" id="27288" confidence="" type="mRNA" locus_tag="" length="787" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST018236">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST018236">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="638"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST031675" version="20010101" id="2131" confidence="" type="mRNA" locus_tag="" length="461" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001449:Phosphoenolpyruvate carboxylase; IPR015813:Pyruvate/Phosphoenolpyruvate kinase, catalytic core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST031675">
      <pattern type="pool" definition="pool1">
        <property id="count" value="12"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST031675">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="6.36396103067893"/>
        <property id="baseMeanA" value="8.48528137423857"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="0.5"/>
        <property id="log2FoldChange" value="-1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="12"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="0.762843296874059"/>
        <property id="rank" value="239"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST007330" version="20010101" id="54972" confidence="" type="mRNA" locus_tag="" length="847" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR013750:GHMP kinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST007330">
      <pattern type="pool" definition="pool1">
        <property id="count" value="18"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="8"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST007330">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="12.0208152801713"/>
        <property id="baseMeanA" value="12.7279220613579"/>
        <property id="baseMeanB" value="11.3137084989848"/>
        <property id="foldChange" value="0.888888888888889"/>
        <property id="log2FoldChange" value="-0.169925001442313"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="18"/>
        <property id="pool2_count" value="8"/>
        <property id="pval" value="0.996492917987071"/>
        <property id="rank" value="611"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST017021" version="20010101" id="47485" confidence="" type="mRNA" locus_tag="" length="497" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST017021">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST017021">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.76776695296637"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.666666666666667"/>
        <property id="log2FoldChange" value="-0.584962500721157"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="723"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST037105" version="20010101" id="25781" confidence="" type="mRNA" locus_tag="" length="470" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002498:Phosphatidylinositol-4-phosphate 5-kinase, core; IPR016034:Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST037105">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST037105">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="821"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST026752" version="20010101" id="23584" confidence="" type="mRNA" locus_tag="" length="510" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR013750:GHMP kinase, C-terminal;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST026752">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST026752">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="833"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST000617" version="20010101" id="14949" confidence="" type="mRNA" locus_tag="" length="1565" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001245:Tyrosine protein kinase; IPR011009:Protein kinase-like; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST000617">
      <pattern type="pool" definition="pool1">
        <property id="count" value="70"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="27"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST000617">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="43.8406204335659"/>
        <property id="baseMeanA" value="49.4974746830583"/>
        <property id="baseMeanB" value="38.1837661840736"/>
        <property id="foldChange" value="0.771428571428571"/>
        <property id="log2FoldChange" value="-0.374395514781498"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="70"/>
        <property id="pool2_count" value="27"/>
        <property id="pval" value="0.771894620667139"/>
        <property id="rank" value="252"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST030218" version="20010101" id="26501" confidence="" type="mRNA" locus_tag="" length="658" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST030218">
      <pattern type="pool" definition="pool1">
        <property id="count" value="15"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="11"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST030218">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="13.0814754519511"/>
        <property id="baseMeanA" value="10.6066017177982"/>
        <property id="baseMeanB" value="15.556349186104"/>
        <property id="foldChange" value="1.46666666666667"/>
        <property id="log2FoldChange" value="0.552541023028779"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="15"/>
        <property id="pool2_count" value="11"/>
        <property id="pval" value="0.777712040682173"/>
        <property id="rank" value="254"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST008045" version="20010101" id="4930" confidence="" type="mRNA" locus_tag="" length="566" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST008045">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST008045">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="440"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST039052" version="20010101" id="37102" confidence="" type="mRNA" locus_tag="" length="412" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR001206:Diacylglycerol kinase, catalytic region;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST039052">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST039052">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="683"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST004271" version="20010101" id="11064" confidence="" type="mRNA" locus_tag="" length="531" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST004271">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST004271">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1.33333333333333"/>
        <property id="log2FoldChange" value="0.415037499278843"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="670"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST039433" version="20010101" id="22625" confidence="" type="mRNA" locus_tag="" length="400" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000403:Phosphatidylinositol 3-/4-kinase, catalytic;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST039433">
      <pattern type="pool" definition="pool1">
        <property id="count" value="0"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST039433">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186547"/>
        <property id="baseMeanA" value="0"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="Inf"/>
        <property id="log2FoldChange" value="Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="0"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.92052505818782"/>
        <property id="rank" value="430"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST059274" version="20010101" id="17314" confidence="" type="mRNA" locus_tag="" length="475" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000764:Uridine kinase;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST059274">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST059274">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="1.06066017177982"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="2"/>
        <property id="log2FoldChange" value="1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="1"/>
        <property id="rank" value="811"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST072454" version="20010101" id="3690" confidence="" type="mRNA" locus_tag="" length="327" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST072454">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST072454">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.5"/>
        <property id="log2FoldChange" value="-1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.985537978420011"/>
        <property id="rank" value="541"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST008027" version="20010101" id="31300" confidence="" type="mRNA" locus_tag="" length="584" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST008027">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST008027">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="776"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST015398" version="20010101" id="29273" confidence="" type="mRNA" locus_tag="" length="504" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST015398">
      <pattern type="pool" definition="pool1">
        <property id="count" value="4"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="1"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST015398">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.12132034355964"/>
        <property id="baseMeanA" value="2.82842712474619"/>
        <property id="baseMeanB" value="1.41421356237309"/>
        <property id="foldChange" value="0.5"/>
        <property id="log2FoldChange" value="-1"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="4"/>
        <property id="pool2_count" value="1"/>
        <property id="pval" value="0.985537978420011"/>
        <property id="rank" value="542"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST013948" version="20010101" id="3771" confidence="" type="mRNA" locus_tag="" length="532" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR017441:Protein kinase, ATP binding site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST013948">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="3"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST013948">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="4.24264068711929"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="4.24264068711928"/>
        <property id="foldChange" value="1"/>
        <property id="log2FoldChange" value="-3.20342650381492e-16"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="3"/>
        <property id="pval" value="1"/>
        <property id="rank" value="680"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST007651" version="20010101" id="53958" confidence="" type="mRNA" locus_tag="" length="464" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR002173:Carbohydrate/puine kinase, PfkB, conserved site;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST007651">
      <pattern type="pool" definition="pool1">
        <property id="count" value="3"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST007651">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="2.47487373415292"/>
        <property id="baseMeanA" value="2.12132034355964"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="1.33333333333333"/>
        <property id="log2FoldChange" value="0.415037499278843"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="3"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="852"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST016675" version="20010101" id="37662" confidence="" type="mRNA" locus_tag="" length="604" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST016675">
      <pattern type="pool" definition="pool1">
        <property id="count" value="5"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="2"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST016675">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="3.18198051533946"/>
        <property id="baseMeanA" value="3.53553390593274"/>
        <property id="baseMeanB" value="2.82842712474619"/>
        <property id="foldChange" value="0.8"/>
        <property id="log2FoldChange" value="-0.321928094887363"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="5"/>
        <property id="pool2_count" value="2"/>
        <property id="pval" value="1"/>
        <property id="rank" value="686"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST005804" version="20010101" id="5303" confidence="" type="mRNA" locus_tag="" length="793" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST005804">
      <pattern type="pool" definition="pool1">
        <property id="count" value="6"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="7"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST005804">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="7.07106781186548"/>
        <property id="baseMeanA" value="4.24264068711929"/>
        <property id="baseMeanB" value="9.89949493661167"/>
        <property id="foldChange" value="2.33333333333333"/>
        <property id="log2FoldChange" value="1.22239242133645"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="6"/>
        <property id="pool2_count" value="7"/>
        <property id="pval" value="0.626047219380868"/>
        <property id="rank" value="116"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST019880" version="20010101" id="7750" confidence="" type="mRNA" locus_tag="" length="397" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR017441:Protein kinase, ATP binding site; IPR017442:Serine/threonine protein kinase-related;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST019880">
      <pattern type="pool" definition="pool1">
        <property id="count" value="1"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST019880">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.353553390593274"/>
        <property id="baseMeanA" value="0.707106781186548"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="1"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="1"/>
        <property id="rank" value="616"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST026310" version="20010101" id="19462" confidence="" type="mRNA" locus_tag="" length="622" xmlfile="">
    <definition confidence="" id="product" ontology="">IPR000719:Protein kinase, core; IPR001245:Tyrosine protein kinase; IPR015726:Serine/threonine protein kinase, striated muscle;</definition>
    <sequence/>
    <organism>
      <species code="" cultivar="" ecotype="" isolate="" strain="" subspecies="" substrain="" variety=""/>
      <taxonomy id="" ontology=""/>
      <organelle/>
    </organism>
    <entry_features accession="TEST026310">
      <pattern type="pool" definition="pool1">
        <property id="count" value="2"/>
      </pattern>
      <pattern type="pool" definition="pool2">
        <property id="count" value="0"/>
      </pattern>
    </entry_features>
    <entry_features accession="TEST026310">
      <pattern definition="DESeq" type="test">
        <property id="baseMean" value="0.707106781186548"/>
        <property id="baseMeanA" value="1.4142135623731"/>
        <property id="baseMeanB" value="0"/>
        <property id="foldChange" value="0"/>
        <property id="log2FoldChange" value="-Inf"/>
        <property id="padj" value="1"/>
        <property id="pool1_count" value="2"/>
        <property id="pool2_count" value="0"/>
        <property id="pval" value="0.989275365583584"/>
        <property id="rank" value="563"/>
        <property id="resVarA" value=""/>
        <property id="resVarB" value=""/>
      </pattern>
    </entry_features>
  </entry>
  <entry accession="TEST022517" version="20010101" id="40580" confidenc