BIOSGetAssemblyVersions 2017.04.28 02:00:18 Execution time: 2 s.

Functionnal tests failed

Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetAssemblyVersions.rdf
  • Contact: jonathan.kreplak@dijon.inra.fr

assembly_versions

Format

Show or HideShow perl code used to test assembly_versions format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetAssemblyVersions/test/BIOSGetAssemblyVersions.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetAssemblyVersions/test/BIOSGetAssemblyVersions.xml.new Differences are reported as "[string in reference]{string in new result}"

Show or HideTest results

[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}

Content

Show or Hide Show perl code used to test assembly_versions content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetAssemblyVersions/test/BIOSGetAssemblyVersions.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetAssemblyVersions/test/BIOSGetAssemblyVersions.xml.new Differences are reported as "[string in reference]{string in new result}"

Show or HideTest results

[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[abrochot,clesignor,cmartin,ga]{p}
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
[arrere,susete,vbourion,vvernoud]
[ert,jburstin,jkrep]
[ak,kgallardo,ms]
[ol,ntayeh,pgamas,reviewer,s]
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}
{fournier,c}
{fjacquin,}
{htruong,}
{noguero,mprudent,m}

Raw

Show or Hide Show raw output data for assembly_versions

#species	library_id	version	access
TEST	LIBTEST1	20140916	public
TEST	LIBTEST2	20140916	public
pscam	03_PsCamSeeds_Root_B_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	15_PsCamSeeds_Peduncle_C_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	06_PsCamSeeds_Nodule_B_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	19_PsCamSeeds_Seeds_12dap	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	10_PsCamSeeds_Leaf_B_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	14_PsCamSeeds_Stem_BC_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	01_PsCamSeeds_RootSys_A_HN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	20_PsCamSeeds_Seed_5dai	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	12_PsCamSeeds_UpperLeaf_C_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	09_PsCamSeeds_Shoot_A_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	21_PsCamSeeds_Seed514_5dai	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	08_PsCamSeeds_Shoot_A_HN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	22_PsCamSeeds_Seeds514_12dap	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	13_PsCamSeeds_Tendril_BC_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	16_PsCamSeeds_ApicNode_B_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	11_PsCamSeeds_LowerLeaf_C_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	07_PsCamSeeds_Nodule_G_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	18_PsCamSeeds_Pods_C_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	04_PsCamSeeds_Root_F_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	05_PsCamSeeds_Nodule_A_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	02_PsCamSeeds_RootSys_A_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	17_PsCamSeeds_Flower_B_LN	20140924	abrochot,cfournier,clesignor,cmartin,fjacquin,gaubert,htruong,jburstin,jkreplak,kgallardo,mnoguero,mprudent,msiol,ntayeh,pgamas,reviewer,scarrere,susete,vbourion,vvernoud
pscam	11_PsUniLC_LowerLeaf_C_LN	20140924	public
pscam	17_PsUniLC_Flower_B_LN	20140924	public
pscam	20_PsUniLC_Seed_5dai	20140924	public
pscam	04_PsUniLC_Root_F_LN	20140924	public
pscam	05_PsUniLC_Nodule_A_LN	20140924	public
pscam	16_PsUniLC_ApicNode_B_LN	20140924	public
pscam	19_PsUniLC_Seeds_12dap	20140924	public
pscam	01_PsUniLC_RootSys_A_HN	20140924	public
pscam	15_PsUniLC_Peduncle_C_LN	20140924	public
pscam	13_PsUniLC_Tendril_BC_LN	20140924	public
pscam	03_PsUniLC_Root_B_LN	20140924	public
pscam	18_PsUniLC_Pods_C_LN	20140924	public
pscam	09_PsUniLC_Shoot_A_LN	20140924	public
pscam	02_PsUniLC_RootSys_A_LN	20140924	public
pscam	08_PsUniLC_Shoot_A_HN	20140924	public
pscam	14_PsUniLC_Stem_BC_LN	20140924	public
pscam	12_PsUniLC_UpperLeaf_C_LN	20140924	public
pscam	06_PsUniLC_Nodule_B_LN	20140924	public
pscam	10_PsUniLC_Leaf_B_LN	20140924	public
pscam	07_PsUniLC_Nodule_G_LN	20140924	public
pscam	11_PsUniHC_LowerLeaf_C_LN	20140924	public
pscam	20_PsUniHC_Seed_5dai	20140924	public
pscam	04_PsUniHC_Root_F_LN	20140924	public
pscam	13_PsUniHC_Tendril_BC_LN	20140924	public
pscam	06_PsUniHC_Nodule_B_LN	20140924	public
pscam	08_PsUniHC_Shoot_A_HN	20140924	public
pscam	07_PsUniHC_Nodule_G_LN	20140924	public
pscam	01_PsUniHC_RootSys_A_HN	20140924	public
pscam	17_PsUniHC_Flower_B_LN	20140924	public
pscam	09_PsUniHC_Shoot_A_LN	20140924	public
pscam	05_PsUniHC_Nodule_A_LN	20140924	public
pscam	14_PsUniHC_Stem_BC_LN	20140924	public
pscam	19_PsUniHC_Seeds_12dap	20140924	public
pscam	03_PsUniHC_Root_B_LN	20140924	public
pscam	16_PsUniHC_ApicNode_B_LN	20140924	public
pscam	18_PsUniHC_Pods_C_LN	20140924	public
pscam	12_PsUniHC_UpperLeaf_C_LN	20140924	public
pscam	02_PsUniHC_RootSys_A_LN	20140924	public
pscam	10_PsUniHC_Leaf_B_LN	20140924	public
pscam	15_PsUniHC_Peduncle_C_LN	20140924	public
BIOSGetGoTermsFromSpecies 2017.04.28 02:00:41 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetGoTermsFromSpecies.rdf
  • Contact: jonathan.kreplak@dijon.inra.fr

GOTerms

Format

Show or HideShow perl code used to test GOTerms format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetGoTermsFromSpecies/test/BIOSGetGoTermsFromSpecies.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetGoTermsFromSpecies/test/BIOSGetGoTermsFromSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test GOTerms content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetGoTermsFromSpecies/test/BIOSGetGoTermsFromSpecies.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetGoTermsFromSpecies/test/BIOSGetGoTermsFromSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for GOTerms

CLUSTERTEST002	GO:0046872
CLUSTERTEST003	GO:0006810, GO:0005743, GO:0005215
CLUSTERTEST001	
CLUSTERTEST004
BIOSGetLibrariesFromSpecies 2017.04.28 02:00:43 Execution time: 1 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetLibrariesFromSpecies.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr,jonathan.kreplak@dijon.inra.fr

libraries

Format

Show or HideShow perl code used to test libraries format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetLibrariesFromSpecies/test/BIOSGetLibrariesFromSpecies.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetLibrariesFromSpecies/test/BIOSGetLibrariesFromSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test libraries content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetLibrariesFromSpecies/test/BIOSGetLibrariesFromSpecies.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetLibrariesFromSpecies/test/BIOSGetLibrariesFromSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for libraries

<?xml version="1.0"?>
<collection>
  <library authority="" count_nr="1206" count_raw="4348" definition="Test import BIOS DATA number 1" id="LIBTEST1" key="TestBank1" tag="Taw" url="http://www.google.com"/>
  <library authority="" count_nr="3644" count_raw="4263" definition="Test import BIOS DATA number 2" id="LIBTEST2" key="TestBank2" tag="Taw" url="http://www.google.com"/>
</collection>
BIOSGetNodeLoad 2017.04.28 02:00:46 Execution time: 1 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetNodeLoad.rdf
  • Contact: jonathan.kreplak@dijon.inra.fr

node_load

Format

Show or HideShow perl code used to test node_load format

#these are default tests for format consistancy #you can/should write your own test #your test MUST return a boolean and a free text return (0, "Not in correct XML format") if ($_ !~ /<system/); return (1, "<system> tag found");
<system> tag found

Content

Show or Hide Show perl code used to test node_load content

#these are default tests for content analysis #you can/should write your own test #your test MUST return a boolean and a free text return (0, "empty article") if ($_ !~ /cpus\s+number="\d+"/); return (1, " CPUs detected");
 CPUs detected

Raw

Show or Hide Show raw output data for node_load

<?xml version="1.0"?>
<system score="0.129642857142857">
	<cpus number="8" speed="2593">
		<load>
			<one>1.18</one>
			<five>1.06</five>
			<fifteen>1.02</fifteen>
		</load>
	</cpus>
	<memory totalmem="61440216" freemem="53924932" totalswap="0" freeswap="0" />
</system>
BIOSGetSequencesFromClusterIds 2017.04.28 02:01:08 Execution time: 19 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetSequencesFromClusterIds.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr,jonathan.kreplak@dijon.inra.fr

Sequences

Format

Show or HideShow perl code used to test Sequences format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromClusterIds/test/BIOSGetSequencesFromClusterIds.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromClusterIds/test/BIOSGetSequencesFromClusterIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test Sequences content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromClusterIds/test/BIOSGetSequencesFromClusterIds.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromClusterIds/test/BIOSGetSequencesFromClusterIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for Sequences

>LIBTEST2#1222#1 acc=Tax1E4D3Z3Y02HQBIU cluster=1 len=24 def=
TGATATTTACCCTACTGATGACAG
>LIBTEST2#1223#1 acc=Tax1E4D3Z3Y02HYIVT cluster=1 len=18 def=
TTCTACTTCAATCCTCTT
>LIBTEST2#1224#1 acc=Tax1E4D3Z3Y02F5TQT cluster=1 len=18 def=
GGGTAAAGCTCGTTTGAT
>LIBTEST2#1225#1 acc=Tax1E4D3Z3Y02GY4D3 cluster=1 len=13 def=
GGGGTGCGTTTAG
>LIBTEST2#1226#1 acc=Tax1E4D3Z3Y02G5ITC cluster=1 len=15 def=
TCATGTGGGTCCTAT
>LIBTEST2#1227#1 acc=Tax1E4D3Z3Y02IS7X8 cluster=1 len=21 def=
TCATTTCTCCTTCGTTTTTCA
>LIBTEST2#1228#1 acc=Tax1E4D3Z3Y02JVWJN cluster=1 len=24 def=
ACTATATTGGTATCCAAATGATCT
>LIBTEST2#1229#1 acc=Tax1E4D3Z3Y02JGQ54 cluster=1 len=25 def=
GTAGCGTCGTGACTAATTGATGGGT
>LIBTEST2#1230#1 acc=Tax1E4D3Z3Y02GRVA7 cluster=1 len=24 def=
ATACCTGATAATTGATAGTGCTAC
>LIBTEST2#1231#1 acc=Tax1E4D3Z3Y02F73KK cluster=1 len=29 def=
AGGTGCGATCATACCAGCACTATTGATGG
BIOSGetSequencesFromFastaIds 2017.04.28 02:01:29 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetSequencesFromFastaIds.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr,jonathan.kreplak@dijon.inra.fr

Sequences

Format

Show or HideShow perl code used to test Sequences format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromFastaIds/test/BIOSGetSequencesFromFastaIds.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromFastaIds/test/BIOSGetSequencesFromFastaIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test Sequences content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromFastaIds/test/BIOSGetSequencesFromFastaIds.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromFastaIds/test/BIOSGetSequencesFromFastaIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for Sequences

>LIBTEST1#9#1 acc=Taj1E4D3Z3Y02H7RB3 len=20 def=
TAAGTGTAAGTGTCGTCACA
>LIBTEST1#11#1 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#2 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#3 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#4 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#5 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#6 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#7#1 acc=Taj1E4D3Z3Y02HMWDW cluster=3 len=21 def=
ACTCTGGCTGTAACGGTGGAT
BIOSGetSequencesFromLibraryIds 2017.04.28 02:01:51 Execution time: 19 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetSequencesFromLibraryIds.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr,jonathan.kreplak@dijon.inra.fr

Sequences

Format

Show or HideShow perl code used to test Sequences format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromLibraryIds/test/BIOSGetSequencesFromLibraryIds.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromLibraryIds/test/BIOSGetSequencesFromLibraryIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test Sequences content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromLibraryIds/test/BIOSGetSequencesFromLibraryIds.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromLibraryIds/test/BIOSGetSequencesFromLibraryIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for Sequences

>LIBTEST1#1#1 acc=Taj1E4D3Z3Y02GXVWK cluster=3 len=21 def=
TCGACTCTAACTGGATGGTCA
>LIBTEST1#2#1 acc=>Taj1E4D3Z3Y02GVGKD cluster=3 len=17 def=
ACTGTACAGTTGGAGCT
>LIBTEST1#3#1 acc=Taj1E4D3Z3Y02HB7BH cluster=3 len=23 def=
ATTGATCGTGCTACTATCTGTGC
>LIBTEST1#4#1 acc=Taj1E4D3Z3Y02GNKAS cluster=3 len=24 def=
TAAAAGCGGCTACGATTGGCTCCT
>LIBTEST1#5#1 acc=Taj1E4D3Z3Y02HV1GN cluster=3 len=14 def=
AAGGGCCATGGGAC
>LIBTEST1#5#2 acc=Taj1E4D3Z3Y02HV1GN cluster=3 len=14 def=
AAGGGCCATGGGAC
>LIBTEST1#6#1 acc=Taj1E4D3Z3Y02GLZ9O cluster=3 len=14 def=
CTGATATATTCGAG
>LIBTEST1#7#1 acc=Taj1E4D3Z3Y02HMWDW cluster=3 len=21 def=
ACTCTGGCTGTAACGGTGGAT
>LIBTEST1#8#1 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#2 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#3 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#4 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#5 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#6 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#7 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#8 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#9 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#10 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#11 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#12 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#13 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#14 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#15 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#16 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#17 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#18 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#19 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#20 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#21 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#22 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#23 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#24 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#25 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#26 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#27 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#28 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#29 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#30 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#31 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#8#32 acc=Taj1E4D3Z3Y02GEIUM cluster=3 len=16 def=
TCCTGATATCCTGATA
>LIBTEST1#9#1 acc=Taj1E4D3Z3Y02H7RB3 len=20 def=
TAAGTGTAAGTGTCGTCACA
>LIBTEST1#10#1 acc=Taj1E4D3Z3Y02JLZLH len=28 def=
GTAGCGTCCGTGACTAATGATGGTGGCC
>LIBTEST1#11#1 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#2 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#3 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#4 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#5 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#11#6 acc=Taj1E4D3Z3Y02HDAHD len=17 def=
CTAAATTTTTCATTGTC
>LIBTEST1#12#1 acc=Taj1E4D3Z3Y02GTE8U len=18 def=
AAAGGGTCCAGCGGCTGA
>LIBTEST1#13#1 acc=Taj1E4D3Z3Y02G4K05 len=15 def=
CCACGTGGCCTGATA
>LIBTEST1#14#1 acc=Taj1E4D3Z3Y02F3X4P len=21 def=
CAAACCAGCCGCGGCTTCCAC
>LIBTEST1#15#1 acc=Taj1E4D3Z3Y02IF2C0 len=28 def=
CTATATACTAGGACGCGTACGACTGTGC
>LIBTEST1#16#1 acc=Taj1E4D3Z3Y02GVAFH len=16 def=
CGATAATTTAGTATGG
>LIBTEST1#16#2 acc=Taj1E4D3Z3Y02GVAFH len=16 def=
CGATAATTTAGTATGG
>LIBTEST1#16#3 acc=Taj1E4D3Z3Y02GVAFH len=16 def=
CGATAATTTAGTATGG
>LIBTEST1#17#1 acc=Taj1E4D3Z3Y02JT9Z7 len=15 def=
CGGCGCGGCGGGGGG
>LIBTEST1#18#1 acc=Taj1E4D3Z3Y02IAZOT len=16 def=
CGGCGGGAGTCTGATA
>LIBTEST1#19#1 acc=Taj1E4D3Z3Y02HMG2U len=13 def=
TAGTTTGTCTGGT
>LIBTEST1#20#1 acc=Taj1E4D3Z3Y02GCC2Z len=20 def=
CCTGATATCCCACAGCTGTC
>LIBTEST1#20#2 acc=Taj1E4D3Z3Y02GCC2Z len=20 def=
CCTGATATCCCACAGCTGTC
>LIBTEST1#21#1 acc=Taj1E4D3Z3Y02J5PK2 len=15 def=
ATATAGCGTCTGATA
>LIBTEST1#21#2 acc=Taj1E4D3Z3Y02J5PK2 len=15 def=
ATATAGCGTCTGATA
>LIBTEST1#21#3 acc=Taj1E4D3Z3Y02J5PK2 len=15 def=
ATATAGCGTCTGATA
>LIBTEST1#22#1 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#2 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#3 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#4 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#5 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#6 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#7 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#8 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#9 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#10 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#11 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#12 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#13 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#14 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#15 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#16 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#17 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#18 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#19 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#20 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#21 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#22 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#23 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#24 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#25 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#26 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#27 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#28 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#29 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#30 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#31 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#32 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#33 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#34 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#35 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#36 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#37 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#38 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#39 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#40 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#41 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#42 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#43 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#44 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#45 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#46 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#47 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#48 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#49 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#50 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#51 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#52 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#53 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#54 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#55 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#56 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#57 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#58 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#59 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#60 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#61 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#62 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#63 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#64 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#65 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#66 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#67 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#68 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#69 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#70 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#71 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#72 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#73 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#74 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#75 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#76 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#77 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#78 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#79 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#80 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#81 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#82 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#83 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#84 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#85 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#86 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#87 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#88 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#89 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#90 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#91 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#92 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#93 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#94 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#95 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#96 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#97 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#98 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#22#99 acc=Taj1E4D3Z3Y02GRJ8Q len=14 def=
GATAATTGATGGTG
>LIBTEST1#23#1 acc=Taj1E4D3Z3Y02GWAFV len=21 def=
TTTCAAGGACGATCACTCGCT
>LIBTEST1#24#1 acc=Taj1E4D3Z3Y02JI14I len=30 def=
CGATAAATTGTATGGTGGCCTACCAACTCT
>LIBTEST1#25#1 acc=Taj1E4D3Z3Y02HJHIE len=22 def=
TTACCTATTCCACCAATTCCAT
>LIBTEST1#25#2 acc=Taj1E4D3Z3Y02HJHIE len=22 def=
TTACCTATTCCACCAATTCCAT
>LIBTEST1#25#3 acc=Taj1E4D3Z3Y02HJHIE len=22 def=
TTACCTATTCCACCAATTCCAT
>LIBTEST1#25#4 acc=Taj1E4D3Z3Y02HJHIE len=22 def=
TTACCTATTCCACCAATTCCAT
>LIBTEST1#26#1 acc=Taj1E4D3Z3Y02G7KIZ len=15 def=
AATAACTAAAGATCT
>LIBTEST1#27#1 acc=Taj1E4D3Z3Y02HX3AX len=22 def=
TAACTCATCTGGATTGATTTAG
>LIBTEST1#28#1 acc=Taj1E4D3Z3Y02GFF4K len=18 def=
GTCCTGAGAATAGCCACT
>LIBTEST1#29#1 acc=Taj1E4D3Z3Y02G5B3E len=16 def=
AGTAGCGTCGTGACTA
>LIBTEST1#30#1 acc=Taj1E4D3Z3Y02F3L7C len=17 def=
CTGATACTACCGATTGA
>LIBTEST1#31#1 acc=Taj1E4D3Z3Y02FX6AC len=20 def=
ATCAACTGAGTTAAGCTTAC
>LIBTEST1#31#2 acc=Taj1E4D3Z3Y02FX6AC len=20 def=
ATCAACTGAGTTAAGCTTAC
>LIBTEST1#31#3 acc=Taj1E4D3Z3Y02FX6AC len=20 def=
ATCAACTGAGTTAAGCTTAC
>LIBTEST1#32#1 acc=Taj1E4D3Z3Y02G20PR len=17 def=
GTGATTCAACAGTCCGC
>LIBTEST1#33#1 acc=Taj1E4D3Z3Y02JY80P len=24 def=
ACACACCTTATTCCCACTGCATCC
>LIBTEST1#34#1 acc=Taj1E4D3Z3Y02HWI1Q len=16 def=
CCTGATAGTCCTGATA
>LIBTEST1#34#2 acc=Taj1E4D3Z3Y02HWI1Q len=16 def=
CCTGATAGTCCTGATA
>LIBTEST1#34#3 acc=Taj1E4D3Z3Y02HWI1Q len=16 def=
CCTGATAGTCCTGATA
>LIBTEST1#34#4 acc=Taj1E4D3Z3Y02HWI1Q len=16 def=
CCTGATAGTCCTGATA
>LIBTEST1#35#1 acc=Taj1E4D3Z3Y02HM34D len=23 def=
GGAAATAAAACAAACAGAATCGT
>LIBTEST1#36#1 acc=Taj1E4D3Z3Y02JD0LJ len=25 def=
GGTCGTTAACCTCTCACATGTCATA
>LIBTEST1#37#1 acc=Taj1E4D3Z3Y02IE207 len=24 def=
CCAAGGTATACGTCTGTGCTTATT
>LIBTEST1#37#2 acc=Taj1E4D3Z3Y02IE207 len=24 def=
CCAAGGTATACGTCTGTGCTTATT
>LIBTEST1#37#3 acc=Taj1E4D3Z3Y02IE207 len=24 def=
CCAAGGTATACGTCTGTGCTTATT
>LIBTEST1#38#1 acc=Taj1E4D3Z3Y02J19JB len=22 def=
AAGGCCGACTTCCCTGTCTACT
>LIBTEST1#39#1 acc=Taj1E4D3Z3Y02HS0NG len=25 def=
AATCGCGATTGTGGCAGTGTGTCCA
>LIBTEST1#40#1 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#2 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#3 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#4 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#5 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#6 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#7 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#8 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#9 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#10 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#11 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#12 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#13 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#40#14 acc=Taj1E4D3Z3Y02IWGIB len=21 def=
TAACTCATCTGGATTGATTTA
>LIBTEST1#41#1 acc=Taj1E4D3Z3Y02GT4IQ len=24 def=
ACTAATGATGGGCTCCGGCAAGCC
>LIBTEST1#41#2 acc=Taj1E4D3Z3Y02GT4IQ len=24 def=
ACTAATGATGGGCTCCGGCAAGCC
>LIBTEST1#42#1 acc=Taj1E4D3Z3Y02FVTAA len=26 def=
CCTGCGTCGGTGTCGGACACACACGT
>LIBTEST1#43#1 acc=Taj1E4D3Z3Y02I9TXZ len=22 def=
AGAATCTTGATGATGCTGCATT
>LIBTEST1#43#2 acc=Taj1E4D3Z3Y02I9TXZ len=22 def=
AGAATCTTGATGATGCTGCATT
>LIBTEST1#43#3 acc=Taj1E4D3Z3Y02I9TXZ len=22 def=
AGAATCTTGATGATGCTGCATT
>LIBTEST1#44#1 acc=Taj1E4D3Z3Y02FZUR5 len=21 def=
TGAAGGCCTGGGAGTGGGTTC
>LIBTEST1#45#1 acc=Taj1E4D3Z3Y02ISSW9 len=27 def=
GTAGCCGTCCTGAATTAATTGAGTGGT
>LIBTEST1#46#1 acc=Taj1E4D3Z3Y02G4R37 len=14 def=
CAGTTAAACTGATA
>LIBTEST1#47#1 acc=Taj1E4D3Z3Y02GHKLV len=17 def=
TAGTCACGGTACGCTAC
>LIBTEST1#48#1 acc=Taj1E4D3Z3Y02GNMG2 len=24 def=
GAATACATCATGATAAACCGTACC
>LIBTEST1#49#1 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#2 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#3 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#4 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#5 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#6 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#7 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#8 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#9 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#10 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#11 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#12 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#13 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#14 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#15 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#16 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#17 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#18 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#19 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#20 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#21 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#22 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#23 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#24 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#25 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#26 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#27 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#28 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#29 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#30 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#31 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#32 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#33 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#34 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#35 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#36 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#37 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#38 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#39 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#40 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#41 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#42 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#43 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#44 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#45 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#46 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#47 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#48 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#49 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#50 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#51 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#52 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#53 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#54 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#55 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#56 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#57 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#58 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#59 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#60 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#61 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#62 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#63 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#64 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#65 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#66 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#67 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#68 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#69 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#70 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#71 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#72 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#73 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#74 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#75 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#76 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#77 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#78 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#79 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#80 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#81 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#82 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#83 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#84 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#85 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#86 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#87 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#88 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#89 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#90 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#91 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#92 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#93 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#94 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#95 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#96 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#97 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#98 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#99 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#100 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#49#101 acc=Taj1E4D3Z3Y02HHG5W len=13 def=
GTAGCTCCTGATA
>LIBTEST1#50#1 acc=Taj1E4D3Z3Y02IEEMH len=15 def=
GATAATTGATGGTGG
>LIBTEST1#50#2 acc=Taj1E4D3Z3Y02IEEMH len=15 def=
GATAATTGATGGTGG
>LIBTEST1#50#3 acc=Taj1E4D3Z3Y02IEEMH len=15 def=
GATAATTGATGGTGG
>LIBTEST1#50#4 acc=Taj1E4D3Z3Y02IEEMH len=15 def=
GATAATTGATGGTGG
>LIBTEST1#50#5 acc=Taj1E4D3Z3Y02IEEMH len=15 def=
GATAATTGATGGTGG
>LIBTEST1#50#6 acc=Taj1E4D3Z3Y02IEEMH len=15 def=
GATAATTGATGGTGG
>LIBTEST1#50#7 acc=Taj1E4D3Z3Y02IEEMH len=15 def=
GATAATTGATGGTGG
>LIBTEST1#50#8 acc=Taj1E4D3Z3Y02IEEMH len=15 def=
GATAATTGATGGTGG
>LIBTEST1#51#1 acc=Taj1E4D3Z3Y02JNCN0 len=18 def=
TTTGGATTGAAGGGAGCT
>LIBTEST1#51#2 acc=Taj1E4D3Z3Y02JNCN0 len=18 def=
TTTGGATTGAAGGGAGCT
>LIBTEST1#51#3 acc=Taj1E4D3Z3Y02JNCN0 len=18 def=
TTTGGATTGAAGGGAGCT
>LIBTEST1#51#4 acc=Taj1E4D3Z3Y02JNCN0 len=18 def=
TTTGGATTGAAGGGAGCT
>LIBTEST1#51#5 acc=Taj1E4D3Z3Y02JNCN0 len=18 def=
TTTGGATTGAAGGGAGCT
>LIBTEST1#51#6 acc=Taj1E4D3Z3Y02JNCN0 len=18 def=
TTTGGATTGAAGGGAGCT
>LIBTEST1#51#7 acc=Taj1E4D3Z3Y02JNCN0 len=18 def=
TTTGGATTGAAGGGAGCT
>LIBTEST1#51#8 acc=Taj1E4D3Z3Y02JNCN0 len=18 def=
TTTGGATTGAAGGGAGCT
>LIBTEST1#51#9 acc=Taj1E4D3Z3Y02JNCN0 len=18 def=
TTTGGATTGAAGGGAGCT
>LIBTEST1#52#1 acc=Taj1E4D3Z3Y02FTNKS len=28 def=
CTGAGACACGCAACAGGGGATAGGCAAG
>LIBTEST1#53#1 acc=Taj1E4D3Z3Y02H0CDS len=24 def=
ATTGATCGTGCCTAACTACTCTGG
>LIBTEST1#53#2 acc=Taj1E4D3Z3Y02H0CDS len=24 def=
ATTGATCGTGCCTAACTACTCTGG
>LIBTEST1#53#3 acc=Taj1E4D3Z3Y02H0CDS len=24 def=
ATTGATCGTGCCTAACTACTCTGG
>LIBTEST1#53#4 acc=Taj1E4D3Z3Y02H0CDS len=24 def=
ATTGATCGTGCCTAACTACTCTGG
>LIBTEST1#53#5 acc=Taj1E4D3Z3Y02H0CDS len=24 def=
ATTGATCGTGCCTAACTACTCTGG
>LIBTEST1#53#6 acc=Taj1E4D3Z3Y02H0CDS len=24 def=
ATTGATCGTGCCTAACTACTCTGG
>LIBTEST1#54#1 acc=Taj1E4D3Z3Y02GHT8M len=20 def=
TCTCGATACTCGTGTGTGCT
>LIBTEST1#55#1 acc=Taj1E4D3Z3Y02GHAQG len=16 def=
GTCCTGATACTGATAC
>LIBTEST1#56#1 acc=Taj1E4D3Z3Y02HIGD5 len=25 def=
TGAGCCAGGATGGCTTGCCGGATTG
>LIBTEST1#57#1 acc=Taj1E4D3Z3Y02HEMRU len=18 def=
CCCTGTTGCGTGTCTCAG
>LIBTEST1#57#2 acc=Taj1E4D3Z3Y02HEMRU len=18 def=
CCCTGTTGCGTGTCTCAG
>LIBTEST1#57#3 acc=Taj1E4D3Z3Y02HEMRU len=18 def=
CCCTGTTGCGTGTCTCAG
>LIBTEST1#58#1 acc=Taj1E4D3Z3Y02HSIUL len=23 def=
GCTAGTATACAATTGTTGCGTAA
>LIBTEST1#59#1 acc=Taj1E4D3Z3Y02HOKRZ len=26 def=
CCGGAGACGTTGGCGGGGCCCGGACG
>LIBTEST1#60#1 acc=Taj1E4D3Z3Y02I3RDT len=22 def=
GGAATAAAACAAACAGAATCGT
>LIBTEST1#61#1 acc=Taj1E4D3Z3Y02HFJU1 len=21 def=
TATGGTTCTAGAGTTTCTGTT
>LIBTEST1#62#1 acc=Taj1E4D3Z3Y02JG2WK len=17 def=
CCTGATACCGTCCAAGG
>LIBTEST1#63#1 acc=Taj1E4D3Z3Y02HEANV len=21 def=
TTGTCTTACCCATTCCTCCCA
>LIBTEST1#64#1 acc=Taj1E4D3Z3Y02JYO3S len=14 def=
TAGTCTCTGCTGTT
>LIBTEST1#64#2 acc=Taj1E4D3Z3Y02JYO3S len=14 def=
TAGTCTCTGCTGTT
>LIBTEST1#64#3 acc=Taj1E4D3Z3Y02JYO3S len=14 def=
TAGTCTCTGCTGTT
>LIBTEST1#64#4 acc=Taj1E4D3Z3Y02JYO3S len=14 def=
TAGTCTCTGCTGTT
>LIBTEST1#64#5 acc=Taj1E4D3Z3Y02JYO3S len=14 def=
TAGTCTCTGCTGTT
>LIBTEST1#65#1 acc=Taj1E4D3Z3Y02FS0AP len=17 def=
TTGATCGTGGATTATGT
>LIBTEST1#66#1 acc=Taj1E4D3Z3Y02G07WI len=15 def=
CGTCATCATCTGATA
>LIBTEST1#67#1 acc=Taj1E4D3Z3Y02F89SJ len=24 def=
TAGCGTCCCTGATAATTGATGGTG
>LIBTEST1#68#1 acc=Taj1E4D3Z3Y02GKF96 len=22 def=
AGGCACCGATCAATTATCAGGA
>LIBTEST1#69#1 acc=Taj1E4D3Z3Y02GXYOI len=30 def=
TCAGGTATCAGGACAACAAGCTGTGTCGTC
>LIBTEST1#70#1 acc=Taj1E4D3Z3Y02ISPUK len=25 def=
AACTCTGGTGGAGGCCCGCAGCAAT
>LIBTEST1#71#1 acc=Taj1E4D3Z3Y02I8MDV len=16 def=
ATTCGATGGTAGTCCT
>LIBTEST1#71#2 acc=Taj1E4D3Z3Y02I8MDV len=16 def=
ATTCGATGGTAGTCCT
>LIBTEST1#72#1 acc=Taj1E4D3Z3Y02F8R84 len=15 def=
ATAGTAGCGATAGAT
>LIBTEST1#73#1 acc=Taj1E4D3Z3Y02H31U2 len=14 def=
GTCTACGATCGTGT
>LIBTEST1#74#1 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#2 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#3 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#4 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#5 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#6 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#7 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#8 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#9 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#10 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#11 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#12 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#13 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#14 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#15 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#16 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#17 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#18 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#19 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#20 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#21 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#22 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#74#23 acc=Taj1E4D3Z3Y02GM9U0 len=13 def=
ATAATTGATGGTG
>LIBTEST1#75#1 acc=Taj1E4D3Z3Y02HD9AG len=15 def=
TAGTAGCGTCCGATA
>LIBTEST1#75#2 acc=Taj1E4D3Z3Y02HD9AG len=15 def=
TAGTAGCGTCCGATA
>LIBTEST1#76#1 acc=Taj1E4D3Z3Y02G33YA len=22 def=
ATTGATCGTGCTACATCTGTGC
>LIBTEST1#77#1 acc=Taj1E4D3Z3Y02F0SYN len=18 def=
TTCTGATAATTGATGGTG
>LIBTEST1#77#2 acc=Taj1E4D3Z3Y02F0SYN len=18 def=
TTCTGATAATTGATGGTG
>LIBTEST1#78#1 acc=Taj1E4D3Z3Y02IXDDG len=15 def=
CGTAGCGTCTGACTA
>LIBTEST1#79#1 acc=Taj1E4D3Z3Y02JNBKB len=15 def=
TGGTGCGTAAGATAG
>LIBTEST1#80#1 acc=Taj1E4D3Z3Y02HP5NA len=25 def=
TAGCGTCCGTGACTAAATTGATGGT
>LIBTEST1#81#1 acc=Taj1E4D3Z3Y02HC1L9 len=25 def=
CCACATACGTTAGCCGTCCGTGATA
>LIBTEST1#82#1 acc=Taj1E4D3Z3Y02GK5Y5 len=17 def=
GTAGACGTCCGTGACTA
>LIBTEST1#83#1 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#2 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#3 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#4 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#5 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#6 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#7 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#8 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#9 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#10 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#11 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#12 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#13 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#14 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#15 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#16 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#17 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#18 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#19 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#20 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#21 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#22 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#83#23 acc=Taj1E4D3Z3Y02FYJJG len=20 def=
TTGGACTGAAGGGAGCTCCC
>LIBTEST1#84#1 acc=Taj1E4D3Z3Y02ISORP len=24 def=
TAAAGTATTATGAGATGCCTTGAG
>LIBTEST1#85#1 acc=Taj1E4D3Z3Y02I97OF len=22 def=
TCAGACGAACAGCACGAACAAA
>LIBTEST1#86#1 acc=Taj1E4D3Z3Y02IMSVM len=24 def=
TTGAACGTTTAAGATGTGGCTGAC
>LIBTEST1#87#1 acc=Taj1E4D3Z3Y02GBA42 len=14 def=
TGTGCGTGTCTCAG
>LIBTEST1#87#2 acc=Taj1E4D3Z3Y02GBA42 len=14 def=
TGTGCGTGTCTCAG
>LIBTEST1#88#1 acc=Taj1E4D3Z3Y02JDOUL len=26 def=
TTGTTGCCCAATGCTGCAGGCATCGT
>LIBTEST1#89#1 acc=Taj1E4D3Z3Y02G65IQ len=28 def=
CCTGATAGATTCAGCCCTTGTCGCTTCG
>LIBTEST1#89#2 acc=Taj1E4D3Z3Y02G65IQ len=28 def=
CCTGATAGATTCAGCCCTTGTCGCTTCG
>LIBTEST1#89#3 acc=Taj1E4D3Z3Y02G65IQ len=28 def=
CCTGATAGATTCAGCCCTTGTCGCTTCG
>LIBTEST1#89#4 acc=Taj1E4D3Z3Y02G65IQ len=28 def=
CCTGATAGATTCAGCCCTTGTCGCTTCG
>LIBTEST1#89#5 acc=Taj1E4D3Z3Y02G65IQ len=28 def=
CCTGATAGATTCAGCCCTTGTCGCTTCG
>LIBTEST1#89#6 acc=Taj1E4D3Z3Y02G65IQ len=28 def=
CCTGATAGATTCAGCCCTTGTCGCTTCG
>LIBTEST1#89#7 acc=Taj1E4D3Z3Y02G65IQ len=28 def=
CCTGATAGATTCAGCCCTTGTCGCTTCG
>LIBTEST1#89#8 acc=Taj1E4D3Z3Y02G65IQ len=28 def=
CCTGATAGATTCAGCCCTTGTCGCTTCG
>LIBTEST1#89#9 acc=Taj1E4D3Z3Y02G65IQ len=28 def=
CCTGATAGATTCAGCCCTTGTCGCTTCG
>LIBTEST1#90#1 acc=Taj1E4D3Z3Y02HQXLM len=17 def=
GAGTGTGTTTGATTTGC
>LIBTEST1#91#1 acc=Taj1E4D3Z3Y02HL29K len=25 def=
GTTAGCGTCCGTGATAATTGATGGT
>LIBTEST1#91#2 acc=Taj1E4D3Z3Y02HL29K len=25 def=
GTTAGCGTCCGTGATAATTGATGGT
>LIBTEST1#92#1 acc=Taj1E4D3Z3Y02IUV12 len=21 def=
CTGAGACACGCAACAGGGGAG
>LIBTEST1#93#1 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#2 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#3 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#4 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#5 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#6 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#7 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#8 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#9 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#10 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#11 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#12 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#13 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#93#14 acc=Taj1E4D3Z3Y02JY1TD len=13 def=
GATAATTGATGGT
>LIBTEST1#94#1 acc=Taj1E4D3Z3Y02H3U54 len=15 def=
GAACGGGTCGTGCCT
>LIBTEST1#95#1 acc=Taj1E4D3Z3Y02JCUY4 len=21 def=
TCGATAAACCTCTGCATCCAG
>LIBTEST1#95#2 acc=Taj1E4D3Z3Y02JCUY4 len=21 def=
TCGATAAACCTCTGCATCCAG
>LIBTEST1#95#3 acc=Taj1E4D3Z3Y02JCUY4 len=21 def=
TCGATAAACCTCTGCATCCAG
>LIBTEST1#95#4 acc=Taj1E4D3Z3Y02JCUY4 len=21 def=
TCGATAAACCTCTGCATCCAG
>LIBTEST1#95#5 acc=Taj1E4D3Z3Y02JCUY4 len=21 def=
TCGATAAACCTCTGCATCCAG
>LIBTEST1#96#1 acc=Taj1E4D3Z3Y02G4QOB len=16 def=
CATAGCGTCCTCGATA
>LIBTEST1#96#2 acc=Taj1E4D3Z3Y02G4QOB len=16 def=
CATAGCGTCCTCGATA
>LIBTEST1#97#1 acc=Taj1E4D3Z3Y02GOF92 len=18 def=
CTGATAGTAGCGTTGATA
>LIBTEST1#98#1 acc=Taj1E4D3Z3Y02GFKLU len=14 def=
TGAAGCTGCCAGCA
>LIBTEST1#98#2 acc=Taj1E4D3Z3Y02GFKLU len=14 def=
TGAAGCTGCCAGCA
>LIBTEST1#98#3 acc=Taj1E4D3Z3Y02GFKLU len=14 def=
TGAAGCTGCCAGCA
>LIBTEST1#98#4 acc=Taj1E4D3Z3Y02GFKLU len=14 def=
TGAAGCTGCCAGCA
>LIBTEST1#98#5 acc=Taj1E4D3Z3Y02GFKLU len=14 def=
TGAAGCTGCCAGCA
>LIBTEST1#99#1 acc=Taj1E4D3Z3Y02IJ2R0 len=30 def=
TGAGACACGCAACAGAGGATAGGCAAGGCA
>LIBTEST1#100#1 acc=Taj1E4D3Z3Y02GZJZ8 len=28 def=
CCTGATAGCTCTCGTAGCTCAGTTGGTT
>LIBTEST1#101#1 acc=Taj1E4D3Z3Y02GLKX1 len=13 def=
CGGTAGCGGTCCT
>LIBTEST1#102#1 acc=Taj1E4D3Z3Y02F49A8 len=19 def=
AGTAGCTCGAGGAAAAGAC
>LIBTEST1#102#2 acc=Taj1E4D3Z3Y02F49A8 len=19 def=
AGTAGCTCGAGGAAAAGAC
>LIBTEST1#103#1 acc=Taj1E4D3Z3Y02GLSPZ len=17 def=
ACGTTAGCGTCCGTGAT
>LIBTEST1#103#2 acc=Taj1E4D3Z3Y02GLSPZ len=17 def=
ACGTTAGCGTCCGTGAT
>LIBTEST1#104#1 acc=Taj1E4D3Z3Y02GU1U8 len=16 def=
TGTTTGGATTGATGTC
>LIBTEST1#105#1 acc=Taj1E4D3Z3Y02GPPPC len=23 def=
ATCCCCTCGTTGCGTGTCTCCAG
>LIBTEST1#106#1 acc=Taj1E4D3Z3Y02JR10W len=20 def=
ATTAGTATGGTGGCCTACCA
>LIBTEST1#107#1 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#2 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#3 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#4 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#5 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#6 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#7 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#8 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#9 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#10 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#11 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#12 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#13 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#14 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#15 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#16 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#17 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#18 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#19 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#107#20 acc=Taj1E4D3Z3Y02HAQ5E len=21 def=
TCGTCATGAAAGTCAAGGGCC
>LIBTEST1#108#1 acc=Taj1E4D3Z3Y02IRZZT len=19 def=
AGAATCTTGATGATGCTGC
>LIBTEST1#108#2 acc=Taj1E4D3Z3Y02IRZZT len=19 def=
AGAATCTTGATGATGCTGC
>LIBTEST1#108#3 acc=Taj1E4D3Z3Y02IRZZT len=19 def=
AGAATCTTGATGATGCTGC
>LIBTEST1#108#4 acc=Taj1E4D3Z3Y02IRZZT len=19 def=
AGAATCTTGATGATGCTGC
>LIBTEST1#109#1 acc=Taj1E4D3Z3Y02JDHTH len=14 def=
TTGATGGTCCTACA
>LIBTEST1#110#1 acc=Taj1E4D3Z3Y02GSN15 len=19 def=
TGTTAAAACGTGTCTTCTT
>LIBTEST1#110#2 acc=Taj1E4D3Z3Y02GSN15 len=19 def=
TGTTAAAACGTGTCTTCTT
>LIBTEST1#111#1 acc=Taj1E4D3Z3Y02G0PSO len=26 def=
ATTAGGCATTTCAATTCCATACTACT
>LIBTEST1#112#1 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#2 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#3 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#4 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#5 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#6 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#7 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#8 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#9 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#10 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#11 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#12 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#13 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#14 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#15 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#16 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#17 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#112#18 acc=Taj1E4D3Z3Y02GF2SB len=14 def=
CTGATAGTAGCGTC
>LIBTEST1#113#1 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#2 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#3 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#4 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#5 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#6 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#7 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#8 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#9 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#10 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#11 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#12 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#13 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#14 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#15 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#16 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#17 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#18 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#19 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#113#20 acc=Taj1E4D3Z3Y02IFY8G len=21 def=
AGAATCTTGATGATGCTGCAT
>LIBTEST1#114#1 acc=Taj1E4D3Z3Y02JAGGK len=23 def=
ATCCAGGACGTCTACGAGTGTCG
>LIBTEST1#115#1 acc=Taj1E4D3Z3Y02JF58K len=24 def=
GCTACTCCCCTTTGCGTGTCTCAG
>LIBTEST1#115#2 acc=Taj1E4D3Z3Y02JF58K len=24 def=
GCTACTCCCCTTTGCGTGTCTCAG
>LIBTEST1#116#1 acc=Taj1E4D3Z3Y02JK2GM len=25 def=
TGTCGCTTCGGATTCGGTAGTTAGT
>LIBTEST1#117#1 acc=Taj1E4D3Z3Y02H4THP len=16 def=
CCTGATAATTGATGGT
>LIBTEST1#117#2 acc=Taj1E4D3Z3Y02H4THP len=16 def=
CCTGATAATTGATGGT
>LIBTEST1#117#3 acc=Taj1E4D3Z3Y02H4THP len=16 def=
CCTGATAATTGATGGT
>LIBTEST1#118#1 acc=Taj1E4D3Z3Y02GQ9YM len=14 def=
GATAAGTCCTGATA
>LIBTEST1#119#1 acc=Taj1E4D3Z3Y02GZRC5 len=22 def=
CTCCACCTGTTGCGTGTCTCAG
>LIBTEST1#120#1 acc=Taj1E4D3Z3Y02G0JK8 len=22 def=
TCGTAGCGGTCCTCGATAATTC
>LIBTEST1#121#1 acc=Taj1E4D3Z3Y02IF90Y len=27 def=
CTGATATATCTTTACACAAACTATCAA
>LIBTEST1#122#1 acc=Taj1E4D3Z3Y02JMODN len=25 def=
CTGAGACACGCAACAGGGGGATAGG
>LIBTEST1#122#2 acc=Taj1E4D3Z3Y02JMODN len=25 def=
CTGAGACACGCAACAGGGGGATAGG
>LIBTEST1#122#3 acc=Taj1E4D3Z3Y02JMODN len=25 def=
CTGAGACACGCAACAGGGGGATAGG
>LIBTEST1#123#1 acc=Taj1E4D3Z3Y02JESD0 len=19 def=
TAGCATTCGACGGTTTCCA
>LIBTEST1#124#1 acc=Taj1E4D3Z3Y02JGIJE len=14 def=
GTGTAGTGGCGTCG
>LIBTEST1#125#1 acc=Taj1E4D3Z3Y02I5PNU len=17 def=
ATATTTTTAAATCAGTT
>LIBTEST1#126#1 acc=Taj1E4D3Z3Y02GDOI1 len=26 def=
CCACAGGGGTCCTGATAATTGATGGT
>LIBTEST1#127#1 acc=>Taj1E4D3Z3Y02F5JE9 len=21 def=
GTGACATACTTAATCAAGGCC
>LIBTEST1#127#2 acc=>Taj1E4D3Z3Y02F5JE9 len=21 def=
GTGACATACTTAATCAAGGCC
>LIBTEST1#128#1 acc=Taj1E4D3Z3Y02GDX0O len=15 def=
AGTGCTGAGACAGGA
>LIBTEST1#129#1 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#2 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#3 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#4 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#5 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#6 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#7 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#8 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#9 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#10 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#11 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#12 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#13 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#14 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#15 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#16 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#17 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#18 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#19 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#20 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#21 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#22 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#23 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#24 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#25 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#26 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#27 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#28 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#29 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#30 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#31 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#32 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#33 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#34 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#35 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#36 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#37 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#38 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#39 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#40 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#41 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#42 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#43 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#44 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#45 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#46 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#47 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#48 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#49 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#50 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#51 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#52 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#53 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#54 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#55 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#56 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#57 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#58 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#59 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#60 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#61 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#62 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#63 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#64 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#65 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#66 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#67 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#68 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#69 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#70 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#71 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#72 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#129#73 acc=Taj1E4D3Z3Y02H0PCC len=13 def=
GTAGCGCCTGATA
>LIBTEST1#130#1 acc=Taj1E4D3Z3Y02IB7HW len=18 def=
ACGGGTATATTACAAGTT
>LIBTEST1#131#1 acc=Taj1E4D3Z3Y02HB1K3 len=15 def=
TTAGGCTCTCGGGTG
>LIBTEST1#131#2 acc=Taj1E4D3Z3Y02HB1K3 len=15 def=
TTAGGCTCTCGGGTG
>LIBTEST1#132#1 acc=Taj1E4D3Z3Y02HQPKQ len=21 def=
CTTGGACTGAAGGGAGCTCCC
>LIBTEST1#132#2 acc=Taj1E4D3Z3Y02HQPKQ len=21 def=
CTTGGACTGAAGGGAGCTCCC
>LIBTEST1#132#3 acc=Taj1E4D3Z3Y02HQPKQ len=21 def=
CTTGGACTGAAGGGAGCTCCC
>LIBTEST1#132#4 acc=Taj1E4D3Z3Y02HQPKQ len=21 def=
CTTGGACTGAAGGGAGCTCCC
>LIBTEST1#133#1 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#2 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#3 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#4 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#5 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#6 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#7 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#8 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#9 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#10 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#11 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#133#12 acc=Taj1E4D3Z3Y02GE2MZ len=15 def=
CCTGATATCCTGATA
>LIBTEST1#134#1 acc=Taj1E4D3Z3Y02JQI4B len=28 def=
CTAACTGATGCCACATTGTTTGAGTTGA
>LIBTEST1#135#1 acc=Taj1E4D3Z3Y02GN4WZ len=23 def=
GGTATATAGCTCGTATATATGGT
>LIBTEST1#136#1 acc=Taj1E4D3Z3Y02IXQIV len=18 def=
TTCCACAGCTTTCTTGAA
>LIBTEST1#136#2 acc=Taj1E4D3Z3Y02IXQIV len=18 def=
TTCCACAGCTTTCTTGAA
>LIBTEST1#137#1 acc=Taj1E4D3Z3Y02HR981 len=22 def=
TACCTACCAAAACGAATACGAT
>LIBTEST1#138#1 acc=Taj1E4D3Z3Y02JS4FB len=19 def=
GTATCCGGTGGGGCCCTCG
>LIBTEST1#139#1 acc=Taj1E4D3Z3Y02GBBWC len=24 def=
CGACTGCAGTTAACTTCCGATGAC
>LIBTEST1#140#1 acc=Taj1E4D3Z3Y02H3R7I len=24 def=
CATCACGGATAAGCCATGGCTCAT
>LIBTEST1#141#1 acc=Taj1E4D3Z3Y02JH0ZL len=16 def=
CCTATCTGGCGTGCCA
>LIBTEST1#141#2 acc=Taj1E4D3Z3Y02JH0ZL len=16 def=
CCTATCTGGCGTGCCA
>LIBTEST1#141#3 acc=Taj1E4D3Z3Y02JH0ZL len=16 def=
CCTATCTGGCGTGCCA
>LIBTEST1#142#1 acc=Taj1E4D3Z3Y02HWRHS len=25 def=
TAGCGTCCGTGACTAATTGATGGTG
>LIBTEST1#142#2 acc=Taj1E4D3Z3Y02HWRHS len=25 def=
TAGCGTCCGTGACTAATTGATGGTG
>LIBTEST1#142#3 acc=Taj1E4D3Z3Y02HWRHS len=25 def=
TAGCGTCCGTGACTAATTGATGGTG
>LIBTEST1#142#4 acc=Taj1E4D3Z3Y02HWRHS len=25 def=
TAGCGTCCGTGACTAATTGATGGTG
>LIBTEST1#142#5 acc=Taj1E4D3Z3Y02HWRHS len=25 def=
TAGCGTCCGTGACTAATTGATGGTG
>LIBTEST1#143#1 acc=Taj1E4D3Z3Y02F81EY len=19 def=
CTGAGACACGCAACAGGGA
>LIBTEST1#143#2 acc=Taj1E4D3Z3Y02F81EY len=19 def=
CTGAGACACGCAACAGGGA
>LIBTEST1#144#1 acc=Taj1E4D3Z3Y02GFCY3 len=23 def=
TTCCACAGCTTCTTGAACTGATA
>LIBTEST1#145#1 acc=Taj1E4D3Z3Y02HSM63 len=18 def=
GATACCTGATACCTGATA
>LIBTEST1#146#1 acc=Taj1E4D3Z3Y02JPLYB len=17 def=
GGTGGATTATGTGCGGT
>LIBTEST1#147#1 acc=Taj1E4D3Z3Y02HRG84 len=24 def=
AATTGTCGTTGATCATATTTGTCC
>LIBTEST1#148#1 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#2 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#3 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#4 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#5 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#6 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#7 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#8 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#9 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#10 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#11 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#12 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#13 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#14 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#15 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#148#16 acc=Taj1E4D3Z3Y02HDQQM len=21 def=
AACCAGGCTCTGATACCATGA
>LIBTEST1#149#1 acc=Taj1E4D3Z3Y02GV8P5 len=15 def=
TAAGGATACACTCTG
>LIBTEST1#149#2 acc=Taj1E4D3Z3Y02GV8P5 len=15 def=
TAAGGATACACTCTG
>LIBTEST1#149#3 acc=Taj1E4D3Z3Y02GV8P5 len=15 def=
TAAGGATACACTCTG
>LIBTEST1#150#1 acc=Taj1E4D3Z3Y02FVPJI len=17 def=
TGCGAGTAAAAGGGCTA
>LIBTEST1#151#1 acc=Taj1E4D3Z3Y02HWK80 len=13 def=
TGATATCCTGATA
>LIBTEST1#151#2 acc=Taj1E4D3Z3Y02HWK80 len=13 def=
TGATATCCTGATA
>LIBTEST1#151#3 acc=Taj1E4D3Z3Y02HWK80 len=13 def=
TGATATCCTGATA
>LIBTEST1#151#4 acc=Taj1E4D3Z3Y02HWK80 len=13 def=
TGATATCCTGATA
>LIBTEST1#151#5 acc=Taj1E4D3Z3Y02HWK80 len=13 def=
TGATATCCTGATA
>LIBTEST1#152#1 acc=Taj1E4D3Z3Y02HOH3C len=26 def=
TATGAAGCTCGCCAGCATGATCTAAC
>LIBTEST1#153#1 acc=Taj1E4D3Z3Y02GP6VX len=21 def=
TTTGTGAGTATCCAAGCAGTT
>LIBTEST1#153#2 acc=Taj1E4D3Z3Y02GP6VX len=21 def=
TTTGTGAGTATCCAAGCAGTT
>LIBTEST1#153#3 acc=Taj1E4D3Z3Y02GP6VX len=21 def=
TTTGTGAGTATCCAAGCAGTT
>LIBTEST1#153#4 acc=Taj1E4D3Z3Y02GP6VX len=21 def=
TTTGTGAGTATCCAAGCAGTT
>LIBTEST1#154#1 acc=Taj1E4D3Z3Y02GJ7AW len=29 def=
GTACTACTCAGGAACGTCTACGAGTGTGC
>LIBTEST1#155#1 acc=Taj1E4D3Z3Y02HSMEC len=26 def=
CTCCTATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#155#2 acc=Taj1E4D3Z3Y02HSMEC len=26 def=
CTCCTATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#156#1 acc=Taj1E4D3Z3Y02G1NYH len=21 def=
ATGGCTGAAGAACGAGTTGGT
>LIBTEST1#157#1 acc=Taj1E4D3Z3Y02I2WJS len=22 def=
GGAATGTTGGCTGGCTCGAGGC
>LIBTEST1#158#1 acc=Taj1E4D3Z3Y02JP28A len=23 def=
TATCTCCCTGTTGCGTGTCTCAG
>LIBTEST1#159#1 acc=Taj1E4D3Z3Y02H16HJ len=14 def=
TAGCGTCGTGACTA
>LIBTEST1#159#2 acc=Taj1E4D3Z3Y02H16HJ len=14 def=
TAGCGTCGTGACTA
>LIBTEST1#159#3 acc=Taj1E4D3Z3Y02H16HJ len=14 def=
TAGCGTCGTGACTA
>LIBTEST1#159#4 acc=Taj1E4D3Z3Y02H16HJ len=14 def=
TAGCGTCGTGACTA
>LIBTEST1#159#5 acc=Taj1E4D3Z3Y02H16HJ len=14 def=
TAGCGTCGTGACTA
>LIBTEST1#159#6 acc=Taj1E4D3Z3Y02H16HJ len=14 def=
TAGCGTCGTGACTA
>LIBTEST1#160#1 acc=Taj1E4D3Z3Y02HC6E5 len=14 def=
GTAGGTCCTGATAA
>LIBTEST1#160#2 acc=Taj1E4D3Z3Y02HC6E5 len=14 def=
GTAGGTCCTGATAA
>LIBTEST1#160#3 acc=Taj1E4D3Z3Y02HC6E5 len=14 def=
GTAGGTCCTGATAA
>LIBTEST1#161#1 acc=Taj1E4D3Z3Y02GKV0B len=23 def=
TACCAAAAATCACTATCTACTAT
>LIBTEST1#161#2 acc=Taj1E4D3Z3Y02GKV0B len=23 def=
TACCAAAAATCACTATCTACTAT
>LIBTEST1#162#1 acc=Taj1E4D3Z3Y02GFGGO len=16 def=
GTCCTGATATCCTGAT
>LIBTEST1#163#1 acc=Taj1E4D3Z3Y02H5TS6 len=23 def=
ACTATACTCCACAATGGGGTGCC
>LIBTEST1#164#1 acc=Taj1E4D3Z3Y02IA8BV len=17 def=
GGACGTCTACGGATGTG
>LIBTEST1#165#1 acc=Taj1E4D3Z3Y02F0FGF len=24 def=
AATCGAACTAGTCATTAAACTGAT
>LIBTEST1#165#2 acc=Taj1E4D3Z3Y02F0FGF len=24 def=
AATCGAACTAGTCATTAAACTGAT
>LIBTEST1#165#3 acc=Taj1E4D3Z3Y02F0FGF len=24 def=
AATCGAACTAGTCATTAAACTGAT
>LIBTEST1#166#1 acc=Taj1E4D3Z3Y02GRYFN len=18 def=
TTTACGGAATGTGTGAAC
>LIBTEST1#166#2 acc=Taj1E4D3Z3Y02GRYFN len=18 def=
TTTACGGAATGTGTGAAC
>LIBTEST1#166#3 acc=Taj1E4D3Z3Y02GRYFN len=18 def=
TTTACGGAATGTGTGAAC
>LIBTEST1#166#4 acc=Taj1E4D3Z3Y02GRYFN len=18 def=
TTTACGGAATGTGTGAAC
>LIBTEST1#166#5 acc=Taj1E4D3Z3Y02GRYFN len=18 def=
TTTACGGAATGTGTGAAC
>LIBTEST1#166#6 acc=Taj1E4D3Z3Y02GRYFN len=18 def=
TTTACGGAATGTGTGAAC
>LIBTEST1#166#7 acc=Taj1E4D3Z3Y02GRYFN len=18 def=
TTTACGGAATGTGTGAAC
>LIBTEST1#166#8 acc=Taj1E4D3Z3Y02GRYFN len=18 def=
TTTACGGAATGTGTGAAC
>LIBTEST1#167#1 acc=Taj1E4D3Z3Y02HUAQC len=21 def=
AATGGTCAAATGCCTCGTCAT
>LIBTEST1#168#1 acc=Taj1E4D3Z3Y02JHC0W len=22 def=
CACCGGTTGTGGAGGATCCTCC
>LIBTEST1#169#1 acc=Taj1E4D3Z3Y02I2NNQ len=19 def=
TGAGCCAGGATGGCCTGCC
>LIBTEST1#170#1 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#2 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#3 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#4 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#5 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#6 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#7 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#8 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#9 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#10 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#11 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#12 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#13 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#14 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#15 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#16 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#17 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#18 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#19 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#20 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#21 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#22 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#23 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#24 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#25 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#26 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#27 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#28 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#29 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#30 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#31 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#32 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#33 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#34 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#35 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#36 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#37 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#38 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#39 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#40 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#41 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#42 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#43 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#44 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#45 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#46 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#170#47 acc=Taj1E4D3Z3Y02G61S0 len=14 def=
CCTGATACCTGATA
>LIBTEST1#171#1 acc=Taj1E4D3Z3Y02J38UT len=14 def=
ATCAGGACGGCGTA
>LIBTEST1#172#1 acc=Taj1E4D3Z3Y02G2N0O len=28 def=
TGTTGTCCTCGCGTCCTTTGAGTATTGA
>LIBTEST1#173#1 acc=Taj1E4D3Z3Y02F8GYV len=19 def=
TTAATGATTGTTAGTTAGT
>LIBTEST1#174#1 acc=Taj1E4D3Z3Y02I8D27 len=13 def=
TGATATACTGATA
>LIBTEST1#175#1 acc=Taj1E4D3Z3Y02HC7G9 len=21 def=
TCAGACCAGGCTTCATTCCCC
>LIBTEST1#176#1 acc=Taj1E4D3Z3Y02GBK0Z len=20 def=
CCTGATAATTAATGTTAACC
>LIBTEST1#177#1 acc=Taj1E4D3Z3Y02F9BM4 len=22 def=
TACGTGTGTCTTCACCTCTGAA
>LIBTEST1#177#2 acc=Taj1E4D3Z3Y02F9BM4 len=22 def=
TACGTGTGTCTTCACCTCTGAA
>LIBTEST1#178#1 acc=Taj1E4D3Z3Y02JLAKL len=23 def=
GACACTGCAACGTTTCACTGCTG
>LIBTEST1#179#1 acc=Taj1E4D3Z3Y02G9MDV len=18 def=
GCTGCTATTGCTATGCTA
>LIBTEST1#180#1 acc=Taj1E4D3Z3Y02JN7U1 len=21 def=
CACAACAGGTCAAGTGGTGAG
>LIBTEST1#180#2 acc=Taj1E4D3Z3Y02JN7U1 len=21 def=
CACAACAGGTCAAGTGGTGAG
>LIBTEST1#180#3 acc=Taj1E4D3Z3Y02JN7U1 len=21 def=
CACAACAGGTCAAGTGGTGAG
>LIBTEST1#180#4 acc=Taj1E4D3Z3Y02JN7U1 len=21 def=
CACAACAGGTCAAGTGGTGAG
>LIBTEST1#180#5 acc=Taj1E4D3Z3Y02JN7U1 len=21 def=
CACAACAGGTCAAGTGGTGAG
>LIBTEST1#180#6 acc=Taj1E4D3Z3Y02JN7U1 len=21 def=
CACAACAGGTCAAGTGGTGAG
>LIBTEST1#181#1 acc=Taj1E4D3Z3Y02I18ZW len=14 def=
GTAGCCGTCATAAT
>LIBTEST1#182#1 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#2 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#3 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#4 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#5 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#6 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#7 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#8 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#9 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#10 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#11 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#12 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#13 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#14 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#15 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#16 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#17 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#18 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#19 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#20 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#21 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#22 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#23 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#24 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#25 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#26 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#27 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#28 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#29 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#30 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#31 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#32 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#33 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#34 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#35 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#36 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#37 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#38 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#39 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#40 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#41 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#42 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#43 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#182#44 acc=Taj1E4D3Z3Y02IR2TK len=14 def=
TAGCGTCCGTGATA
>LIBTEST1#183#1 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#2 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#3 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#4 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#5 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#6 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#7 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#8 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#9 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#10 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#11 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#12 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#13 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#14 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#15 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#16 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#17 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#18 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#19 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#20 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#21 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#22 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#23 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#24 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#25 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#26 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#27 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#28 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#183#29 acc=Taj1E4D3Z3Y02GY4R6 len=19 def=
TCGGACCAGGCTTCATTCC
>LIBTEST1#184#1 acc=Taj1E4D3Z3Y02HCTA2 len=25 def=
CGAGTTGACGGACCGGCCCACACCT
>LIBTEST1#185#1 acc=Taj1E4D3Z3Y02GGCH5 len=28 def=
AGCACACTCGTAGACGTTCCTGAGTATC
>LIBTEST1#186#1 acc=Taj1E4D3Z3Y02G05E5 len=15 def=
CGTCTACGAGTGTCG
>LIBTEST1#186#2 acc=Taj1E4D3Z3Y02G05E5 len=15 def=
CGTCTACGAGTGTCG
>LIBTEST1#186#3 acc=Taj1E4D3Z3Y02G05E5 len=15 def=
CGTCTACGAGTGTCG
>LIBTEST1#186#4 acc=Taj1E4D3Z3Y02G05E5 len=15 def=
CGTCTACGAGTGTCG
>LIBTEST1#187#1 acc=Taj1E4D3Z3Y02F9WZV len=18 def=
GTACGCGAGCTGGATTGA
>LIBTEST1#188#1 acc=Taj1E4D3Z3Y02GWLQB len=14 def=
CTAATTGGATCGGT
>LIBTEST1#188#2 acc=Taj1E4D3Z3Y02GWLQB len=14 def=
CTAATTGGATCGGT
>LIBTEST1#189#1 acc=Taj1E4D3Z3Y02HB4RS len=26 def=
GCCAGTTACCGAAGCTGCGGATGCAT
>LIBTEST1#190#1 acc=Taj1E4D3Z3Y02HV1UA len=24 def=
TCGTTCGGGAGAGCATAGTTCGAT
>LIBTEST1#191#1 acc=Taj1E4D3Z3Y02IR7HE len=26 def=
ATATCTAGTGACTATAAATTGATCTT
>LIBTEST1#192#1 acc=Taj1E4D3Z3Y02F7NQN len=22 def=
ATTAATTGAGTGGTCGCCTACA
>LIBTEST1#192#2 acc=Taj1E4D3Z3Y02F7NQN len=22 def=
ATTAATTGAGTGGTCGCCTACA
>LIBTEST1#193#1 acc=Taj1E4D3Z3Y02GIS1R len=23 def=
AAGTGTTTTCCTATTAAATCACT
>LIBTEST1#194#1 acc=Taj1E4D3Z3Y02IO8UX len=22 def=
ACTAACTTGTAAATTGCATTAT
>LIBTEST1#195#1 acc=Taj1E4D3Z3Y02IJHEB len=21 def=
CGACTCCCGGTAGGACCTCCA
>LIBTEST1#195#2 acc=Taj1E4D3Z3Y02IJHEB len=21 def=
CGACTCCCGGTAGGACCTCCA
>LIBTEST1#195#3 acc=Taj1E4D3Z3Y02IJHEB len=21 def=
CGACTCCCGGTAGGACCTCCA
>LIBTEST1#195#4 acc=Taj1E4D3Z3Y02IJHEB len=21 def=
CGACTCCCGGTAGGACCTCCA
>LIBTEST1#195#5 acc=Taj1E4D3Z3Y02IJHEB len=21 def=
CGACTCCCGGTAGGACCTCCA
>LIBTEST1#195#6 acc=Taj1E4D3Z3Y02IJHEB len=21 def=
CGACTCCCGGTAGGACCTCCA
>LIBTEST1#196#1 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#2 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#3 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#4 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#5 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#6 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#7 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#8 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#9 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#10 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#11 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#196#12 acc=Taj1E4D3Z3Y02FXGCM len=22 def=
TCCCTACCATGTGGACTCCATC
>LIBTEST1#197#1 acc=Taj1E4D3Z3Y02HPSPQ len=15 def=
CAAAGACTACACTCT
>LIBTEST1#198#1 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#2 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#3 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#4 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#5 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#6 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#7 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#8 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#9 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#10 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#11 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#198#12 acc=Taj1E4D3Z3Y02GW1MR len=15 def=
CTGATAGTCCTGATA
>LIBTEST1#199#1 acc=Taj1E4D3Z3Y02HYUP6 len=17 def=
CCTGATAGGTTTCGTGG
>LIBTEST1#200#1 acc=Taj1E4D3Z3Y02JWPAV len=24 def=
GATTGTAGGAGGGGGCTTGTCGAT
>LIBTEST1#201#1 acc=Taj1E4D3Z3Y02HWQX1 len=14 def=
GTCCTGATAGCGTC
>LIBTEST1#202#1 acc=Taj1E4D3Z3Y02FQ1X9 len=20 def=
CTTATCATGCTCTCTCAACA
>LIBTEST1#202#2 acc=Taj1E4D3Z3Y02FQ1X9 len=20 def=
CTTATCATGCTCTCTCAACA
>LIBTEST1#202#3 acc=Taj1E4D3Z3Y02FQ1X9 len=20 def=
CTTATCATGCTCTCTCAACA
>LIBTEST1#203#1 acc=Taj1E4D3Z3Y02GAVGW len=13 def=
ACTTACGATGGTG
>LIBTEST1#204#1 acc=Taj1E4D3Z3Y02JUXRT len=26 def=
CACAGGACTTCTGATCCTATTGTGAC
>LIBTEST1#205#1 acc=Taj1E4D3Z3Y02F7VZU len=30 def=
TCGGACCAGGCTTACTATTCCCCAGTTGAC
>LIBTEST1#206#1 acc=Taj1E4D3Z3Y02JOLSM len=23 def=
AGTCTTGGAACAAGGCGTGATGC
>LIBTEST1#207#1 acc=Taj1E4D3Z3Y02IGIZJ len=24 def=
CCTGATAGGGGAAGGTTCCATGTG
>LIBTEST1#208#1 acc=Taj1E4D3Z3Y02GSWQD len=18 def=
CCTATCCATGAGCGTGGA
>LIBTEST1#209#1 acc=Taj1E4D3Z3Y02HFNMR len=23 def=
CTATTAATCAGGGAATCACAGTT
>LIBTEST1#210#1 acc=Taj1E4D3Z3Y02HDKNU len=19 def=
ATACATATTCTGCTTACGT
>LIBTEST1#210#2 acc=Taj1E4D3Z3Y02HDKNU len=19 def=
ATACATATTCTGCTTACGT
>LIBTEST1#211#1 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#2 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#3 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#4 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#5 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#6 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#7 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#8 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#9 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#10 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#11 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#12 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#13 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#14 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#15 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#16 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#17 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#211#18 acc=Taj1E4D3Z3Y02HT947 len=23 def=
GATATTTGTGAGTATCCAAGCAG
>LIBTEST1#212#1 acc=Taj1E4D3Z3Y02F7GJA len=20 def=
TGGACTGAAGGGAGCTCCCT
>LIBTEST1#212#2 acc=Taj1E4D3Z3Y02F7GJA len=20 def=
TGGACTGAAGGGAGCTCCCT
>LIBTEST1#212#3 acc=Taj1E4D3Z3Y02F7GJA len=20 def=
TGGACTGAAGGGAGCTCCCT
>LIBTEST1#213#1 acc=Taj1E4D3Z3Y02H2PGP len=15 def=
CAATTCATGGAAATG
>LIBTEST1#214#1 acc=Taj1E4D3Z3Y02F2VQ5 len=14 def=
CGACGGTCGCTATA
>LIBTEST1#214#2 acc=Taj1E4D3Z3Y02F2VQ5 len=14 def=
CGACGGTCGCTATA
>LIBTEST1#214#3 acc=Taj1E4D3Z3Y02F2VQ5 len=14 def=
CGACGGTCGCTATA
>LIBTEST1#214#4 acc=Taj1E4D3Z3Y02F2VQ5 len=14 def=
CGACGGTCGCTATA
>LIBTEST1#214#5 acc=Taj1E4D3Z3Y02F2VQ5 len=14 def=
CGACGGTCGCTATA
>LIBTEST1#215#1 acc=Taj1E4D3Z3Y02H9BLE len=20 def=
TTGGATTAGTCACCATGATG
>LIBTEST1#216#1 acc=Taj1E4D3Z3Y02GMOEU len=26 def=
AGTCGTCTCGGTAGACTTACGATGTG
>LIBTEST1#217#1 acc=Taj1E4D3Z3Y02GW1JI len=19 def=
GCGGCGAGAGCGGGTCATA
>LIBTEST1#218#1 acc=Taj1E4D3Z3Y02GX3V6 len=14 def=
TGATAGTAGCGTCC
>LIBTEST1#218#2 acc=Taj1E4D3Z3Y02GX3V6 len=14 def=
TGATAGTAGCGTCC
>LIBTEST1#218#3 acc=Taj1E4D3Z3Y02GX3V6 len=14 def=
TGATAGTAGCGTCC
>LIBTEST1#218#4 acc=Taj1E4D3Z3Y02GX3V6 len=14 def=
TGATAGTAGCGTCC
>LIBTEST1#218#5 acc=Taj1E4D3Z3Y02GX3V6 len=14 def=
TGATAGTAGCGTCC
>LIBTEST1#219#1 acc=Taj1E4D3Z3Y02I9Z0P len=15 def=
CGTCCTGAGACGTAG
>LIBTEST1#220#1 acc=Taj1E4D3Z3Y02J267D len=24 def=
CGGACGAAACACATCATTAAGCCT
>LIBTEST1#221#1 acc=Taj1E4D3Z3Y02GEM6G len=17 def=
ATTGATCATAGATTTTT
>LIBTEST1#222#1 acc=Taj1E4D3Z3Y02JAER4 len=22 def=
TCGTTTCATGTCAGGTTCACCA
>LIBTEST1#222#2 acc=Taj1E4D3Z3Y02JAER4 len=22 def=
TCGTTTCATGTCAGGTTCACCA
>LIBTEST1#223#1 acc=Taj1E4D3Z3Y02JK46C len=14 def=
GGACCTGTGCTCGG
>LIBTEST1#224#1 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#224#2 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#224#3 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#224#4 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#224#5 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#224#6 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#224#7 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#224#8 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#224#9 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#224#10 acc=Taj1E4D3Z3Y02F5WYG len=24 def=
TTGCAGGGGTGCAAATCGTGGCAC
>LIBTEST1#225#1 acc=Taj1E4D3Z3Y02FWUY7 len=25 def=
GTAGCGTCGTGACTAATTGATGGTG
>LIBTEST1#226#1 acc=Taj1E4D3Z3Y02IW9Y2 len=26 def=
CCAACATACGTTAAGCGTCCGTGATA
>LIBTEST1#227#1 acc=Taj1E4D3Z3Y02I4QSD len=15 def=
TGGACCTTGGTTGGT
>LIBTEST1#228#1 acc=Taj1E4D3Z3Y02INJ6S len=24 def=
ATGTTCCTTTTGTGTCCGTTTCCT
>LIBTEST1#229#1 acc=Taj1E4D3Z3Y02GJ7OZ len=24 def=
ATTTCGTCGTCTGAGTGTGGCGAT
>LIBTEST1#230#1 acc=Taj1E4D3Z3Y02GG4OJ len=21 def=
TGAAGCTGCCAGCATGATCTA
>LIBTEST1#230#2 acc=Taj1E4D3Z3Y02GG4OJ len=21 def=
TGAAGCTGCCAGCATGATCTA
>LIBTEST1#230#3 acc=Taj1E4D3Z3Y02GG4OJ len=21 def=
TGAAGCTGCCAGCATGATCTA
>LIBTEST1#230#4 acc=Taj1E4D3Z3Y02GG4OJ len=21 def=
TGAAGCTGCCAGCATGATCTA
>LIBTEST1#231#1 acc=Taj1E4D3Z3Y02IWDST len=21 def=
TCGCTTGGTGCAGGTCGGGAA
>LIBTEST1#231#2 acc=Taj1E4D3Z3Y02IWDST len=21 def=
TCGCTTGGTGCAGGTCGGGAA
>LIBTEST1#231#3 acc=Taj1E4D3Z3Y02IWDST len=21 def=
TCGCTTGGTGCAGGTCGGGAA
>LIBTEST1#231#4 acc=Taj1E4D3Z3Y02IWDST len=21 def=
TCGCTTGGTGCAGGTCGGGAA
>LIBTEST1#231#5 acc=Taj1E4D3Z3Y02IWDST len=21 def=
TCGCTTGGTGCAGGTCGGGAA
>LIBTEST1#232#1 acc=Taj1E4D3Z3Y02JR8RV len=15 def=
CGATAATTAGTATGA
>LIBTEST1#233#1 acc=Taj1E4D3Z3Y02JUO1E len=16 def=
TCGTAACGTCCTAATA
>LIBTEST1#234#1 acc=Taj1E4D3Z3Y02GXMXB len=14 def=
CATAGCGTCCTATA
>LIBTEST1#235#1 acc=Taj1E4D3Z3Y02GETTY len=23 def=
AGTATGCTTCTGAAGTACGCTTC
>LIBTEST1#236#1 acc=Taj1E4D3Z3Y02GIX2H len=21 def=
TAAAAGAAAAGGATGTATGTG
>LIBTEST1#237#1 acc=Taj1E4D3Z3Y02GR5WI len=16 def=
TAGCGGTCCGTGACTA
>LIBTEST1#238#1 acc=Taj1E4D3Z3Y02FQV1H len=24 def=
ATAAAATGTTACGGCAGTTATTGG
>LIBTEST1#239#1 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#2 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#3 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#4 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#5 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#6 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#7 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#8 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#9 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#10 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#11 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#12 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#13 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#14 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#15 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#16 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#17 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#18 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#19 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#20 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#21 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#22 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#23 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#24 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#25 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#26 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#27 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#28 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#29 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#30 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#31 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#32 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#33 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#34 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#35 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#36 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#37 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#38 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#39 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#40 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#41 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#42 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#43 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#44 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#45 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#46 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#47 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#48 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#49 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#50 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#51 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#52 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#53 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#54 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#55 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#56 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#57 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#58 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#59 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#60 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#61 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#62 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#63 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#64 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#65 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#66 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#67 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#68 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#69 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#70 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#71 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#72 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#73 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#74 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#75 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#239#76 acc=Taj1E4D3Z3Y02GSAHE len=21 def=
TTAATCAGGGAAATCACAGTT
>LIBTEST1#240#1 acc=Taj1E4D3Z3Y02IC0YD len=24 def=
GCTGGGTTACGGTGATTGATGGTG
>LIBTEST1#241#1 acc=Taj1E4D3Z3Y02H90FS len=21 def=
GAACCCCTGCTAGGGGAGGAC
>LIBTEST1#242#1 acc=Taj1E4D3Z3Y02F63QJ len=25 def=
CTGAGACACGCAACAGGGGATAGGA
>LIBTEST1#242#2 acc=Taj1E4D3Z3Y02F63QJ len=25 def=
CTGAGACACGCAACAGGGGATAGGA
>LIBTEST1#242#3 acc=Taj1E4D3Z3Y02F63QJ len=25 def=
CTGAGACACGCAACAGGGGATAGGA
>LIBTEST1#242#4 acc=Taj1E4D3Z3Y02F63QJ len=25 def=
CTGAGACACGCAACAGGGGATAGGA
>LIBTEST1#243#1 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#2 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#3 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#4 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#5 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#6 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#7 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#8 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#9 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#10 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#11 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#12 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#13 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#14 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#15 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#16 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#17 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#18 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#19 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#20 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#21 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#22 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#23 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#24 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#25 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#26 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#27 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#28 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#29 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#30 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#31 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#32 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#33 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#34 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#35 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#36 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#37 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#38 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#39 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#40 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#41 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#42 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#43 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#44 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#45 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#46 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#47 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#48 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#49 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#50 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#51 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#52 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#53 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#54 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#55 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#56 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#57 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#58 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#59 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#60 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#61 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#62 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#63 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#64 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#65 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#66 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#67 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#68 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#69 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#70 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#71 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#72 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#73 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#74 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#75 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#76 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#77 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#78 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#79 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#80 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#81 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#82 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#83 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#84 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#85 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#86 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#87 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#88 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#89 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#90 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#91 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#92 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#93 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#94 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#95 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#96 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#97 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#98 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#99 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#100 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#101 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#102 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#103 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#104 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#105 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#106 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#107 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#108 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#109 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#110 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#111 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#112 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#113 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#114 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#115 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#116 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#117 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#118 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#119 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#120 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#121 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#122 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#123 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#124 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#125 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#126 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#127 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#128 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#129 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#130 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#131 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#132 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#133 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#134 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#135 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#136 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#137 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#138 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#139 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#140 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#141 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#142 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#143 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#144 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#145 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#146 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#147 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#148 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#149 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#150 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#151 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#152 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#153 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#154 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#155 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#156 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#157 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#158 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#159 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#160 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#161 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#162 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#163 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#164 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#165 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#166 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#167 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#168 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#169 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#243#170 acc=>Taj1E4D3Z3Y02FXTK5 len=22 def=
TGAAGCTGCCAGCATGATCTGG
>LIBTEST1#244#1 acc=Taj1E4D3Z3Y02F9XGJ len=15 def=
GGGACCTGTGCTCGG
>LIBTEST1#245#1 acc=Taj1E4D3Z3Y02IZZSP len=19 def=
ACCTGGATAATTGATGGTG
>LIBTEST1#245#2 acc=Taj1E4D3Z3Y02IZZSP len=19 def=
ACCTGGATAATTGATGGTG
>LIBTEST1#245#3 acc=Taj1E4D3Z3Y02IZZSP len=19 def=
ACCTGGATAATTGATGGTG
>LIBTEST1#245#4 acc=Taj1E4D3Z3Y02IZZSP len=19 def=
ACCTGGATAATTGATGGTG
>LIBTEST1#246#1 acc=Taj1E4D3Z3Y02FZDIR len=30 def=
CGCATCGAATGGAATTAACGAGAGTTGACT
>LIBTEST1#247#1 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#2 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#3 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#4 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#5 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#6 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#7 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#8 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#9 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#10 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#11 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#12 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#13 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#14 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#15 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#16 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#17 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#18 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#19 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#20 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#21 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#22 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#23 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#24 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#25 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#26 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#27 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#28 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#29 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#30 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#31 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#32 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#33 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#34 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#35 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#36 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#37 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#38 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#39 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#40 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#41 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#42 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#43 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#44 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#45 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#46 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#47 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#48 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#49 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#50 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#51 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#52 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#53 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#54 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#55 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#56 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#57 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#58 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#59 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#60 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#61 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#62 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#63 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#64 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#65 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#66 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#67 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#68 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#69 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#70 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#71 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#72 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#73 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#74 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#75 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#76 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#77 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#78 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#79 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#80 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#81 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#82 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#83 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#84 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#85 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#86 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#87 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#88 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#89 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#90 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#91 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#92 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#93 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#94 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#95 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#96 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#97 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#98 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#99 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#100 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#101 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#102 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#103 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#104 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#105 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#106 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#107 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#108 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#109 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#110 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#111 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#112 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#113 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#114 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#115 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#116 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#117 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#118 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#119 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#120 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#121 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#122 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#123 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#124 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#125 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#126 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#127 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#128 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#129 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#130 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#131 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#132 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#133 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#134 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#135 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#136 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#137 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#138 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#139 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#140 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#141 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#142 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#143 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#247#144 acc=Taj1E4D3Z3Y02G3P7D len=13 def=
GTAGCGTCTGATA
>LIBTEST1#248#1 acc=Taj1E4D3Z3Y02JPKAX len=25 def=
AGGGTGCACGAGAAGGCAGCAGGGT
>LIBTEST1#249#1 acc=Taj1E4D3Z3Y02J3C81 len=28 def=
TCTCGCTACTCCCTGTTCCGTGTCTCAG
>LIBTEST1#250#1 acc=Taj1E4D3Z3Y02I9N6I len=24 def=
CTGATAGCTAATAAGCCAGCTGCT
>LIBTEST1#251#1 acc=Taj1E4D3Z3Y02F59ZR len=15 def=
AAGAGTGTGCCTACA
>LIBTEST1#252#1 acc=Taj1E4D3Z3Y02G3XJZ len=16 def=
ACTGATGGTGCTACAT
>LIBTEST1#253#1 acc=Taj1E4D3Z3Y02GOVRH len=17 def=
TGATATATTAGGTCTAA
>LIBTEST1#253#2 acc=Taj1E4D3Z3Y02GOVRH len=17 def=
TGATATATTAGGTCTAA
>LIBTEST1#254#1 acc=Taj1E4D3Z3Y02GLF5N len=23 def=
ATGTTCCTTTTGTGTCCGTTTCC
>LIBTEST1#255#1 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#2 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#3 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#4 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#5 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#6 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#7 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#8 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#9 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#10 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#11 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#12 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#255#13 acc=Taj1E4D3Z3Y02GRI93 len=21 def=
TTCCACAGCTTTCTTGAACTT
>LIBTEST1#256#1 acc=Taj1E4D3Z3Y02H93RT len=23 def=
CACATCGTAAGTCGTCCTGGATA
>LIBTEST1#257#1 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#2 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#3 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#4 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#5 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#6 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#7 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#8 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#9 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#10 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#11 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#12 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#13 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#14 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#15 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#16 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#17 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#18 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#19 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#20 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#21 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#22 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#23 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#24 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#25 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#26 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#27 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#28 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#29 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#30 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#31 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#32 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#33 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#34 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#35 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#36 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#37 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#38 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#39 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#40 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#41 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#42 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#43 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#44 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#45 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#46 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#47 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#48 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#49 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#50 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#51 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#52 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#53 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#54 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#55 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#56 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#57 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#58 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#59 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#60 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#61 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#62 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#63 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#64 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#65 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#66 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#67 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#68 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#69 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#70 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#71 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#72 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#73 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#74 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#75 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#76 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#77 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#78 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#257#79 acc=Taj1E4D3Z3Y02JHI5M len=13 def=
GTAGCGTCCGATA
>LIBTEST1#258#1 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#2 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#3 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#4 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#5 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#6 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#7 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#8 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#9 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#10 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#11 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#12 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#13 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#14 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#15 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#16 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#17 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#18 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#19 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#20 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#21 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#22 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#23 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#24 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#25 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#26 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#27 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#28 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#29 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#30 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#31 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#32 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#33 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#34 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#35 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#36 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#37 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#38 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#39 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#40 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#41 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#42 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#43 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#44 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#45 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#46 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#47 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#48 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#49 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#50 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#51 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#52 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#53 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#54 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#55 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#56 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#57 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#58 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#59 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#258#60 acc=Taj1E4D3Z3Y02GMC99 len=21 def=
TTCCACAGCTTTCTTGAACTG
>LIBTEST1#259#1 acc=Taj1E4D3Z3Y02G4EAF len=27 def=
CTGAGACACGCAACAGGGGATAGGAGC
>LIBTEST1#259#2 acc=Taj1E4D3Z3Y02G4EAF len=27 def=
CTGAGACACGCAACAGGGGATAGGAGC
>LIBTEST1#260#1 acc=Taj1E4D3Z3Y02GJK4J len=15 def=
TTGGTCGTCACGCAG
>LIBTEST1#261#1 acc=Taj1E4D3Z3Y02F8LNG len=13 def=
GTAGCGTCCATTG
>LIBTEST1#261#2 acc=Taj1E4D3Z3Y02F8LNG len=13 def=
GTAGCGTCCATTG
>LIBTEST1#261#3 acc=Taj1E4D3Z3Y02F8LNG len=13 def=
GTAGCGTCCATTG
>LIBTEST1#262#1 acc=Taj1E4D3Z3Y02HYKHX len=17 def=
GAGCGGCGGTCCTGATA
>LIBTEST1#263#1 acc=Taj1E4D3Z3Y02F2EP2 len=25 def=
AGCTGGAAACAGCGAAAGTGAATAC
>LIBTEST1#263#2 acc=Taj1E4D3Z3Y02F2EP2 len=25 def=
AGCTGGAAACAGCGAAAGTGAATAC
>LIBTEST1#263#3 acc=Taj1E4D3Z3Y02F2EP2 len=25 def=
AGCTGGAAACAGCGAAAGTGAATAC
>LIBTEST1#264#1 acc=Taj1E4D3Z3Y02G1KUT len=24 def=
TGAAGTGGTGATACGTTGACCACC
>LIBTEST1#265#1 acc=Taj1E4D3Z3Y02GOYOH len=14 def=
ATACGAGTGTGTCT
>LIBTEST1#266#1 acc=Taj1E4D3Z3Y02GPX9F len=13 def=
CTGATATCCTGAT
>LIBTEST1#266#2 acc=Taj1E4D3Z3Y02GPX9F len=13 def=
CTGATATCCTGAT
>LIBTEST1#266#3 acc=Taj1E4D3Z3Y02GPX9F len=13 def=
CTGATATCCTGAT
>LIBTEST1#267#1 acc=Taj1E4D3Z3Y02GBYJ4 len=15 def=
CTGATACTGATAGTC
>LIBTEST1#267#2 acc=Taj1E4D3Z3Y02GBYJ4 len=15 def=
CTGATACTGATAGTC
>LIBTEST1#268#1 acc=Taj1E4D3Z3Y02GVZEU len=24 def=
CCACATACGTTAGCGTCCGTGATA
>LIBTEST1#268#2 acc=Taj1E4D3Z3Y02GVZEU len=24 def=
CCACATACGTTAGCGTCCGTGATA
>LIBTEST1#268#3 acc=Taj1E4D3Z3Y02GVZEU len=24 def=
CCACATACGTTAGCGTCCGTGATA
>LIBTEST1#268#4 acc=Taj1E4D3Z3Y02GVZEU len=24 def=
CCACATACGTTAGCGTCCGTGATA
>LIBTEST1#268#5 acc=Taj1E4D3Z3Y02GVZEU len=24 def=
CCACATACGTTAGCGTCCGTGATA
>LIBTEST1#268#6 acc=Taj1E4D3Z3Y02GVZEU len=24 def=
CCACATACGTTAGCGTCCGTGATA
>LIBTEST1#268#7 acc=Taj1E4D3Z3Y02GVZEU len=24 def=
CCACATACGTTAGCGTCCGTGATA
>LIBTEST1#268#8 acc=Taj1E4D3Z3Y02GVZEU len=24 def=
CCACATACGTTAGCGTCCGTGATA
>LIBTEST1#268#9 acc=Taj1E4D3Z3Y02GVZEU len=24 def=
CCACATACGTTAGCGTCCGTGATA
>LIBTEST1#269#1 acc=Taj1E4D3Z3Y02H5P63 len=17 def=
GTAGCGTCGTGACTAAC
>LIBTEST1#270#1 acc=Taj1E4D3Z3Y02IGMBK len=13 def=
TGAGGGTACACTC
>LIBTEST1#271#1 acc=Taj1E4D3Z3Y02IEEXF len=19 def=
CGAGTATTTAATGTTGTAT
>LIBTEST1#272#1 acc=Taj1E4D3Z3Y02HXKSN len=22 def=
GGGGGTCGCAGTGACCAGGCCC
>LIBTEST1#273#1 acc=Taj1E4D3Z3Y02HFV3S len=19 def=
TTCGGATTAAAACTTACAC
>LIBTEST1#274#1 acc=Taj1E4D3Z3Y02GJVNF len=24 def=
CAAGTCAATGCTGACGTGGCCGCC
>LIBTEST1#275#1 acc=Taj1E4D3Z3Y02HIQJK len=24 def=
TAATAGATGTGCTTTAGAATTGAT
>LIBTEST1#276#1 acc=Taj1E4D3Z3Y02JM1N1 len=22 def=
AGAATCTTGATGATGCTGCAGT
>LIBTEST1#277#1 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#2 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#3 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#4 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#5 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#6 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#7 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#8 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#9 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#10 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#11 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#12 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#13 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#14 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#15 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#277#16 acc=Taj1E4D3Z3Y02IUDJ9 len=21 def=
ATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#278#1 acc=Taj1E4D3Z3Y02G6QMV len=15 def=
GGAGACAGACTGCGG
>LIBTEST1#279#1 acc=Taj1E4D3Z3Y02FVCE7 len=15 def=
CTGATACTGATAGTT
>LIBTEST1#280#1 acc=Taj1E4D3Z3Y02G1XGS len=17 def=
GTCCACTGAACATTGAT
>LIBTEST1#281#1 acc=Taj1E4D3Z3Y02FIWVN len=14 def=
CNTGCGTGTCTCAG
>LIBTEST1#282#1 acc=Taj1E4D3Z3Y02GC8M7 len=17 def=
CGTAAGCGTCCTGTATA
>LIBTEST1#283#1 acc=Taj1E4D3Z3Y02JZZV4 len=24 def=
ATACTAGGACGCGTACGACTGTGC
>LIBTEST1#284#1 acc=Taj1E4D3Z3Y02HAS68 len=15 def=
GATACCCTGGAACGT
>LIBTEST1#285#1 acc=Taj1E4D3Z3Y02F3MJ6 len=23 def=
GTAGCTCCTGATAATTGATGGTG
>LIBTEST1#285#2 acc=Taj1E4D3Z3Y02F3MJ6 len=23 def=
GTAGCTCCTGATAATTGATGGTG
>LIBTEST1#285#3 acc=Taj1E4D3Z3Y02F3MJ6 len=23 def=
GTAGCTCCTGATAATTGATGGTG
>LIBTEST1#286#1 acc=Taj1E4D3Z3Y02JY7NN len=26 def=
ATTGACTCGGTGCCTAACTACTCTGG
>LIBTEST1#286#2 acc=Taj1E4D3Z3Y02JY7NN len=26 def=
ATTGACTCGGTGCCTAACTACTCTGG
>LIBTEST1#287#1 acc=Taj1E4D3Z3Y02GC0MC len=23 def=
GAGCTCCCGCATACACAAGGCTC
>LIBTEST1#288#1 acc=Taj1E4D3Z3Y02FVO7M len=16 def=
GCCTGATACTGATATG
>LIBTEST1#289#1 acc=Taj1E4D3Z3Y02J1YKO len=19 def=
ACCCTGTTGCGTGTCTCAG
>LIBTEST1#289#2 acc=Taj1E4D3Z3Y02J1YKO len=19 def=
ACCCTGTTGCGTGTCTCAG
>LIBTEST1#290#1 acc=Taj1E4D3Z3Y02HAFPZ len=22 def=
CTAACTGATGCCACATTGTTTG
>LIBTEST1#291#1 acc=Taj1E4D3Z3Y02GBLJ3 len=19 def=
AACTCGATTTCGACTATTC
>LIBTEST1#292#1 acc=Taj1E4D3Z3Y02F5SQC len=26 def=
ATTGATCGGTGCCTTAACACTACTGT
>LIBTEST1#293#1 acc=Taj1E4D3Z3Y02F2ZOT len=28 def=
TTCCCTATCCCCCTGTTGCGTGTCTCAG
>LIBTEST1#294#1 acc=Taj1E4D3Z3Y02IWBVZ len=24 def=
AGGAGGGCGCGGCGGTCGCTGTCC
>LIBTEST1#295#1 acc=Taj1E4D3Z3Y02FW3AB len=13 def=
CGTGACCTGCATG
>LIBTEST1#296#1 acc=Taj1E4D3Z3Y02F6QLK len=22 def=
CTGAGACACGCAACAGGGGATA
>LIBTEST1#296#2 acc=Taj1E4D3Z3Y02F6QLK len=22 def=
CTGAGACACGCAACAGGGGATA
>LIBTEST1#296#3 acc=Taj1E4D3Z3Y02F6QLK len=22 def=
CTGAGACACGCAACAGGGGATA
>LIBTEST1#297#1 acc=Taj1E4D3Z3Y02GJGAG len=17 def=
AGGTGTGTCTGGTATGC
>LIBTEST1#298#1 acc=Taj1E4D3Z3Y02G2TO8 len=24 def=
CGGAAACCTGATAGCAGGTGGCCC
>LIBTEST1#299#1 acc=Taj1E4D3Z3Y02ICJND len=14 def=
GTAGCGTCTGATAC
>LIBTEST1#300#1 acc=Taj1E4D3Z3Y02G2E0C len=18 def=
TGAAGCTGCCAGCATGAT
>LIBTEST1#300#2 acc=Taj1E4D3Z3Y02G2E0C len=18 def=
TGAAGCTGCCAGCATGAT
>LIBTEST1#300#3 acc=Taj1E4D3Z3Y02G2E0C len=18 def=
TGAAGCTGCCAGCATGAT
>LIBTEST1#300#4 acc=Taj1E4D3Z3Y02G2E0C len=18 def=
TGAAGCTGCCAGCATGAT
>LIBTEST1#300#5 acc=Taj1E4D3Z3Y02G2E0C len=18 def=
TGAAGCTGCCAGCATGAT
>LIBTEST1#300#6 acc=Taj1E4D3Z3Y02G2E0C len=18 def=
TGAAGCTGCCAGCATGAT
>LIBTEST1#301#1 acc=Taj1E4D3Z3Y02HVJRT len=18 def=
CGAAAGGCGTAGTCGATG
>LIBTEST1#302#1 acc=Taj1E4D3Z3Y02HJ6TE len=21 def=
TATAAGCATTAAACGGGGTGT
>LIBTEST1#303#1 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#2 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#3 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#4 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#5 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#6 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#7 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#8 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#9 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#10 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#303#11 acc=Taj1E4D3Z3Y02F0TED len=29 def=
TCGGACCAGGCTTCATTCCCCATTGATGG
>LIBTEST1#304#1 acc=Taj1E4D3Z3Y02H0SC7 len=17 def=
TGTTCCGCTTGTCTCAG
>LIBTEST1#305#1 acc=Taj1E4D3Z3Y02HYF79 len=30 def=
CTGAGACACGCAACAGGGGGATAGGAAGGC
>LIBTEST1#306#1 acc=Taj1E4D3Z3Y02GCWAL len=28 def=
CCTGATATTAATCAGGGAAATCACAGTT
>LIBTEST1#307#1 acc=Taj1E4D3Z3Y02HHBJQ len=26 def=
GAAATACCCATGACCTCATTACCTTG
>LIBTEST1#308#1 acc=Taj1E4D3Z3Y02J2E4O len=20 def=
ATTGGAGTGAAGGAGCTCCA
>LIBTEST1#309#1 acc=Taj1E4D3Z3Y02F4AIN len=24 def=
CTGCAAATACCCATACGTTTGACA
>LIBTEST1#310#1 acc=Taj1E4D3Z3Y02IWRGM len=22 def=
GTGGAAGTGCTTTTTGGGTTTC
>LIBTEST1#310#2 acc=Taj1E4D3Z3Y02IWRGM len=22 def=
GTGGAAGTGCTTTTTGGGTTTC
>LIBTEST1#310#3 acc=Taj1E4D3Z3Y02IWRGM len=22 def=
GTGGAAGTGCTTTTTGGGTTTC
>LIBTEST1#311#1 acc=Taj1E4D3Z3Y02J2M33 len=19 def=
ACGTGTCACTAGCGATGGC
>LIBTEST1#312#1 acc=Taj1E4D3Z3Y02J4HO0 len=21 def=
TGAAGCTATTAATCGAGTTGC
>LIBTEST1#313#1 acc=Taj1E4D3Z3Y02GUH9N len=24 def=
ACTAACTTTAGTGGAGTTGCACTA
>LIBTEST1#313#2 acc=Taj1E4D3Z3Y02GUH9N len=24 def=
ACTAACTTTAGTGGAGTTGCACTA
>LIBTEST1#314#1 acc=Taj1E4D3Z3Y02IH2Y4 len=17 def=
GAGCGTCCTGGATAACT
>LIBTEST1#315#1 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#2 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#3 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#4 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#5 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#6 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#7 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#8 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#9 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#10 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#11 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#12 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#13 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#14 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#15 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#16 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#17 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#18 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#19 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#20 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#21 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#22 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#23 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#24 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#25 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#26 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#27 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#28 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#29 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#30 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#31 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#32 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#33 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#34 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#35 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#36 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#37 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#38 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#39 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#40 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#41 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#42 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#43 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#44 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#45 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#46 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#47 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#48 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#49 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#50 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#51 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#52 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#53 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#54 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#55 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#56 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#57 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#58 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#59 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#60 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#61 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#62 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#63 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#64 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#65 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#66 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#67 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#68 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#69 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#70 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#71 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#72 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#73 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#74 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#75 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#76 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#77 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#78 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#79 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#80 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#81 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#82 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#83 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#84 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#85 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#86 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#87 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#88 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#89 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#90 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#91 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#92 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#93 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#94 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#95 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#96 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#97 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#98 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#99 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#100 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#101 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#102 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#103 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#104 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#105 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#106 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#107 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#108 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#109 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#110 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#111 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#112 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#113 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#114 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#115 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#116 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#117 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#118 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#119 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#120 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#121 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#122 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#123 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#124 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#125 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#126 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#127 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#128 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#129 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#130 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#131 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#132 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#133 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#134 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#135 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#136 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#137 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#138 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#139 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#140 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#141 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#142 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#143 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#144 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#145 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#146 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#147 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#148 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#149 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#150 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#151 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#152 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#153 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#154 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#155 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#156 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#157 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#158 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#159 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#160 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#161 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#162 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#163 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#164 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#165 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#166 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#167 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#168 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#169 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#170 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#171 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#172 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#173 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#174 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#175 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#176 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#177 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#178 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#179 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#180 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#181 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#182 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#183 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#184 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#185 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#186 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#187 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#188 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#189 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#190 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#191 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#192 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#193 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#194 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#195 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#196 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#197 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#198 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#199 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#200 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#201 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#202 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#203 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#204 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#205 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#206 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#207 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#208 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#209 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#210 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#211 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#212 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#213 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#214 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#215 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#216 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#217 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#218 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#219 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#220 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#221 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#222 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#223 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#224 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#225 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#226 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#227 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#228 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#229 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#230 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#231 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#232 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#233 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#234 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#235 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#236 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#237 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#238 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#239 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#240 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#241 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#242 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#243 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#244 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#245 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#246 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#247 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#248 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#249 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#250 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#251 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#252 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#253 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#254 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#255 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#256 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#257 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#258 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#259 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#260 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#261 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#262 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#263 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#264 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#265 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#266 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#267 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#268 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#269 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#270 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#271 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#272 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#273 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#274 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#275 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#276 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#277 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#278 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#279 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#280 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#281 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#282 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#283 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#284 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#285 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#286 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#287 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#288 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#289 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#290 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#291 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#292 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#293 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#294 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#295 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#296 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#297 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#298 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#299 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#300 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#301 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#302 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#303 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#304 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#305 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#306 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#307 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#308 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#309 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#310 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#311 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#312 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#313 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#314 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#315 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#316 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#317 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#318 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#319 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#320 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#321 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#322 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#323 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#324 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#325 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#326 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#327 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#328 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#329 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#330 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#331 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#332 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#333 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#334 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#335 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#336 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#337 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#338 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#339 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#340 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#341 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#342 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#343 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#344 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#345 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#346 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#347 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#348 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#349 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#350 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#351 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#352 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#353 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#354 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#355 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#356 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#357 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#358 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#359 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#360 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#361 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#362 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#363 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#364 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#365 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#366 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#367 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#368 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#369 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#370 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#371 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#372 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#373 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#374 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#375 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#376 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#377 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#378 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#379 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#380 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#381 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#382 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#383 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#384 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#385 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#386 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#387 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#388 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#389 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#390 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#391 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#392 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#393 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#394 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#395 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#396 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#397 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#398 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#399 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#400 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#401 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#402 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#403 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#404 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#405 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#406 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#407 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#408 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#409 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#410 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#411 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#412 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#413 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#414 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#415 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#416 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#417 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#418 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#419 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#420 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#421 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#422 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#423 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#424 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#425 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#426 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#427 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#428 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#429 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#430 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#431 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#432 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#433 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#434 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#435 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#436 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#437 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#438 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#439 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#440 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#441 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#442 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#443 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#444 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#445 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#446 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#447 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#448 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#449 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#450 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#451 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#452 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#453 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#454 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#455 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#456 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#457 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#458 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#459 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#460 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#461 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#462 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#463 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#464 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#465 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#466 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#467 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#468 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#469 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#470 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#471 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#472 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#473 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#474 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#475 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#476 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#477 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#478 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#479 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#480 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#481 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#482 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#483 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#484 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#485 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#486 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#487 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#488 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#489 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#490 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#491 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#492 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#493 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#494 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#495 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#496 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#497 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#498 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#499 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#500 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#501 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#502 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#503 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#504 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#505 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#506 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#507 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#508 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#509 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#510 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#511 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#512 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#513 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#514 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#515 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#516 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#517 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#518 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#519 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#520 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#521 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#522 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#523 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#524 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#525 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#526 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#527 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#528 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#529 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#530 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#531 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#532 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#533 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#534 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#535 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#536 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#537 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#538 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#539 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#540 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#315#541 acc=Taj1E4D3Z3Y02HPNK8 len=21 def=
TCGGACCAGGCTTCATTCCCC
>LIBTEST1#316#1 acc=Taj1E4D3Z3Y02GY28Y len=18 def=
ATTAGGATCGTAATAGAT
>LIBTEST1#317#1 acc=Taj1E4D3Z3Y02FXATJ len=22 def=
AGTTCCAAAATAAACATCAGGT
>LIBTEST1#318#1 acc=Taj1E4D3Z3Y02JT5O6 len=22 def=
CTGCACAATTTGAGGTAGTGGC
>LIBTEST1#318#2 acc=Taj1E4D3Z3Y02JT5O6 len=22 def=
CTGCACAATTTGAGGTAGTGGC
>LIBTEST1#319#1 acc=Taj1E4D3Z3Y02FTSPF len=15 def=
CAGGATAGTAGCGTC
>LIBTEST1#320#1 acc=Taj1E4D3Z3Y02F1RED len=23 def=
ATAGATTTGAATTATGAAGGAGT
>LIBTEST1#321#1 acc=Taj1E4D3Z3Y02GK5Q2 len=13 def=
CGATACCTCGATA
>LIBTEST1#322#1 acc=Taj1E4D3Z3Y02HASG9 len=20 def=
TTCCACAGCTTTCTTGAACT
>LIBTEST1#322#2 acc=Taj1E4D3Z3Y02HASG9 len=20 def=
TTCCACAGCTTTCTTGAACT
>LIBTEST1#322#3 acc=Taj1E4D3Z3Y02HASG9 len=20 def=
TTCCACAGCTTTCTTGAACT
>LIBTEST1#323#1 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#2 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#3 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#4 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#5 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#6 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#7 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#8 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#9 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#10 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#11 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#12 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#13 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#14 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#15 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#16 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#17 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#18 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#19 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#20 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#21 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#22 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#23 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#24 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#25 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#26 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#27 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#28 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#29 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#30 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#31 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#32 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#33 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#34 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#35 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#36 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#37 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#38 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#39 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#323#40 acc=Taj1E4D3Z3Y02H8XSW len=21 def=
TTTGGATTGAAGGGAGCTCTA
>LIBTEST1#324#1 acc=Taj1E4D3Z3Y02IZJKU len=18 def=
GCGTCCTCGATAATTAGT
>LIBTEST1#325#1 acc=Taj1E4D3Z3Y02GUK30 len=13 def=
ATTGATGGGCCTA
>LIBTEST1#325#2 acc=Taj1E4D3Z3Y02GUK30 len=13 def=
ATTGATGGGCCTA
>LIBTEST1#325#3 acc=Taj1E4D3Z3Y02GUK30 len=13 def=
ATTGATGGGCCTA
>LIBTEST1#326#1 acc=Taj1E4D3Z3Y02HFNCT len=25 def=
GCACAGTCGTACGCGTCCTAGTATA
>LIBTEST1#327#1 acc=Taj1E4D3Z3Y02HL0Z2 len=26 def=
GTAGCGTCCGTGACTAATTGACTGGT
>LIBTEST1#328#1 acc=Taj1E4D3Z3Y02JS97K len=21 def=
TCAGCTAGCTTATCAGCTATC
>LIBTEST1#329#1 acc=Taj1E4D3Z3Y02GM580 len=26 def=
CCTGATACGGATGTTGACGCAATGTG
>LIBTEST1#330#1 acc=Taj1E4D3Z3Y02JWCRH len=17 def=
ACCTGCATGGGCCACCA
>LIBTEST1#330#2 acc=Taj1E4D3Z3Y02JWCRH len=17 def=
ACCTGCATGGGCCACCA
>LIBTEST1#331#1 acc=Taj1E4D3Z3Y02JYW5P len=29 def=
CTGAGACACGCAACAGGGGGATAGGAAGG
>LIBTEST1#332#1 acc=Taj1E4D3Z3Y02I0Z9U len=20 def=
TAATCAGGGAAATCACAGTT
>LIBTEST1#332#2 acc=Taj1E4D3Z3Y02I0Z9U len=20 def=
TAATCAGGGAAATCACAGTT
>LIBTEST1#333#1 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#2 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#3 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#4 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#5 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#6 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#7 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#8 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#9 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#10 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#11 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#12 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#13 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#14 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#15 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#16 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#17 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#18 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#19 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#20 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#21 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#22 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#23 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#24 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#25 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#26 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#27 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#28 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#29 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#30 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#31 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#32 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#33 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#34 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#35 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#333#36 acc=Taj1E4D3Z3Y02HMDJ6 len=21 def=
TCGGACCAGGCTTCATTCCTA
>LIBTEST1#334#1 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#2 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#3 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#4 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#5 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#6 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#7 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#8 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#9 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#10 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#11 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#12 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#334#13 acc=Taj1E4D3Z3Y02GKV0K len=18 def=
CTGATAGTCGTCGTGGCC
>LIBTEST1#335#1 acc=Taj1E4D3Z3Y02JB5MA len=18 def=
CCTCCGTTGTCGTCGTNT
>LIBTEST1#336#1 acc=Taj1E4D3Z3Y02I5DU4 len=24 def=
TGATCCCAGATACGTGTCGTGTCC
>LIBTEST1#336#2 acc=Taj1E4D3Z3Y02I5DU4 len=24 def=
TGATCCCAGATACGTGTCGTGTCC
>LIBTEST1#337#1 acc=Taj1E4D3Z3Y02IK197 len=21 def=
TTCTTCTAAATTACATGCTCT
>LIBTEST1#338#1 acc=Taj1E4D3Z3Y02GM77T len=25 def=
GGTTTTGTCATGTGCAGCCTTTTCA
>LIBTEST1#339#1 acc=Taj1E4D3Z3Y02F3YF6 len=24 def=
GTAGCGTCTGACTAATTGATCGGT
>LIBTEST1#340#1 acc=Taj1E4D3Z3Y02F2M84 len=29 def=
ATTGATCGGTGCCTTAACACGTCTGGTCG
>LIBTEST1#341#1 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#2 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#3 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#4 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#5 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#6 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#7 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#8 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#9 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#10 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#341#11 acc=Taj1E4D3Z3Y02F4XI1 len=13 def=
TTGCGTGTCTCAG
>LIBTEST1#342#1 acc=Taj1E4D3Z3Y02G1BXG len=13 def=
GATAGTAGCGTCC
>LIBTEST1#342#2 acc=Taj1E4D3Z3Y02G1BXG len=13 def=
GATAGTAGCGTCC
>LIBTEST1#343#1 acc=Taj1E4D3Z3Y02GDZQ0 len=14 def=
TGATATACCTGATA
>LIBTEST1#344#1 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#2 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#3 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#4 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#5 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#6 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#7 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#8 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#9 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#10 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#11 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#344#12 acc=Taj1E4D3Z3Y02HR6JQ len=18 def=
AGTTAGCGTCCGTGACTA
>LIBTEST1#345#1 acc=Taj1E4D3Z3Y02HOTGS len=16 def=
GTCCTGATAATTGATG
>LIBTEST1#346#1 acc=Taj1E4D3Z3Y02J0HB1 len=27 def=
TAACTCATCTGGATTGATTTAATTGAT
>LIBTEST1#346#2 acc=Taj1E4D3Z3Y02J0HB1 len=27 def=
TAACTCATCTGGATTGATTTAATTGAT
>LIBTEST1#347#1 acc=Taj1E4D3Z3Y02JV55C len=14 def=
CGATAATTGATGGT
>LIBTEST1#348#1 acc=Taj1E4D3Z3Y02F8BVO len=24 def=
ACAGACATCACGGGAGGTGGTGGA
>LIBTEST1#348#2 acc=Taj1E4D3Z3Y02F8BVO len=24 def=
ACAGACATCACGGGAGGTGGTGGA
>LIBTEST1#349#1 acc=Taj1E4D3Z3Y02GNPB4 len=23 def=
AGTTTCCGCGGTTGGTCGTCACG
>LIBTEST1#350#1 acc=Taj1E4D3Z3Y02GPDR3 len=23 def=
AGACGGAGAGTGGTCGCCGGTGC
>LIBTEST1#351#1 acc=Taj1E4D3Z3Y02GS6E2 len=13 def=
TCGTAGCTCCTGA
>LIBTEST1#352#1 acc=Taj1E4D3Z3Y02HNVB3 len=18 def=
GATACTGATAGTAGCGTC
>LIBTEST1#353#1 acc=Taj1E4D3Z3Y02G1K28 len=20 def=
TTTCGCGGCACTACCTGAAT
>LIBTEST1#354#1 acc=Taj1E4D3Z3Y02H38JJ len=13 def=
TAGTCTCGTTTAT
>LIBTEST1#355#1 acc=Taj1E4D3Z3Y02HG9TF len=23 def=
AAGTTCAGACTGATGCTTTGACT
>LIBTEST1#356#1 acc=Taj1E4D3Z3Y02G1LTL len=21 def=
TAATCAGGGAAATCACAGTTA
>LIBTEST1#356#2 acc=Taj1E4D3Z3Y02G1LTL len=21 def=
TAATCAGGGAAATCACAGTTA
>LIBTEST1#357#1 acc=Taj1E4D3Z3Y02F13IG len=21 def=
TAATGTTGTATTGTGTTCTAT
>LIBTEST1#357#2 acc=Taj1E4D3Z3Y02F13IG len=21 def=
TAATGTTGTATTGTGTTCTAT
>LIBTEST1#357#3 acc=Taj1E4D3Z3Y02F13IG len=21 def=
TAATGTTGTATTGTGTTCTAT
>LIBTEST1#357#4 acc=Taj1E4D3Z3Y02F13IG len=21 def=
TAATGTTGTATTGTGTTCTAT
>LIBTEST1#358#1 acc=Taj1E4D3Z3Y02IG5IR len=15 def=
TGATAATTGATGGTG
>LIBTEST1#358#2 acc=Taj1E4D3Z3Y02IG5IR len=15 def=
TGATAATTGATGGTG
>LIBTEST1#358#3 acc=Taj1E4D3Z3Y02IG5IR len=15 def=
TGATAATTGATGGTG
>LIBTEST1#359#1 acc=Taj1E4D3Z3Y02HGPBE len=25 def=
AAGCTACCGTGCGTTGGAGGTCCGC
>LIBTEST1#360#1 acc=Taj1E4D3Z3Y02G410P len=20 def=
ATTTAGTATGGTGGCCTACC
>LIBTEST1#361#1 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#2 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#3 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#4 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#5 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#6 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#7 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#8 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#9 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#10 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#11 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#361#12 acc=Taj1E4D3Z3Y02IDTMN len=16 def=
CTGATAATTGATGGTG
>LIBTEST1#362#1 acc=Taj1E4D3Z3Y02IIIKE len=16 def=
GTTGGGGCTCGAAGAC
>LIBTEST1#363#1 acc=Taj1E4D3Z3Y02H4UNM len=14 def=
AGTTATGAGTGGTC
>LIBTEST1#364#1 acc=Taj1E4D3Z3Y02GHKG2 len=16 def=
TCTCGATCAATTCAAG
>LIBTEST1#365#1 acc=Taj1E4D3Z3Y02HZB7A len=24 def=
TATGTTCAGATTTCCTCGGCAGTT
>LIBTEST1#366#1 acc=Taj1E4D3Z3Y02JJS1Q len=22 def=
GTAGCGTCTGATAATTGATGGT
>LIBTEST1#366#2 acc=Taj1E4D3Z3Y02JJS1Q len=22 def=
GTAGCGTCTGATAATTGATGGT
>LIBTEST1#367#1 acc=Taj1E4D3Z3Y02J5INJ len=23 def=
CTGAGACACGCAACAGGGGATAG
>LIBTEST1#368#1 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#2 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#3 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#4 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#5 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#6 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#7 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#8 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#9 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#10 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#11 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#368#12 acc=Taj1E4D3Z3Y02ILXBL len=21 def=
TGAAGCTGCCAGCATGATCTT
>LIBTEST1#369#1 acc=Taj1E4D3Z3Y02HW54F len=22 def=
CTGAGACACGCAACAGGGATAG
>LIBTEST1#370#1 acc=Taj1E4D3Z3Y02F84T5 len=17 def=
GTCCTGATATCCTGATA
>LIBTEST1#370#2 acc=Taj1E4D3Z3Y02F84T5 len=17 def=
GTCCTGATATCCTGATA
>LIBTEST1#370#3 acc=Taj1E4D3Z3Y02F84T5 len=17 def=
GTCCTGATATCCTGATA
>LIBTEST1#370#4 acc=Taj1E4D3Z3Y02F84T5 len=17 def=
GTCCTGATATCCTGATA
>LIBTEST1#370#5 acc=Taj1E4D3Z3Y02F84T5 len=17 def=
GTCCTGATATCCTGATA
>LIBTEST1#370#6 acc=Taj1E4D3Z3Y02F84T5 len=17 def=
GTCCTGATATCCTGATA
>LIBTEST1#370#7 acc=Taj1E4D3Z3Y02F84T5 len=17 def=
GTCCTGATATCCTGATA
>LIBTEST1#370#8 acc=Taj1E4D3Z3Y02F84T5 len=17 def=
GTCCTGATATCCTGATA
>LIBTEST1#370#9 acc=Taj1E4D3Z3Y02F84T5 len=17 def=
GTCCTGATATCCTGATA
>LIBTEST1#371#1 acc=Taj1E4D3Z3Y02INXWX len=15 def=
GTAGCGTACCTGATA
>LIBTEST1#372#1 acc=Taj1E4D3Z3Y02GLW5H len=21 def=
TGTGTTCTCAGGTCGCCCCTG
>LIBTEST1#373#1 acc=Taj1E4D3Z3Y02GU64X len=23 def=
GTGAAGTAGGTCATCGTCAGGCT
>LIBTEST1#374#1 acc=Taj1E4D3Z3Y02FUKEI len=24 def=
AAGACTCCTTAAATGGACTCCACG
>LIBTEST1#374#2 acc=Taj1E4D3Z3Y02FUKEI len=24 def=
AAGACTCCTTAAATGGACTCCACG
>LIBTEST1#374#3 acc=Taj1E4D3Z3Y02FUKEI len=24 def=
AAGACTCCTTAAATGGACTCCACG
>LIBTEST1#374#4 acc=Taj1E4D3Z3Y02FUKEI len=24 def=
AAGACTCCTTAAATGGACTCCACG
>LIBTEST1#375#1 acc=Taj1E4D3Z3Y02H0MLS len=26 def=
CGTAGCGGGTAGAGGTGTTATCGACC
>LIBTEST1#376#1 acc=Taj1E4D3Z3Y02G5FUR len=20 def=
TCGTGTCCTGATAAGTTGAT
>LIBTEST1#377#1 acc=Taj1E4D3Z3Y02GLYTO len=24 def=
ACATGACATTTCTGGTTAACGTGT
>LIBTEST1#378#1 acc=Taj1E4D3Z3Y02GRKP0 len=14 def=
CTGACGCTCATGCA
>LIBTEST1#379#1 acc=Taj1E4D3Z3Y02FPG6X len=17 def=
CCGTCTGTTTAGAAGGT
>LIBTEST1#380#1 acc=Taj1E4D3Z3Y02IVS0S len=20 def=
ATTTCTCGGTGGGACCTCCA
>LIBTEST1#381#1 acc=Taj1E4D3Z3Y02HOH12 len=15 def=
ACGTCTACGATGTCG
>LIBTEST1#381#2 acc=Taj1E4D3Z3Y02HOH12 len=15 def=
ACGTCTACGATGTCG
>LIBTEST1#382#1 acc=Taj1E4D3Z3Y02GJSWE len=15 def=
TAAGTGGGAGCTCTA
>LIBTEST1#383#1 acc=Taj1E4D3Z3Y02H16WK len=27 def=
ATTGATGGTTACATTGTGGTTGGCTGT
>LIBTEST1#384#1 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#2 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#3 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#4 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#5 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#6 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#7 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#8 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#9 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#10 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#11 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#12 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#13 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#14 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#384#15 acc=Taj1E4D3Z3Y02GBZG6 len=22 def=
TGAAGCTGCCAGCATGATCTGT
>LIBTEST1#385#1 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#2 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#3 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#4 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#5 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#6 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#7 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#8 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#9 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#10 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#11 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#12 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#13 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#14 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#15 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#16 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#17 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#18 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#19 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#20 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#21 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#385#22 acc=Taj1E4D3Z3Y02HVJG6 len=21 def=
AAGCCAAGGATGACTTGCCGG
>LIBTEST1#386#1 acc=Taj1E4D3Z3Y02G6CH7 len=24 def=
CTGAGACACGCAACAGGGGATAGA
>LIBTEST1#386#2 acc=Taj1E4D3Z3Y02G6CH7 len=24 def=
CTGAGACACGCAACAGGGGATAGA
>LIBTEST1#387#1 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#2 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#3 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#4 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#5 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#6 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#7 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#8 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#9 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#10 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#11 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#12 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#13 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#14 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#15 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#16 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#17 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#18 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#19 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#20 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#21 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#387#22 acc=Taj1E4D3Z3Y02F2HGW len=22 def=
AAGCCTGGTCTAGTACTTTCTT
>LIBTEST1#388#1 acc=Taj1E4D3Z3Y02J4BFV len=14 def=
CTTAGCGTCTGATA
>LIBTEST1#389#1 acc=Taj1E4D3Z3Y02J3SXY len=21 def=
CTACTCCTGTGCGTGTCTCAG
>LIBTEST1#390#1 acc=Taj1E4D3Z3Y02GD427 len=16 def=
ACGCCTACGTATCGTG
>LIBTEST1#391#1 acc=Taj1E4D3Z3Y02J3Y3N len=18 def=
TGATAGTAGCGTCTGATA
>LIBTEST1#392#1 acc=Taj1E4D3Z3Y02GQZJK len=21 def=
TGGACTGAAGGGAGCTCCTTC
>LIBTEST1#392#2 acc=Taj1E4D3Z3Y02GQZJK len=21 def=
TGGACTGAAGGGAGCTCCTTC
>LIBTEST1#392#3 acc=Taj1E4D3Z3Y02GQZJK len=21 def=
TGGACTGAAGGGAGCTCCTTC
>LIBTEST1#392#4 acc=Taj1E4D3Z3Y02GQZJK len=21 def=
TGGACTGAAGGGAGCTCCTTC
>LIBTEST1#392#5 acc=Taj1E4D3Z3Y02GQZJK len=21 def=
TGGACTGAAGGGAGCTCCTTC
>LIBTEST1#392#6 acc=Taj1E4D3Z3Y02GQZJK len=21 def=
TGGACTGAAGGGAGCTCCTTC
>LIBTEST1#392#7 acc=Taj1E4D3Z3Y02GQZJK len=21 def=
TGGACTGAAGGGAGCTCCTTC
>LIBTEST1#392#8 acc=Taj1E4D3Z3Y02GQZJK len=21 def=
TGGACTGAAGGGAGCTCCTTC
>LIBTEST1#392#9 acc=Taj1E4D3Z3Y02GQZJK len=21 def=
TGGACTGAAGGGAGCTCCTTC
>LIBTEST1#393#1 acc=Taj1E4D3Z3Y02GRJVF len=22 def=
ATAATGCTAACTTGTACCCTCT
>LIBTEST1#394#1 acc=Taj1E4D3Z3Y02IR0SS len=22 def=
GGGGGAAGCCCGTCTGATGATA
>LIBTEST1#395#1 acc=Taj1E4D3Z3Y02IE6CV len=13 def=
TCCTGATCTGATA
>LIBTEST1#395#2 acc=Taj1E4D3Z3Y02IE6CV len=13 def=
TCCTGATCTGATA
>LIBTEST1#396#1 acc=Taj1E4D3Z3Y02HK5RC len=17 def=
GCCGATTTGGACTCGTG
>LIBTEST1#397#1 acc=Taj1E4D3Z3Y02GNMUA len=23 def=
TACGGTCCCTGGAATAACTTGTA
>LIBTEST1#398#1 acc=Taj1E4D3Z3Y02HRR5N len=13 def=
CGTAGCGTTGATA
>LIBTEST1#398#2 acc=Taj1E4D3Z3Y02HRR5N len=13 def=
CGTAGCGTTGATA
>LIBTEST1#398#3 acc=Taj1E4D3Z3Y02HRR5N len=13 def=
CGTAGCGTTGATA
>LIBTEST1#398#4 acc=Taj1E4D3Z3Y02HRR5N len=13 def=
CGTAGCGTTGATA
>LIBTEST1#398#5 acc=Taj1E4D3Z3Y02HRR5N len=13 def=
CGTAGCGTTGATA
>LIBTEST1#399#1 acc=Taj1E4D3Z3Y02G7JZU len=26 def=
GCATCAGGCTCCTGGAGCGCCTGCCC
>LIBTEST1#400#1 acc=Taj1E4D3Z3Y02FZ4CG len=22 def=
TGCAAATGGTTTGGTTACGGTG
>LIBTEST1#401#1 acc=Taj1E4D3Z3Y02F1M8Q len=29 def=
GCCTTGCCTATCCCCTGTTGCGTGTCTCA
>LIBTEST1#402#1 acc=Taj1E4D3Z3Y02F7T6I len=21 def=
TCTAGGAACAAACTCACAACA
>LIBTEST1#403#1 acc=Taj1E4D3Z3Y02F3DK2 len=18 def=
CTGATAGATTGAAATCTC
>LIBTEST1#404#1 acc=Taj1E4D3Z3Y02IIJ5C len=24 def=
AAGATGGCTCATAGTGTTGGGAAT
>LIBTEST1#404#2 acc=Taj1E4D3Z3Y02IIJ5C len=24 def=
AAGATGGCTCATAGTGTTGGGAAT
>LIBTEST1#405#1 acc=Taj1E4D3Z3Y02FV1HY len=21 def=
AATGGGCGGTGAGATTGTTCC
>LIBTEST1#406#1 acc=Taj1E4D3Z3Y02I3I35 len=20 def=
ATTGATCGTGCTACTATCTG
>LIBTEST1#407#1 acc=Taj1E4D3Z3Y02HKK0V len=20 def=
TTATATGTTGGATTGATGTC
>LIBTEST1#408#1 acc=Taj1E4D3Z3Y02GF26G len=20 def=
ACTTGGTCGTCCTACACTCT
>LIBTEST1#409#1 acc=Taj1E4D3Z3Y02G0C7H len=16 def=
TAGCTCCTGATAATTG
>LIBTEST1#410#1 acc=Taj1E4D3Z3Y02FQY5A len=21 def=
TAACTCATCTAGATTGATTTA
>LIBTEST1#411#1 acc=Taj1E4D3Z3Y02JPRQU len=21 def=
TGTTTGGATTGATGTCTTTCA
>LIBTEST1#411#2 acc=Taj1E4D3Z3Y02JPRQU len=21 def=
TGTTTGGATTGATGTCTTTCA
>LIBTEST1#412#1 acc=Taj1E4D3Z3Y02GMSEF len=24 def=
ATTGATGGTCGCCTACAACTTCTG
>LIBTEST1#412#2 acc=Taj1E4D3Z3Y02GMSEF len=24 def=
ATTGATGGTCGCCTACAACTTCTG
>LIBTEST1#412#3 acc=Taj1E4D3Z3Y02GMSEF len=24 def=
ATTGATGGTCGCCTACAACTTCTG
>LIBTEST1#412#4 acc=Taj1E4D3Z3Y02GMSEF len=24 def=
ATTGATGGTCGCCTACAACTTCTG
>LIBTEST1#412#5 acc=Taj1E4D3Z3Y02GMSEF len=24 def=
ATTGATGGTCGCCTACAACTTCTG
>LIBTEST1#413#1 acc=Taj1E4D3Z3Y02IG662 len=28 def=
CTGAGACACGCAACAGGGGATAGGAAGG
>LIBTEST1#413#2 acc=Taj1E4D3Z3Y02IG662 len=28 def=
CTGAGACACGCAACAGGGGATAGGAAGG
>LIBTEST1#413#3 acc=Taj1E4D3Z3Y02IG662 len=28 def=
CTGAGACACGCAACAGGGGATAGGAAGG
>LIBTEST1#413#4 acc=Taj1E4D3Z3Y02IG662 len=28 def=
CTGAGACACGCAACAGGGGATAGGAAGG
>LIBTEST1#414#1 acc=Taj1E4D3Z3Y02H2UBR len=23 def=
TTCGTGCCCCACGGTGGGCGCCA
>LIBTEST1#415#1 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#2 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#3 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#4 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#5 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#6 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#7 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#8 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#9 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#10 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#11 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#12 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#13 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#14 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#15 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#16 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#17 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#18 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#19 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#20 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#21 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#22 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#23 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#24 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#25 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#26 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#27 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#28 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#29 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#30 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#31 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#32 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#33 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#34 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#35 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#36 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#37 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#38 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#39 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#40 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#41 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#42 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#43 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#44 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#45 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#46 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#47 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#48 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#49 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#50 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#51 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#52 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#53 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#54 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#55 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#56 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#57 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#58 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#59 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#60 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#61 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#62 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#63 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#64 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#65 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#66 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#67 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#68 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#69 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#70 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#71 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#72 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#73 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#74 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#75 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#76 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#77 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#78 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#79 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#80 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#81 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#82 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#83 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#84 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#85 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#86 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#87 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#88 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#89 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#90 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#91 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#92 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#93 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#94 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#95 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#96 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#97 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#98 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#99 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#100 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#101 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#102 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#103 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#104 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#105 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#106 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#107 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#108 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#109 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#110 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#111 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#112 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#113 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#114 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#115 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#116 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#117 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#118 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#119 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#120 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#121 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#122 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#123 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#124 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#125 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#126 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#415#127 acc=Taj1E4D3Z3Y02G112E len=13 def=
CCTGATACTGATA
>LIBTEST1#416#1 acc=Taj1E4D3Z3Y02JRUD5 len=24 def=
CTGAGACACGCAACAGGGGATAGG
>LIBTEST1#416#2 acc=Taj1E4D3Z3Y02JRUD5 len=24 def=
CTGAGACACGCAACAGGGGATAGG
>LIBTEST1#417#1 acc=Taj1E4D3Z3Y02I60NW len=24 def=
ACTTTCAGGGTTTGTATGAACGGT
>LIBTEST1#418#1 acc=Taj1E4D3Z3Y02IXUJP len=26 def=
CTGAGACACGCAACAGGGGATAGGAA
>LIBTEST1#418#2 acc=Taj1E4D3Z3Y02IXUJP len=26 def=
CTGAGACACGCAACAGGGGATAGGAA
>LIBTEST1#418#3 acc=Taj1E4D3Z3Y02IXUJP len=26 def=
CTGAGACACGCAACAGGGGATAGGAA
>LIBTEST1#418#4 acc=Taj1E4D3Z3Y02IXUJP len=26 def=
CTGAGACACGCAACAGGGGATAGGAA
>LIBTEST1#419#1 acc=Taj1E4D3Z3Y02F9KYH len=13 def=
GTCGTCCTGGATA
>LIBTEST1#420#1 acc=Taj1E4D3Z3Y02GPMRI len=26 def=
ATTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#421#1 acc=Taj1E4D3Z3Y02GZG6C len=14 def=
TAGCGTCCTAGATA
>LIBTEST1#421#2 acc=Taj1E4D3Z3Y02GZG6C len=14 def=
TAGCGTCCTAGATA
>LIBTEST1#422#1 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#2 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#3 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#4 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#5 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#6 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#7 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#8 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#9 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#10 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#11 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#12 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#13 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#14 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#15 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#16 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#17 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#18 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#19 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#20 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#21 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#22 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#23 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#24 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#25 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#26 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#27 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#28 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#29 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#422#30 acc=Taj1E4D3Z3Y02GQYI4 len=13 def=
CGGCGGTCGCTTA
>LIBTEST1#423#1 acc=Taj1E4D3Z3Y02FN09E len=30 def=
CTGAGACACGCAACAGGGGATAGGCAAGGC
>LIBTEST1#423#2 acc=Taj1E4D3Z3Y02FN09E len=30 def=
CTGAGACACGCAACAGGGGATAGGCAAGGC
>LIBTEST1#423#3 acc=Taj1E4D3Z3Y02FN09E len=30 def=
CTGAGACACGCAACAGGGGATAGGCAAGGC
>LIBTEST1#423#4 acc=Taj1E4D3Z3Y02FN09E len=30 def=
CTGAGACACGCAACAGGGGATAGGCAAGGC
>LIBTEST1#423#5 acc=Taj1E4D3Z3Y02FN09E len=30 def=
CTGAGACACGCAACAGGGGATAGGCAAGGC
>LIBTEST1#424#1 acc=Taj1E4D3Z3Y02IVUDY len=15 def=
GCGGCGGACCGGCCA
>LIBTEST1#425#1 acc=Taj1E4D3Z3Y02I3PBU len=21 def=
CATTCGTCCAGTTTACATAAC
>LIBTEST1#426#1 acc=Taj1E4D3Z3Y02GCY69 len=21 def=
TTAACGGTGATGTCCAGCAGG
>LIBTEST1#426#2 acc=Taj1E4D3Z3Y02GCY69 len=21 def=
TTAACGGTGATGTCCAGCAGG
>LIBTEST1#426#3 acc=Taj1E4D3Z3Y02GCY69 len=21 def=
TTAACGGTGATGTCCAGCAGG
>LIBTEST1#427#1 acc=Taj1E4D3Z3Y02JCP7X len=21 def=
GAGTCACATGGTCGGTATCCC
>LIBTEST1#428#1 acc=Taj1E4D3Z3Y02JSD3G len=27 def=
GATGATGGGGAAGGGGTTCGACTCCCC
>LIBTEST1#429#1 acc=Taj1E4D3Z3Y02G6KQL len=23 def=
TGAGACACGCAAAGGGAGTAGGC
>LIBTEST1#430#1 acc=Taj1E4D3Z3Y02GDH53 len=21 def=
TTAATCTAGGAAATACGGTGG
>LIBTEST1#430#2 acc=Taj1E4D3Z3Y02GDH53 len=21 def=
TTAATCTAGGAAATACGGTGG
>LIBTEST1#431#1 acc=Taj1E4D3Z3Y02F9W0J len=17 def=
ACGTCTACCGGATGTGC
>LIBTEST1#432#1 acc=Taj1E4D3Z3Y02HM3R3 len=21 def=
CGGGTCCCACTGGGCGTGCCA
>LIBTEST1#433#1 acc=Taj1E4D3Z3Y02F0CSQ len=24 def=
GTGAAAGTAGGTCATCGTCAGGCT
>LIBTEST1#433#2 acc=Taj1E4D3Z3Y02F0CSQ len=24 def=
GTGAAAGTAGGTCATCGTCAGGCT
>LIBTEST1#434#1 acc=Taj1E4D3Z3Y02GTNRV len=23 def=
TTGACTGGTTGCCTACACCTCTG
>LIBTEST1#435#1 acc=Taj1E4D3Z3Y02F7GXF len=29 def=
GCCCTTGTCGCTTCGATTCGTATTGATGG
>LIBTEST1#436#1 acc=Taj1E4D3Z3Y02FNP8M len=23 def=
TAGGCCGTTTTCTAGGTCTGGTC
>LIBTEST1#437#1 acc=Taj1E4D3Z3Y02JHADX len=15 def=
CACCACTTGACCTGT
>LIBTEST1#438#1 acc=Taj1E4D3Z3Y02F0QAO len=15 def=
ATTCGATGGTAGTCC
>LIBTEST1#439#1 acc=Taj1E4D3Z3Y02GT3NJ len=16 def=
TCCTGATAGTAGCGTC
>LIBTEST1#439#2 acc=Taj1E4D3Z3Y02GT3NJ len=16 def=
TCCTGATAGTAGCGTC
>LIBTEST1#439#3 acc=Taj1E4D3Z3Y02GT3NJ len=16 def=
TCCTGATAGTAGCGTC
>LIBTEST1#440#1 acc=Taj1E4D3Z3Y02HL7VG len=21 def=
TCTGACTACTGAATAATTGAT
>LIBTEST1#441#1 acc=Taj1E4D3Z3Y02F8S5Q len=22 def=
AATGGTGCAACTTGTTGTCAGT
>LIBTEST1#442#1 acc=Taj1E4D3Z3Y02F3YCK len=22 def=
GATAATTGATTGGTGCCGTACA
>LIBTEST1#443#1 acc=Taj1E4D3Z3Y02IVBAJ len=13 def=
ATAATTGAGTGGT
>LIBTEST1#444#1 acc=Taj1E4D3Z3Y02H94NS len=18 def=
ATCAGCTTGAGGGATAGA
>LIBTEST1#445#1 acc=Taj1E4D3Z3Y02FYQ89 len=22 def=
GGAGTGACTTGTCGGACACTTT
>LIBTEST1#446#1 acc=Taj1E4D3Z3Y02HL2FJ len=24 def=
CCCTGATGAGTAGGAGGGCTTTGG
>LIBTEST1#446#2 acc=Taj1E4D3Z3Y02HL2FJ len=24 def=
CCCTGATGAGTAGGAGGGCTTTGG
>LIBTEST1#447#1 acc=Taj1E4D3Z3Y02JUSYA len=17 def=
ACCATCAATTATCAGGA
>LIBTEST1#448#1 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#2 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#3 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#4 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#5 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#6 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#7 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#8 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#9 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#10 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#11 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#12 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#13 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#14 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#15 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#16 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#17 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#18 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#19 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#20 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#21 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#22 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#23 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#24 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#25 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#26 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#27 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#28 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#29 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#448#30 acc=Taj1E4D3Z3Y02GFT4Y len=15 def=
TCCTGATACCTGATA
>LIBTEST1#449#1 acc=Taj1E4D3Z3Y02JV6IL len=14 def=
ATTGATGGTCCTAC
>LIBTEST1#449#2 acc=Taj1E4D3Z3Y02JV6IL len=14 def=
ATTGATGGTCCTAC
>LIBTEST1#450#1 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#2 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#3 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#4 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#5 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#6 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#7 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#8 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#9 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#10 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#11 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#12 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#450#13 acc=Taj1E4D3Z3Y02IN346 len=21 def=
TGAAGCTGCCAGCATGATCTG
>LIBTEST1#451#1 acc=Taj1E4D3Z3Y02GMM3N len=14 def=
CTGATAATTGATGG
>LIBTEST1#451#2 acc=Taj1E4D3Z3Y02GMM3N len=14 def=
CTGATAATTGATGG
>LIBTEST1#451#3 acc=Taj1E4D3Z3Y02GMM3N len=14 def=
CTGATAATTGATGG
>LIBTEST1#451#4 acc=Taj1E4D3Z3Y02GMM3N len=14 def=
CTGATAATTGATGG
>LIBTEST1#451#5 acc=Taj1E4D3Z3Y02GMM3N len=14 def=
CTGATAATTGATGG
>LIBTEST1#452#1 acc=Taj1E4D3Z3Y02H6NVH len=24 def=
AACTCCACTATCAACTGAACTATG
>LIBTEST1#453#1 acc=Taj1E4D3Z3Y02GBHX2 len=19 def=
TTTGGATTGAAGGGAGCTA
>LIBTEST1#453#2 acc=Taj1E4D3Z3Y02GBHX2 len=19 def=
TTTGGATTGAAGGGAGCTA
>LIBTEST1#454#1 acc=Taj1E4D3Z3Y02GBB2Q len=25 def=
ATATGACGTACAAGTTCGTCACCAT
>LIBTEST1#455#1 acc=Taj1E4D3Z3Y02GMRLI len=16 def=
CGATAATTAGTATGGT
>LIBTEST1#455#2 acc=Taj1E4D3Z3Y02GMRLI len=16 def=
CGATAATTAGTATGGT
>LIBTEST1#456#1 acc=Taj1E4D3Z3Y02GVRWA len=28 def=
TTGGACTGAAGGGAGCTCCCATTGATGG
>LIBTEST1#456#2 acc=Taj1E4D3Z3Y02GVRWA len=28 def=
TTGGACTGAAGGGAGCTCCCATTGATGG
>LIBTEST1#456#3 acc=Taj1E4D3Z3Y02GVRWA len=28 def=
TTGGACTGAAGGGAGCTCCCATTGATGG
>LIBTEST1#457#1 acc=Taj1E4D3Z3Y02IX77B len=20 def=
TCCATTGATGGTCGCCTACA
>LIBTEST1#458#1 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#2 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#3 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#4 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#5 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#6 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#7 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#8 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#9 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#10 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#11 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#12 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#13 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#14 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#15 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#16 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#17 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#18 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#19 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#20 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#21 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#22 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#23 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#24 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#25 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#26 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#27 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#28 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#29 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#30 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#31 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#32 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#33 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#34 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#35 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#36 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#37 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#38 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#39 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#40 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#41 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#42 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#43 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#44 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#45 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#46 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#47 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#48 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#458#49 acc=Taj1E4D3Z3Y02F01RE len=13 def=
GTAGGTCCTGATA
>LIBTEST1#459#1 acc=Taj1E4D3Z3Y02GDZRN len=29 def=
CTGAGACACGCAACAGGGGGAGTCGAGAG
>LIBTEST1#460#1 acc=Taj1E4D3Z3Y02F3HLR len=25 def=
CTGAGACACGCAACAGGGGATAGGC
>LIBTEST1#460#2 acc=Taj1E4D3Z3Y02F3HLR len=25 def=
CTGAGACACGCAACAGGGGATAGGC
>LIBTEST1#461#1 acc=Taj1E4D3Z3Y02GA389 len=24 def=
ATTGATCGTGCTAACTACTCTGTG
>LIBTEST1#462#1 acc=Taj1E4D3Z3Y02GGGRR len=23 def=
GCGCGCGACCTATACCCGGCATA
>LIBTEST1#463#1 acc=Taj1E4D3Z3Y02H7FVE len=19 def=
CTTGGATTAGGCGTATCCC
>LIBTEST1#463#2 acc=Taj1E4D3Z3Y02H7FVE len=19 def=
CTTGGATTAGGCGTATCCC
>LIBTEST1#463#3 acc=Taj1E4D3Z3Y02H7FVE len=19 def=
CTTGGATTAGGCGTATCCC
>LIBTEST1#464#1 acc=Taj1E4D3Z3Y02IZ102 len=14 def=
TCCTGATAGTCCTG
>LIBTEST1#465#1 acc=Taj1E4D3Z3Y02JPRUO len=14 def=
GCCGACCGCTGATA
>LIBTEST1#466#1 acc=>Taj1E4D3Z3Y02JWCQ2 len=23 def=
ATTTCAGTCTACTTCACATGTGC
>LIBTEST1#466#2 acc=>Taj1E4D3Z3Y02JWCQ2 len=23 def=
ATTTCAGTCTACTTCACATGTGC
>LIBTEST1#467#1 acc=Taj1E4D3Z3Y02GWHF9 len=21 def=
CCTGATAAATTAATGTTAACC
>LIBTEST1#467#2 acc=Taj1E4D3Z3Y02GWHF9 len=21 def=
CCTGATAAATTAATGTTAACC
>LIBTEST1#467#3 acc=Taj1E4D3Z3Y02GWHF9 len=21 def=
CCTGATAAATTAATGTTAACC
>LIBTEST1#468#1 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#2 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#3 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#4 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#5 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#6 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#7 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#8 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#9 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#10 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#11 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#12 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#13 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#14 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#15 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#16 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#17 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#18 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#19 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#20 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#21 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#468#22 acc=Taj1E4D3Z3Y02HUY56 len=14 def=
CTGATATCCTGATA
>LIBTEST1#469#1 acc=Taj1E4D3Z3Y02G4022 len=21 def=
TCCGTTTACAATAAAGTTGGT
>LIBTEST1#470#1 acc=Taj1E4D3Z3Y02F3LA1 len=29 def=
CCTTGCCTATCTCCTGTTGCGTGTCTCAG
>LIBTEST1#470#2 acc=Taj1E4D3Z3Y02F3LA1 len=29 def=
CCTTGCCTATCTCCTGTTGCGTGTCTCAG
>LIBTEST1#470#3 acc=Taj1E4D3Z3Y02F3LA1 len=29 def=
CCTTGCCTATCTCCTGTTGCGTGTCTCAG
>LIBTEST1#471#1 acc=Taj1E4D3Z3Y02JVDM8 len=16 def=
CGTTAGCGTCCGTGAT
>LIBTEST1#472#1 acc=Taj1E4D3Z3Y02IWJKR len=24 def=
AGTGCCGACATGAATTGTCAACTC
>LIBTEST1#473#1 acc=Taj1E4D3Z3Y02FQSRP len=13 def=
ATAGTCCTGATAA
>LIBTEST1#474#1 acc=Taj1E4D3Z3Y02H9KU7 len=24 def=
GATAGCAAAGAAGAATTCTTGTGT
>LIBTEST1#475#1 acc=Taj1E4D3Z3Y02IMQ0I len=17 def=
CGGCGGTCGCAGATTGA
>LIBTEST1#476#1 acc=Taj1E4D3Z3Y02GBK8K len=15 def=
TAGCGTCCCTGACTA
>LIBTEST1#476#2 acc=Taj1E4D3Z3Y02GBK8K len=15 def=
TAGCGTCCCTGACTA
>LIBTEST1#476#3 acc=Taj1E4D3Z3Y02GBK8K len=15 def=
TAGCGTCCCTGACTA
>LIBTEST1#476#4 acc=Taj1E4D3Z3Y02GBK8K len=15 def=
TAGCGTCCCTGACTA
>LIBTEST1#476#5 acc=Taj1E4D3Z3Y02GBK8K len=15 def=
TAGCGTCCCTGACTA
>LIBTEST1#476#6 acc=Taj1E4D3Z3Y02GBK8K len=15 def=
TAGCGTCCCTGACTA
>LIBTEST1#477#1 acc=Taj1E4D3Z3Y02HNNNK len=16 def=
ATATTTTTAATCAGTT
>LIBTEST1#478#1 acc=Taj1E4D3Z3Y02I4QT9 len=21 def=
ATGAGTTTCATCAAATCATGT
>LIBTEST1#478#2 acc=Taj1E4D3Z3Y02I4QT9 len=21 def=
ATGAGTTTCATCAAATCATGT
>LIBTEST1#479#1 acc=Taj1E4D3Z3Y02GF6RN len=21 def=
TAGGGGCAGCGGTCCTTTTTT
>LIBTEST1#480#1 acc=Taj1E4D3Z3Y02JHR18 len=26 def=
CCTGATACCGGCGATGCGCTCCTGGC
>LIBTEST1#481#1 acc=Taj1E4D3Z3Y02IEZB8 len=22 def=
CTGAGACACGCAACAGGGGTAG
>LIBTEST1#482#1 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#2 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#3 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#4 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#5 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#6 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#7 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#8 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#9 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#10 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#11 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#12 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#13 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#14 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#15 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#16 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#17 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#18 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#19 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#20 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#21 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#22 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#23 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#24 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#25 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#26 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#27 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#28 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#29 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#30 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#31 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#32 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#33 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#34 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#35 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#36 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#37 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#38 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#39 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#40 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#41 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#42 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#43 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#44 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#45 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#46 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#47 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#48 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#49 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#50 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#51 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#52 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#53 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#54 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#55 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#56 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#57 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#58 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#59 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#60 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#61 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#62 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#63 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#64 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#65 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#66 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#67 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#68 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#69 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#70 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#71 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#72 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#73 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#74 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#75 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#482#76 acc=Taj1E4D3Z3Y02GIHHO len=16 def=
GTAGCGTCCGTGACTA
>LIBTEST1#483#1 acc=Taj1E4D3Z3Y02GGIRL len=20 def=
ATTGAGTGGACGCCTACACT
>LIBTEST1#484#1 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#2 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#3 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#4 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#5 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#6 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#7 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#8 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#9 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#10 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#11 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#12 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#13 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#14 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#15 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#16 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#17 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#18 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#19 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#20 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#21 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#22 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#23 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#24 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#25 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#26 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#27 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#28 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#29 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#30 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#31 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#32 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#33 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#34 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#35 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#36 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#37 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#38 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#39 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#40 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#41 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#42 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#43 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#44 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#45 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#46 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#47 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#48 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#49 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#50 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#51 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#52 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#53 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#54 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#55 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#56 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#57 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#58 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#59 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#60 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#61 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#62 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#63 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#64 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#65 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#66 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#67 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#68 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#69 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#70 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#71 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#72 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#73 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#74 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#75 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#76 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#77 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#78 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#79 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#80 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#81 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#82 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#83 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#84 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#85 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#86 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#87 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#88 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#89 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#90 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#91 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#92 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#93 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#94 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#95 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#96 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#97 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#98 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#484#99 acc=Taj1E4D3Z3Y02GOKY0 len=14 def=
TCCTGATACTGATA
>LIBTEST1#485#1 acc=Taj1E4D3Z3Y02H16VA len=14 def=
ATTGTATGGTGGCC
>LIBTEST1#486#1 acc=Taj1E4D3Z3Y02HPCP0 len=24 def=
TTCGATACTTGGATGTTAGTATGT
>LIBTEST1#487#1 acc=Taj1E4D3Z3Y02GI7QG len=17 def=
CTATTACTTGTGTGACT
>LIBTEST1#488#1 acc=Taj1E4D3Z3Y02F9BJF len=15 def=
ACAATGATGCTTAGC
>LIBTEST1#489#1 acc=Taj1E4D3Z3Y02GWPQL len=24 def=
GTTGATGCATATGATGCTCTGCCT
>LIBTEST1#490#1 acc=Taj1E4D3Z3Y02GPCBZ len=24 def=
AAAGCAGCATCTCTGTATCTGGTC
>LIBTEST1#490#2 acc=Taj1E4D3Z3Y02GPCBZ len=24 def=
AAAGCAGCATCTCTGTATCTGGTC
>LIBTEST1#490#3 acc=Taj1E4D3Z3Y02GPCBZ len=24 def=
AAAGCAGCATCTCTGTATCTGGTC
>LIBTEST1#491#1 acc=Taj1E4D3Z3Y02IZX7V len=15 def=
TTTAGATTGATGGTG
>LIBTEST1#492#1 acc=Taj1E4D3Z3Y02HJB5Y len=16 def=
TAGCGTCCGATAGATA
>LIBTEST1#492#2 acc=Taj1E4D3Z3Y02HJB5Y len=16 def=
TAGCGTCCGATAGATA
>LIBTEST1#492#3 acc=Taj1E4D3Z3Y02HJB5Y len=16 def=
TAGCGTCCGATAGATA
>LIBTEST1#493#1 acc=Taj1E4D3Z3Y02F8R9Z len=16 def=
GGCCCGGGTAAGCGTC
>LIBTEST1#494#1 acc=Taj1E4D3Z3Y02HX47O len=13 def=
CGGGAGTAATGAC
>LIBTEST1#495#1 acc=Taj1E4D3Z3Y02IY12B len=15 def=
TCCTGATACCTGATG
>LIBTEST1#496#1 acc=Taj1E4D3Z3Y02H7W3M len=21 def=
CGTTACCCTGCATCTCCACCA
>LIBTEST1#497#1 acc=Taj1E4D3Z3Y02H5IPR len=24 def=
GGTGCGTGAAGAAGTAGGTGACCC
>LIBTEST1#498#1 acc=Taj1E4D3Z3Y02GC99S len=21 def=
TTGAACTGAAGGGAGCTCCCT
>LIBTEST1#499#1 acc=Taj1E4D3Z3Y02FW68B len=24 def=
TTGACGGTTAAAGATGTAATATCC
>LIBTEST1#500#1 acc=Taj1E4D3Z3Y02FW6CE len=14 def=
CGTAACGTCTGATA
>LIBTEST1#501#1 acc=Taj1E4D3Z3Y02GYSVI len=24 def=
CAAACTCTCACTGGTTACTCCACC
>LIBTEST1#501#2 acc=Taj1E4D3Z3Y02GYSVI len=24 def=
CAAACTCTCACTGGTTACTCCACC
>LIBTEST1#502#1 acc=Taj1E4D3Z3Y02IKO1G len=17 def=
CCCCACGGTGGGCGCCA
>LIBTEST1#502#2 acc=Taj1E4D3Z3Y02IKO1G len=17 def=
CCCCACGGTGGGCGCCA
>LIBTEST1#502#3 acc=Taj1E4D3Z3Y02IKO1G len=17 def=
CCCCACGGTGGGCGCCA
>LIBTEST1#503#1 acc=Taj1E4D3Z3Y02HIGSP len=22 def=
TTCTGATAGACACCGGCTCTGC
>LIBTEST1#504#1 acc=Taj1E4D3Z3Y02I4TA0 len=26 def=
AGTTAGCGTCCGTGATAATTGATGGT
>LIBTEST1#504#2 acc=Taj1E4D3Z3Y02I4TA0 len=26 def=
AGTTAGCGTCCGTGATAATTGATGGT
>LIBTEST1#504#3 acc=Taj1E4D3Z3Y02I4TA0 len=26 def=
AGTTAGCGTCCGTGATAATTGATGGT
>LIBTEST1#504#4 acc=Taj1E4D3Z3Y02I4TA0 len=26 def=
AGTTAGCGTCCGTGATAATTGATGGT
>LIBTEST1#504#5 acc=Taj1E4D3Z3Y02I4TA0 len=26 def=
AGTTAGCGTCCGTGATAATTGATGGT
>LIBTEST1#505#1 acc=Taj1E4D3Z3Y02FZ9YC len=13 def=
GTCGTCGTCGTCA
>LIBTEST1#506#1 acc=Taj1E4D3Z3Y02G14O5 len=18 def=
GCTCACTCTCTATCTGTC
>LIBTEST1#507#1 acc=Taj1E4D3Z3Y02IZ33M len=24 def=
AGTAGCGGCGCTGATGGTAATGGC
>LIBTEST1#508#1 acc=Taj1E4D3Z3Y02F42S4 len=21 def=
CAGAGTGCAGATACACGCATC
>LIBTEST1#508#2 acc=Taj1E4D3Z3Y02F42S4 len=21 def=
CAGAGTGCAGATACACGCATC
>LIBTEST1#508#3 acc=Taj1E4D3Z3Y02F42S4 len=21 def=
CAGAGTGCAGATACACGCATC
>LIBTEST1#509#1 acc=Taj1E4D3Z3Y02F36D6 len=27 def=
TGATAGTCGCCGGGCACATTGATGGTG
>LIBTEST1#510#1 acc=Taj1E4D3Z3Y02GG9PL len=29 def=
CCTGATAGGGTTGGGTCGATCGATTGATG
>LIBTEST1#511#1 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#511#2 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#511#3 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#511#4 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#511#5 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#511#6 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#511#7 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#511#8 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#511#9 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#511#10 acc=Taj1E4D3Z3Y02JVWFH len=20 def=
TCGGACCAGGCTTCATTCCC
>LIBTEST1#512#1 acc=Taj1E4D3Z3Y02JTAES len=24 def=
AACAATTGTTCATGTGTTACTAAA
>LIBTEST1#513#1 acc=Taj1E4D3Z3Y02HQRIA len=17 def=
CTTGTTTAGGGTAGTTC
>LIBTEST1#513#2 acc=Taj1E4D3Z3Y02HQRIA len=17 def=
CTTGTTTAGGGTAGTTC
>LIBTEST1#514#1 acc=Taj1E4D3Z3Y02FYBC5 len=22 def=
TTTCCACAGCTTTCTTGAACTG
>LIBTEST1#515#1 acc=Taj1E4D3Z3Y02FL5N3 len=16 def=
TTAATCAGGGAAATCA
>LIBTEST1#515#2 acc=Taj1E4D3Z3Y02FL5N3 len=16 def=
TTAATCAGGGAAATCA
>LIBTEST1#516#1 acc=Taj1E4D3Z3Y02GV76Q len=20 def=
CCTGATACCCGGTCGTACTC
>LIBTEST1#517#1 acc=Taj1E4D3Z3Y02JFUDJ len=19 def=
ACCGAAGCTGCGGATGCAT
>LIBTEST1#517#2 acc=Taj1E4D3Z3Y02JFUDJ len=19 def=
ACCGAAGCTGCGGATGCAT
>LIBTEST1#518#1 acc=Taj1E4D3Z3Y02HL1E2 len=13 def=
TCGTACGTCCTGA
>LIBTEST1#519#1 acc=Taj1E4D3Z3Y02JPLIB len=18 def=
CTTAAATTTTTCATTGTC
>LIBTEST1#520#1 acc=Taj1E4D3Z3Y02I1G7A len=22 def=
TCGAACCAGGCTTCATTCCCCA
>LIBTEST1#521#1 acc=Taj1E4D3Z3Y02G7D8Y len=29 def=
CCTGATAGCTAGAAGCGATGCGTGTGCCC
>LIBTEST1#522#1 acc=Taj1E4D3Z3Y02H39T0 len=16 def=
AAGTGATGTGAGCTTG
>LIBTEST1#523#1 acc=Taj1E4D3Z3Y02G2JHZ len=21 def=
CTAGATTGTAGTTTCCTGAGT
>LIBTEST1#524#1 acc=Taj1E4D3Z3Y02JSOBP len=24 def=
TGATAGTGTCCTGAATTGATGGTG
>LIBTEST1#525#1 acc=Taj1E4D3Z3Y02GPG45 len=16 def=
CCTGATATTGCCGCTG
>LIBTEST1#526#1 acc=Taj1E4D3Z3Y02GFGMG len=17 def=
TTAAGTGCAGATGCTCT
>LIBTEST1#526#2 acc=Taj1E4D3Z3Y02GFGMG len=17 def=
TTAAGTGCAGATGCTCT
>LIBTEST1#526#3 acc=Taj1E4D3Z3Y02GFGMG len=17 def=
TTAAGTGCAGATGCTCT
>LIBTEST1#527#1 acc=Taj1E4D3Z3Y02HYLYX len=25 def=
AGCAAAAGAAAGGATGCAGATGGAA
>LIBTEST1#528#1 acc=Taj1E4D3Z3Y02FS5CC len=24 def=
CGGTTCTGTGCGTGTGTGTTGTGT
>LIBTEST1#529#1 acc=Taj1E4D3Z3Y02HQSRV len=24 def=
ATTTGTATCATCATATAAACGACT
>LIBTEST1#530#1 acc=Taj1E4D3Z3Y02FYCK3 len=24 def=
AGACATTTACACTAAATACGTCGA
>LIBTEST1#531#1 acc=Taj1E4D3Z3Y02FXPIW len=20 def=
GCGAAAGTGAAATACACTCT
>LIBTEST1#532#1 acc=Taj1E4D3Z3Y02FYMKM len=21 def=
ATGACCAATCTCACTGCTCAC
>LIBTEST1#533#1 acc=Taj1E4D3Z3Y02J31IV len=21 def=
CACCTCTAACCACTCGTACAC
>LIBTEST1#534#1 acc=Taj1E4D3Z3Y02FUCVC len=29 def=
CTGAGACACGCAACAGGGGATAGGCAAGG
>LIBTEST1#534#2 acc=Taj1E4D3Z3Y02FUCVC len=29 def=
CTGAGACACGCAACAGGGGATAGGCAAGG
>LIBTEST1#534#3 acc=Taj1E4D3Z3Y02FUCVC len=29 def=
CTGAGACACGCAACAGGGGATAGGCAAGG
>LIBTEST1#534#4 acc=Taj1E4D3Z3Y02FUCVC len=29 def=
CTGAGACACGCAACAGGGGATAGGCAAGG
>LIBTEST1#534#5 acc=Taj1E4D3Z3Y02FUCVC len=29 def=
CTGAGACACGCAACAGGGGATAGGCAAGG
>LIBTEST1#534#6 acc=Taj1E4D3Z3Y02FUCVC len=29 def=
CTGAGACACGCAACAGGGGATAGGCAAGG
>LIBTEST1#534#7 acc=Taj1E4D3Z3Y02FUCVC len=29 def=
CTGAGACACGCAACAGGGGATAGGCAAGG
>LIBTEST1#535#1 acc=Taj1E4D3Z3Y02HWHF6 len=24 def=
TTTGTGTCGTGTTCGTTATTCGTA
>LIBTEST1#536#1 acc=Taj1E4D3Z3Y02H6NEX len=15 def=
ATATTTTAATCAGTT
>LIBTEST1#537#1 acc=Taj1E4D3Z3Y02HEXEW len=16 def=
GTAGCGTCTCCTGATA
>LIBTEST1#538#1 acc=Taj1E4D3Z3Y02I8ALS len=25 def=
CTTGAAATCCGGAGGACCGAGTGCC
>LIBTEST1#539#1 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#2 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#3 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#4 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#5 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#6 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#7 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#8 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#9 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#10 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#11 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#12 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#13 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#14 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#15 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#16 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#17 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#18 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#19 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#539#20 acc=Taj1E4D3Z3Y02HMUAP len=13 def=
CGTAGCCCTGATA
>LIBTEST1#540#1 acc=Taj1E4D3Z3Y02GLC60 len=24 def=
AAACTCAATTCTATCAAACTCAAT
>LIBTEST1#541#1 acc=Taj1E4D3Z3Y02HCU27 len=16 def=
CCTGATAAGTTAGATC
>LIBTEST1#542#1 acc=Taj1E4D3Z3Y02HLB3B len=19 def=
GTAGGATAGCATATCTTGC
>LIBTEST1#542#2 acc=Taj1E4D3Z3Y02HLB3B len=19 def=
GTAGGATAGCATATCTTGC
>LIBTEST1#542#3 acc=Taj1E4D3Z3Y02HLB3B len=19 def=
GTAGGATAGCATATCTTGC
>LIBTEST1#543#1 acc=Taj1E4D3Z3Y02IYY65 len=14 def=
CGTAGCGGCTGATA
>LIBTEST1#543#2 acc=Taj1E4D3Z3Y02IYY65 len=14 def=
CGTAGCGGCTGATA
>LIBTEST1#543#3 acc=Taj1E4D3Z3Y02IYY65 len=14 def=
CGTAGCGGCTGATA
>LIBTEST1#544#1 acc=Taj1E4D3Z3Y02F8NI9 len=15 def=
GGATATAACTATAGT
>LIBTEST1#545#1 acc=Taj1E4D3Z3Y02GEV24 len=22 def=
CCAGGTCATGATGTGGAACGTT
>LIBTEST1#545#2 acc=Taj1E4D3Z3Y02GEV24 len=22 def=
CCAGGTCATGATGTGGAACGTT
>LIBTEST1#546#1 acc=Taj1E4D3Z3Y02G7LHJ len=21 def=
TTTGTATTGTTGACATGGCTT
>LIBTEST1#546#2 acc=Taj1E4D3Z3Y02G7LHJ len=21 def=
TTTGTATTGTTGACATGGCTT
>LIBTEST1#547#1 acc=Taj1E4D3Z3Y02H046C len=24 def=
ATATCGGACCAGGCTTCATTCCTA
>LIBTEST1#548#1 acc=Taj1E4D3Z3Y02I3LZ7 len=22 def=
AGCTGCTTAGCTATGGATCCCC
>LIBTEST1#548#2 acc=Taj1E4D3Z3Y02I3LZ7 len=22 def=
AGCTGCTTAGCTATGGATCCCC
>LIBTEST1#548#3 acc=Taj1E4D3Z3Y02I3LZ7 len=22 def=
AGCTGCTTAGCTATGGATCCCC
>LIBTEST1#549#1 acc=Taj1E4D3Z3Y02HWRBO len=24 def=
ATGATACACATGCCGATACCAACC
>LIBTEST1#550#1 acc=Taj1E4D3Z3Y02JXZHR len=24 def=
GGAAATAAAAACAAACAGAATCGT
>LIBTEST1#551#1 acc=Taj1E4D3Z3Y02J5K49 len=24 def=
ATGTGGAATTCCTCTTCCATCTTC
>LIBTEST1#552#1 acc=Taj1E4D3Z3Y02G3LBI len=21 def=
CGATTGCATTACATCTCCCGA
>LIBTEST1#553#1 acc=Taj1E4D3Z3Y02HVVUC len=17 def=
TCTCTCAGGCGACGCCA
>LIBTEST1#553#2 acc=Taj1E4D3Z3Y02HVVUC len=17 def=
TCTCTCAGGCGACGCCA
>LIBTEST1#553#3 acc=Taj1E4D3Z3Y02HVVUC len=17 def=
TCTCTCAGGCGACGCCA
>LIBTEST1#554#1 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#2 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#3 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#4 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#5 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#6 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#7 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#8 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#9 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#10 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#11 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#12 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#13 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#14 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#15 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#554#16 acc=Taj1E4D3Z3Y02GO7KC len=21 def=
TCTCGGACCAGGCTTCATTCC
>LIBTEST1#555#1 acc=Taj1E4D3Z3Y02GG0Q3 len=17 def=
TCTCGGTGGGACCTCCA
>LIBTEST1#555#2 acc=Taj1E4D3Z3Y02GG0Q3 len=17 def=
TCTCGGTGGGACCTCCA
>LIBTEST1#556#1 acc=Taj1E4D3Z3Y02HCKEG len=18 def=
TGATAAATTGATTATAGC
>LIBTEST1#557#1 acc=Taj1E4D3Z3Y02FXNPR len=22 def=
TTCAAGGAGTGGTTGTTGGATT
>LIBTEST1#557#2 acc=Taj1E4D3Z3Y02FXNPR len=22 def=
TTCAAGGAGTGGTTGTTGGATT
>LIBTEST1#558#1 acc=Taj1E4D3Z3Y02IDUPA len=14 def=
CCTGATACTCGATA
>LIBTEST1#559#1 acc=Taj1E4D3Z3Y02GPQWQ len=21 def=
CCTATCCCCTGTGTGCCTTGG
>LIBTEST1#560#1 acc=Taj1E4D3Z3Y02FKQV4 len=29 def=
CTGAGACACGCAACAGGGGATAGGAAGGC
>LIBTEST1#561#1 acc=Taj1E4D3Z3Y02GA663 len=20 def=
TCCCCTGTTGCGTGTCTCAG
>LIBTEST1#561#2 acc=Taj1E4D3Z3Y02GA663 len=20 def=
TCCCCTGTTGCGTGTCTCAG
>LIBTEST1#561#3 acc=Taj1E4D3Z3Y02GA663 len=20 def=
TCCCCTGTTGCGTGTCTCAG
>LIBTEST1#561#4 acc=Taj1E4D3Z3Y02GA663 len=20 def=
TCCCCTGTTGCGTGTCTCAG
>LIBTEST1#561#5 acc=Taj1E4D3Z3Y02GA663 len=20 def=
TCCCCTGTTGCGTGTCTCAG
>LIBTEST1#561#6 acc=Taj1E4D3Z3Y02GA663 len=20 def=
TCCCCTGTTGCGTGTCTCAG
>LIBTEST1#561#7 acc=Taj1E4D3Z3Y02GA663 len=20 def=
TCCCCTGTTGCGTGTCTCAG
>LIBTEST1#561#8 acc=Taj1E4D3Z3Y02GA663 len=20 def=
TCCCCTGTTGCGTGTCTCAG
>LIBTEST1#561#9 acc=Taj1E4D3Z3Y02GA663 len=20 def=
TCCCCTGTTGCGTGTCTCAG
>LIBTEST1#562#1 acc=Taj1E4D3Z3Y02F0XXH len=25 def=
GCCTATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#562#2 acc=Taj1E4D3Z3Y02F0XXH len=25 def=
GCCTATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#562#3 acc=Taj1E4D3Z3Y02F0XXH len=25 def=
GCCTATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#562#4 acc=Taj1E4D3Z3Y02F0XXH len=25 def=
GCCTATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#562#5 acc=Taj1E4D3Z3Y02F0XXH len=25 def=
GCCTATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#563#1 acc=Taj1E4D3Z3Y02GDP5A len=20 def=
GACTTAGGAGCCGAGAGAGT
>LIBTEST1#564#1 acc=Taj1E4D3Z3Y02G3CGW len=22 def=
AGAAGCTTTAGTAATGGGATTT
>LIBTEST1#565#1 acc=Taj1E4D3Z3Y02IJG1G len=13 def=
CGTGCCGCTGATA
>LIBTEST1#566#1 acc=Taj1E4D3Z3Y02JHVKV len=18 def=
ACTTAGGAACTGACCTAT
>LIBTEST1#567#1 acc=Taj1E4D3Z3Y02F03BF len=18 def=
GTGGCTAATCTCATGACC
>LIBTEST1#568#1 acc=Taj1E4D3Z3Y02IICG7 len=24 def=
AGGCACTGGATCTTAGAAGACCCC
>LIBTEST1#569#1 acc=Taj1E4D3Z3Y02IZHLN len=15 def=
AAAGACTATGTAACC
>LIBTEST1#570#1 acc=Taj1E4D3Z3Y02J3MGQ len=28 def=
GAGTATTTGTGAGGTATCCAACGACGAG
>LIBTEST1#571#1 acc=Taj1E4D3Z3Y02IP4F5 len=18 def=
TCGGACCAGGCTTCATTC
>LIBTEST1#572#1 acc=Taj1E4D3Z3Y02I1FDR len=14 def=
TCATTGATGGTGAT
>LIBTEST1#573#1 acc=Taj1E4D3Z3Y02HM0DL len=21 def=
TTGTGCTTCACATCCTTCCTT
>LIBTEST1#574#1 acc=Taj1E4D3Z3Y02HF5N6 len=22 def=
TTGCGAGTGAGGTCGTATCACC
>LIBTEST1#575#1 acc=Taj1E4D3Z3Y02F872I len=24 def=
ACGAATATCGAGACCTAACTCATC
>LIBTEST1#576#1 acc=Taj1E4D3Z3Y02IRWG1 len=14 def=
CGTCCGATAGTAGC
>LIBTEST1#577#1 acc=Taj1E4D3Z3Y02H94CQ len=17 def=
AAGACGACACGTGAGAG
>LIBTEST1#578#1 acc=Taj1E4D3Z3Y02GRV4R len=23 def=
ATTGATCGTGCCTAACTACTCTG
>LIBTEST1#579#1 acc=Taj1E4D3Z3Y02G9KXB len=22 def=
TCAGTGTCAGTGTCGGACATCG
>LIBTEST1#580#1 acc=Taj1E4D3Z3Y02HJXZ9 len=24 def=
AAGGCGACGATGCGTAGCCGACCT
>LIBTEST1#581#1 acc=Taj1E4D3Z3Y02J1OSX len=16 def=
ACCGCTACCGATCGTG
>LIBTEST1#582#1 acc=Taj1E4D3Z3Y02IEUE3 len=20 def=
ATAAGTGATGAAGATGAACT
>LIBTEST1#583#1 acc=Taj1E4D3Z3Y02G54PT len=19 def=
CTGATAAATCATGTGGGCT
>LIBTEST1#584#1 acc=Taj1E4D3Z3Y02G9IQW len=30 def=
GACCTCAGGTCAGGCGGGGCTAATTGATGG
>LIBTEST1#585#1 acc=Taj1E4D3Z3Y02F3ZH1 len=17 def=
TGGCCTTCGGAGTCGTC
>LIBTEST1#586#1 acc=Taj1E4D3Z3Y02FNBY5 len=16 def=
TCCTGTCGTGTCTCAG
>LIBTEST1#587#1 acc=Taj1E4D3Z3Y02JB9YX len=20 def=
CGATACTGATACTGACTAAC
>LIBTEST1#588#1 acc=Taj1E4D3Z3Y02JU4RT len=13 def=
TCGATGGAACACT
>LIBTEST1#589#1 acc=Taj1E4D3Z3Y02HB4IK len=20 def=
AAGCATTGTGGCATTGTGAT
>LIBTEST1#590#1 acc=Taj1E4D3Z3Y02IAG32 len=24 def=
TGTGTAAGCTCTAGTCACTATGCT
>LIBTEST1#591#1 acc=Taj1E4D3Z3Y02GYTFI len=14 def=
CGGCAACGGAACCA
>LIBTEST1#592#1 acc=Taj1E4D3Z3Y02HEICM len=17 def=
TCCCGGCAATGGAACCA
>LIBTEST1#593#1 acc=Taj1E4D3Z3Y02IBLTK len=24 def=
TAGTAGTTCATCTAATAATGCTTG
>LIBTEST1#594#1 acc=Taj1E4D3Z3Y02GV2BE len=22 def=
TAGCAGTTGGGTTGTATCCTCC
>LIBTEST1#595#1 acc=Taj1E4D3Z3Y02H995A len=23 def=
TATTGGTCCTGGACGTTTGACCC
>LIBTEST1#596#1 acc=Taj1E4D3Z3Y02HGJ1N len=20 def=
TGTAGCAAAGCTCTATCGTC
>LIBTEST1#597#1 acc=Taj1E4D3Z3Y02J26YN len=25 def=
GTAGCGTCATTGATGGTCGCCTACA
>LIBTEST1#598#1 acc=Taj1E4D3Z3Y02I7G6A len=15 def=
CCTGATAGTCCTGAT
>LIBTEST1#599#1 acc=Taj1E4D3Z3Y02ICWY2 len=22 def=
TGAGCCAAAGATGACTTGCCGG
>LIBTEST1#599#2 acc=Taj1E4D3Z3Y02ICWY2 len=22 def=
TGAGCCAAAGATGACTTGCCGG
>LIBTEST1#600#1 acc=Taj1E4D3Z3Y02HVE5R len=23 def=
CGTAAGTCGTTAGAGATTGATCT
>LIBTEST1#600#2 acc=Taj1E4D3Z3Y02HVE5R len=23 def=
CGTAAGTCGTTAGAGATTGATCT
>LIBTEST1#601#1 acc=Taj1E4D3Z3Y02IVF0J len=21 def=
TAGACATTCCTTCTGCGATAC
>LIBTEST1#602#1 acc=Taj1E4D3Z3Y02IIB4M len=14 def=
CGTCCCGAGACCGA
>LIBTEST1#603#1 acc=Taj1E4D3Z3Y02H5XL1 len=21 def=
TGTATTCAGATCTGTAATTCA
>LIBTEST1#604#1 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#604#2 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#604#3 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#604#4 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#604#5 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#604#6 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#604#7 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#604#8 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#604#9 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#604#10 acc=Taj1E4D3Z3Y02G2HKP len=21 def=
TATGATTTTGGTATTGTTGGT
>LIBTEST1#605#1 acc=>Taj1E4D3Z3Y02G0S5P len=16 def=
TGCTAGGAGGAGGATA
>LIBTEST1#606#1 acc=Taj1E4D3Z3Y02IH2HW len=17 def=
CGACGTGTTGGCAGTTG
>LIBTEST1#607#1 acc=Taj1E4D3Z3Y02HW0W1 len=15 def=
CCTGATACTGATAAC
>LIBTEST1#608#1 acc=Taj1E4D3Z3Y02G9YG4 len=15 def=
ATAACTTGACTGGTC
>LIBTEST1#608#2 acc=Taj1E4D3Z3Y02G9YG4 len=15 def=
ATAACTTGACTGGTC
>LIBTEST1#609#1 acc=Taj1E4D3Z3Y02I5DRT len=29 def=
GCACACTCGTAGACGTTCCTGAGTAATTC
>LIBTEST1#610#1 acc=Taj1E4D3Z3Y02F0TM6 len=21 def=
TCCAATGTAATCTAGGTCTAC
>LIBTEST1#610#2 acc=Taj1E4D3Z3Y02F0TM6 len=21 def=
TCCAATGTAATCTAGGTCTAC
>LIBTEST1#610#3 acc=Taj1E4D3Z3Y02F0TM6 len=21 def=
TCCAATGTAATCTAGGTCTAC
>LIBTEST1#610#4 acc=Taj1E4D3Z3Y02F0TM6 len=21 def=
TCCAATGTAATCTAGGTCTAC
>LIBTEST1#610#5 acc=Taj1E4D3Z3Y02F0TM6 len=21 def=
TCCAATGTAATCTAGGTCTAC
>LIBTEST1#611#1 acc=Taj1E4D3Z3Y02FU6ZE len=22 def=
CACCACCAGAGAGTCCGCACCC
>LIBTEST1#612#1 acc=Taj1E4D3Z3Y02IA3SF len=19 def=
TTAAATATATCATTGGTCT
>LIBTEST1#613#1 acc=Taj1E4D3Z3Y02INBZ2 len=18 def=
AACCTGGTTGATTTTGCC
>LIBTEST1#614#1 acc=Taj1E4D3Z3Y02IZ552 len=20 def=
TGCGTATGCGGAAGCTTCGG
>LIBTEST1#615#1 acc=Taj1E4D3Z3Y02HJGT5 len=22 def=
TTTTAGATGGTCGTTTTATGAT
>LIBTEST1#616#1 acc=Taj1E4D3Z3Y02HV30D len=21 def=
CCTGATAACCCGTTAGGCGCA
>LIBTEST1#616#2 acc=Taj1E4D3Z3Y02HV30D len=21 def=
CCTGATAACCCGTTAGGCGCA
>LIBTEST1#617#1 acc=Taj1E4D3Z3Y02G2FWU len=18 def=
CATTTATATCAGGTCCAT
>LIBTEST1#618#1 acc=Taj1E4D3Z3Y02IVL5T len=23 def=
TTCGATCCTCGCCGGGGGCTCCC
>LIBTEST1#619#1 acc=Taj1E4D3Z3Y02FIJ8H len=18 def=
CTGAGACACGCAACAGGG
>LIBTEST1#619#2 acc=Taj1E4D3Z3Y02FIJ8H len=18 def=
CTGAGACACGCAACAGGG
>LIBTEST1#620#1 acc=Taj1E4D3Z3Y02HMN5D len=24 def=
CGGAGGCAACAGTTAGCATTTCCC
>LIBTEST1#621#1 acc=Taj1E4D3Z3Y02II7TQ len=24 def=
GGTCACTAGCTTTTGGACACACCA
>LIBTEST1#622#1 acc=Taj1E4D3Z3Y02HBYAL len=16 def=
CGGTGGTTCCTCACGA
>LIBTEST1#623#1 acc=Taj1E4D3Z3Y02I9PFJ len=19 def=
CCTGATAAAACATTGATGG
>LIBTEST1#624#1 acc=Taj1E4D3Z3Y02GX9QE len=15 def=
TACCGGGCTCAGATA
>LIBTEST1#625#1 acc=Taj1E4D3Z3Y02HCAP1 len=24 def=
GTTTTGAAGGACCCTGATGAGACC
>LIBTEST1#626#1 acc=Taj1E4D3Z3Y02IOWQ9 len=21 def=
CAGAACTGCTTACGGCGGGGA
>LIBTEST1#627#1 acc=Taj1E4D3Z3Y02HWI4I len=24 def=
TCTCAACATTTTCCTTACTCTGTC
>LIBTEST1#628#1 acc=Taj1E4D3Z3Y02GTOK5 len=17 def=
CTGCCAGCATGATCTGG
>LIBTEST1#629#1 acc=Taj1E4D3Z3Y02G3MSB len=29 def=
ACTGTGCGATCTGGGTCCAGCCGGCCGAC
>LIBTEST1#630#1 acc=Taj1E4D3Z3Y02F4HQZ len=14 def=
GGTTGGGCCCTCCA
>LIBTEST1#630#2 acc=Taj1E4D3Z3Y02F4HQZ len=14 def=
GGTTGGGCCCTCCA
>LIBTEST1#631#1 acc=Taj1E4D3Z3Y02F3HLU len=28 def=
GCCTTGCCTATCCCCTGTTGCGTGTCTC
>LIBTEST1#631#2 acc=Taj1E4D3Z3Y02F3HLU len=28 def=
GCCTTGCCTATCCCCTGTTGCGTGTCTC
>LIBTEST1#631#3 acc=Taj1E4D3Z3Y02F3HLU len=28 def=
GCCTTGCCTATCCCCTGTTGCGTGTCTC
>LIBTEST1#632#1 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#2 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#3 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#4 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#5 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#6 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#7 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#8 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#9 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#10 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#11 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#632#12 acc=Taj1E4D3Z3Y02HG3OT len=13 def=
CTGAGACACGCAA
>LIBTEST1#633#1 acc=Taj1E4D3Z3Y02IZI6Q len=26 def=
GATAAAGTTGATGGTGGCCTACGACT
>LIBTEST1#634#1 acc=Taj1E4D3Z3Y02INDHS len=15 def=
GTCCCTACGAGGTAA
>LIBTEST1#635#1 acc=Taj1E4D3Z3Y02HNU2C len=20 def=
ACCTGGATAGGCCTAGGGAA
>LIBTEST1#636#1 acc=Taj1E4D3Z3Y02F5Q1Y len=13 def=
TCGTGTCCTGATA
>LIBTEST1#636#2 acc=Taj1E4D3Z3Y02F5Q1Y len=13 def=
TCGTGTCCTGATA
>LIBTEST1#636#3 acc=Taj1E4D3Z3Y02F5Q1Y len=13 def=
TCGTGTCCTGATA
>LIBTEST1#637#1 acc=Taj1E4D3Z3Y02I211B len=25 def=
AGTTAGCGTCCGTGACTAATGCTGG
>LIBTEST1#638#1 acc=Taj1E4D3Z3Y02GOKNT len=23 def=
TGGTTTCGCAATGTGTTTACAAG
>LIBTEST1#639#1 acc=Taj1E4D3Z3Y02IXVGL len=16 def=
TAGGCGTCCCTGATAA
>LIBTEST1#640#1 acc=Taj1E4D3Z3Y02F9MAR len=21 def=
ATTGATGACGAGGCATTTGGC
>LIBTEST1#640#2 acc=Taj1E4D3Z3Y02F9MAR len=21 def=
ATTGATGACGAGGCATTTGGC
>LIBTEST1#641#1 acc=Taj1E4D3Z3Y02GKRYZ len=18 def=
CTGAACACGCAACAGGGG
>LIBTEST1#641#2 acc=Taj1E4D3Z3Y02GKRYZ len=18 def=
CTGAACACGCAACAGGGG
>LIBTEST1#642#1 acc=Taj1E4D3Z3Y02G6NU7 len=16 def=
AGCTTAGGATGCATGC
>LIBTEST1#643#1 acc=Taj1E4D3Z3Y02JG2WZ len=22 def=
GAGCCAAGGATGACTTGCCGGT
>LIBTEST1#643#2 acc=Taj1E4D3Z3Y02JG2WZ len=22 def=
GAGCCAAGGATGACTTGCCGGT
>LIBTEST1#643#3 acc=Taj1E4D3Z3Y02JG2WZ len=22 def=
GAGCCAAGGATGACTTGCCGGT
>LIBTEST1#644#1 acc=Taj1E4D3Z3Y02IHTDP len=19 def=
GGGTCGATCGGTCCGATTG
>LIBTEST1#645#1 acc=Taj1E4D3Z3Y02GSYMJ len=24 def=
CAAAACTCTATTGAAATTGTTCTG
>LIBTEST1#646#1 acc=Taj1E4D3Z3Y02I733U len=17 def=
GTGGTTTTGAGTGAATC
>LIBTEST1#647#1 acc=Taj1E4D3Z3Y02I09FP len=14 def=
TATAGCGTCCTACA
>LIBTEST1#648#1 acc=Taj1E4D3Z3Y02HNG4M len=23 def=
TCGTTGTAGTATAGTGATTGATG
>LIBTEST1#649#1 acc=Taj1E4D3Z3Y02G1Y5Q len=21 def=
CGTTCCCCAGCGGAGTCGCCA
>LIBTEST1#650#1 acc=Taj1E4D3Z3Y02JCDZ2 len=16 def=
GTAGCGTCTGATAATA
>LIBTEST1#651#1 acc=Taj1E4D3Z3Y02GN71O len=21 def=
TTACCGATTCCACCATTCCTA
>LIBTEST1#652#1 acc=Taj1E4D3Z3Y02G9DO1 len=26 def=
TGGGTTAGTCGATCCTAAGGGTGATA
>LIBTEST1#653#1 acc=Taj1E4D3Z3Y02GQFJG len=24 def=
GGAGCTTCTACGGTGCAGTCTGGA
>LIBTEST1#654#1 acc=Taj1E4D3Z3Y02GY7P8 len=27 def=
AGTTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#654#2 acc=Taj1E4D3Z3Y02GY7P8 len=27 def=
AGTTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#654#3 acc=Taj1E4D3Z3Y02GY7P8 len=27 def=
AGTTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#655#1 acc=Taj1E4D3Z3Y02FVJWQ len=24 def=
CGTGACTCATCATCAGCATTTCCC
>LIBTEST1#656#1 acc=Taj1E4D3Z3Y02F0VN0 len=17 def=
CACCCAGATTGATGGTG
>LIBTEST1#657#1 acc=Taj1E4D3Z3Y02F78LB len=23 def=
AAACAACGTTGCACTAAGATGAC
>LIBTEST1#658#1 acc=Taj1E4D3Z3Y02I58D2 len=17 def=
GCGTCTTGATATAATTT
>LIBTEST1#659#1 acc=Taj1E4D3Z3Y02J1PDF len=23 def=
GTCCTGATAGGCATCGGGGGCTA
>LIBTEST1#660#1 acc=Taj1E4D3Z3Y02I5C5B len=24 def=
GAGAATGCCAGAGACACTCTCTTT
>LIBTEST1#661#1 acc=Taj1E4D3Z3Y02I6V3M len=18 def=
GTCGTTGTAGTAATTAAT
>LIBTEST1#662#1 acc=Taj1E4D3Z3Y02G5O7U len=19 def=
TCGCTTCGATTCCGTATTC
>LIBTEST1#663#1 acc=Taj1E4D3Z3Y02I8D8A len=26 def=
ATACGGGAGTTGCCTTGGTTCTCCCC
>LIBTEST1#664#1 acc=Taj1E4D3Z3Y02G4A12 len=15 def=
CGGATGGGGGCCATA
>LIBTEST1#664#2 acc=Taj1E4D3Z3Y02G4A12 len=15 def=
CGGATGGGGGCCATA
>LIBTEST1#665#1 acc=Taj1E4D3Z3Y02HP02O len=18 def=
TCGTAGCAGGATACGCTA
>LIBTEST1#666#1 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#2 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#3 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#4 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#5 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#6 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#7 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#8 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#9 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#10 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#11 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#12 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#666#13 acc=Taj1E4D3Z3Y02IN8EV len=22 def=
TTACCGATTCCACCCATTCCTA
>LIBTEST1#667#1 acc=Taj1E4D3Z3Y02F9CB0 len=23 def=
CAACAAAAAAAAGCGTAGGGATC
>LIBTEST1#668#1 acc=Taj1E4D3Z3Y02I6XB4 len=25 def=
TAGCGTCCGTGACTAATTGATCGTG
>LIBTEST1#669#1 acc=Taj1E4D3Z3Y02H4ORB len=22 def=
GATCCCTACCATGTGGACTCCA
>LIBTEST1#669#2 acc=Taj1E4D3Z3Y02H4ORB len=22 def=
GATCCCTACCATGTGGACTCCA
>LIBTEST1#669#3 acc=Taj1E4D3Z3Y02H4ORB len=22 def=
GATCCCTACCATGTGGACTCCA
>LIBTEST1#669#4 acc=Taj1E4D3Z3Y02H4ORB len=22 def=
GATCCCTACCATGTGGACTCCA
>LIBTEST1#669#5 acc=Taj1E4D3Z3Y02H4ORB len=22 def=
GATCCCTACCATGTGGACTCCA
>LIBTEST1#669#6 acc=Taj1E4D3Z3Y02H4ORB len=22 def=
GATCCCTACCATGTGGACTCCA
>LIBTEST1#670#1 acc=Taj1E4D3Z3Y02JIQ4Z len=22 def=
CTTGCCCTAACAGCAGCGGATG
>LIBTEST1#671#1 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#671#2 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#671#3 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#671#4 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#671#5 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#671#6 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#671#7 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#671#8 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#671#9 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#671#10 acc=Taj1E4D3Z3Y02IJKG4 len=20 def=
AAGCTGCCAGCATGATCTGG
>LIBTEST1#672#1 acc=Taj1E4D3Z3Y02IHNAM len=17 def=
TAGGTACAAAATCGTAT
>LIBTEST1#672#2 acc=Taj1E4D3Z3Y02IHNAM len=17 def=
TAGGTACAAAATCGTAT
>LIBTEST1#673#1 acc=Taj1E4D3Z3Y02H05XJ len=14 def=
CATAGCGCCTGATA
>LIBTEST1#674#1 acc=Taj1E4D3Z3Y02G9MHB len=20 def=
TTGGAGTGAAGGGAGCTCCA
>LIBTEST1#674#2 acc=Taj1E4D3Z3Y02G9MHB len=20 def=
TTGGAGTGAAGGGAGCTCCA
>LIBTEST1#674#3 acc=Taj1E4D3Z3Y02G9MHB len=20 def=
TTGGAGTGAAGGGAGCTCCA
>LIBTEST1#675#1 acc=Taj1E4D3Z3Y02J2QRB len=16 def=
GTCCTGATACCTGATA
>LIBTEST1#675#2 acc=Taj1E4D3Z3Y02J2QRB len=16 def=
GTCCTGATACCTGATA
>LIBTEST1#676#1 acc=Taj1E4D3Z3Y02IVS56 len=14 def=
TAACTTGACCTGGT
>LIBTEST1#677#1 acc=Taj1E4D3Z3Y02HV8HO len=15 def=
CATGCGTTTTACTTC
>LIBTEST1#678#1 acc=Taj1E4D3Z3Y02IP0BZ len=22 def=
GTTGAGGTAAACTCTCGAGTCG
>LIBTEST1#679#1 acc=Taj1E4D3Z3Y02G4T5G len=16 def=
AGGCGAATTCTATGGT
>LIBTEST1#680#1 acc=Taj1E4D3Z3Y02HX20Z len=21 def=
TTTGGATTGAAGGGAGCTCCC
>LIBTEST1#681#1 acc=Taj1E4D3Z3Y02HTUGT len=24 def=
ATCCTAGAAATAGCATCTTGATCA
>LIBTEST1#682#1 acc=Taj1E4D3Z3Y02JOOOA len=18 def=
ATAGGGGACGGACTGGGA
>LIBTEST1#683#1 acc=Taj1E4D3Z3Y02JIYRK len=14 def=
ATGAAAGAGTAAGT
>LIBTEST1#684#1 acc=Taj1E4D3Z3Y02GPYXE len=21 def=
GTCCTGATAGGTTTCGTGGTG
>LIBTEST1#685#1 acc=Taj1E4D3Z3Y02GI6SQ len=26 def=
GGAGGGCGCGGCGGTCGCTGCTGATA
>LIBTEST1#686#1 acc=Taj1E4D3Z3Y02GRHJJ len=18 def=
TAAGAACTTTCTATGACA
>LIBTEST1#687#1 acc=Taj1E4D3Z3Y02FSG7L len=22 def=
GTAGCGCCTGATAATTGATGGT
>LIBTEST1#687#2 acc=Taj1E4D3Z3Y02FSG7L len=22 def=
GTAGCGCCTGATAATTGATGGT
>LIBTEST1#688#1 acc=Taj1E4D3Z3Y02FNGX4 len=19 def=
TTAACACGTGTCACCTCTG
>LIBTEST1#689#1 acc=Taj1E4D3Z3Y02I1L7D len=20 def=
CGGACCAGGCTTCATTCCCC
>LIBTEST1#689#2 acc=Taj1E4D3Z3Y02I1L7D len=20 def=
CGGACCAGGCTTCATTCCCC
>LIBTEST1#689#3 acc=Taj1E4D3Z3Y02I1L7D len=20 def=
CGGACCAGGCTTCATTCCCC
>LIBTEST1#689#4 acc=Taj1E4D3Z3Y02I1L7D len=20 def=
CGGACCAGGCTTCATTCCCC
>LIBTEST1#689#5 acc=Taj1E4D3Z3Y02I1L7D len=20 def=
CGGACCAGGCTTCATTCCCC
>LIBTEST1#689#6 acc=Taj1E4D3Z3Y02I1L7D len=20 def=
CGGACCAGGCTTCATTCCCC
>LIBTEST1#689#7 acc=Taj1E4D3Z3Y02I1L7D len=20 def=
CGGACCAGGCTTCATTCCCC
>LIBTEST1#690#1 acc=Taj1E4D3Z3Y02GL9WT len=21 def=
GGAACGTTGTCTGGCTCGAGG
>LIBTEST1#690#2 acc=Taj1E4D3Z3Y02GL9WT len=21 def=
GGAACGTTGTCTGGCTCGAGG
>LIBTEST1#690#3 acc=Taj1E4D3Z3Y02GL9WT len=21 def=
GGAACGTTGTCTGGCTCGAGG
>LIBTEST1#690#4 acc=Taj1E4D3Z3Y02GL9WT len=21 def=
GGAACGTTGTCTGGCTCGAGG
>LIBTEST1#690#5 acc=Taj1E4D3Z3Y02GL9WT len=21 def=
GGAACGTTGTCTGGCTCGAGG
>LIBTEST1#690#6 acc=Taj1E4D3Z3Y02GL9WT len=21 def=
GGAACGTTGTCTGGCTCGAGG
>LIBTEST1#691#1 acc=Taj1E4D3Z3Y02JW78T len=18 def=
GAAGAGGAGAGCGGAATA
>LIBTEST1#692#1 acc=Taj1E4D3Z3Y02IKU3C len=19 def=
GTAGCGTCCGTGAGTAATT
>LIBTEST1#693#1 acc=Taj1E4D3Z3Y02IELWZ len=19 def=
TGAGATATGCTCACGGAAA
>LIBTEST1#694#1 acc=Taj1E4D3Z3Y02GCAIK len=13 def=
ATCAGACGCTACG
>LIBTEST1#694#2 acc=Taj1E4D3Z3Y02GCAIK len=13 def=
ATCAGACGCTACG
>LIBTEST1#695#1 acc=Taj1E4D3Z3Y02GRUFA len=25 def=
GTTAAACTCCTTCGATTTTGCTATT
>LIBTEST1#696#1 acc=Taj1E4D3Z3Y02HIZ0J len=24 def=
GTTACCATGTTGGGCATCATGACA
>LIBTEST1#697#1 acc=Taj1E4D3Z3Y02HZ64T len=21 def=
TCGGACCAGGCTTCATTCCCA
>LIBTEST1#697#2 acc=Taj1E4D3Z3Y02HZ64T len=21 def=
TCGGACCAGGCTTCATTCCCA
>LIBTEST1#697#3 acc=Taj1E4D3Z3Y02HZ64T len=21 def=
TCGGACCAGGCTTCATTCCCA
>LIBTEST1#698#1 acc=Taj1E4D3Z3Y02HJLHH len=15 def=
ATTGATGGCTACACT
>LIBTEST1#699#1 acc=Taj1E4D3Z3Y02G1RYU len=21 def=
TGAAACGCCGGATTCACCTTC
>LIBTEST1#699#2 acc=Taj1E4D3Z3Y02G1RYU len=21 def=
TGAAACGCCGGATTCACCTTC
>LIBTEST1#699#3 acc=Taj1E4D3Z3Y02G1RYU len=21 def=
TGAAACGCCGGATTCACCTTC
>LIBTEST1#699#4 acc=Taj1E4D3Z3Y02G1RYU len=21 def=
TGAAACGCCGGATTCACCTTC
>LIBTEST1#699#5 acc=Taj1E4D3Z3Y02G1RYU len=21 def=
TGAAACGCCGGATTCACCTTC
>LIBTEST1#699#6 acc=Taj1E4D3Z3Y02G1RYU len=21 def=
TGAAACGCCGGATTCACCTTC
>LIBTEST1#699#7 acc=Taj1E4D3Z3Y02G1RYU len=21 def=
TGAAACGCCGGATTCACCTTC
>LIBTEST1#699#8 acc=Taj1E4D3Z3Y02G1RYU len=21 def=
TGAAACGCCGGATTCACCTTC
>LIBTEST1#699#9 acc=Taj1E4D3Z3Y02G1RYU len=21 def=
TGAAACGCCGGATTCACCTTC
>LIBTEST1#700#1 acc=Taj1E4D3Z3Y02IZWQW len=13 def=
CTGATACTGATAC
>LIBTEST1#700#2 acc=Taj1E4D3Z3Y02IZWQW len=13 def=
CTGATACTGATAC
>LIBTEST1#700#3 acc=Taj1E4D3Z3Y02IZWQW len=13 def=
CTGATACTGATAC
>LIBTEST1#700#4 acc=Taj1E4D3Z3Y02IZWQW len=13 def=
CTGATACTGATAC
>LIBTEST1#701#1 acc=Taj1E4D3Z3Y02GHAH6 len=23 def=
TTGTCTTACCCATTCCTCCCATT
>LIBTEST1#702#1 acc=Taj1E4D3Z3Y02IP1RZ len=17 def=
CGGAAATGGATGAAAAC
>LIBTEST1#703#1 acc=Taj1E4D3Z3Y02I1ZNJ len=23 def=
CCTATCCCCGTTGCGTGTCTCAG
>LIBTEST1#704#1 acc=Taj1E4D3Z3Y02JVIU1 len=16 def=
CCTGGGTGCTGTGGTT
>LIBTEST1#705#1 acc=Taj1E4D3Z3Y02H1QR9 len=27 def=
CGTCCTATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#706#1 acc=Taj1E4D3Z3Y02I1X5I len=18 def=
TAGGACGGTCTGAGGCTA
>LIBTEST1#707#1 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#2 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#3 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#4 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#5 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#6 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#7 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#8 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#9 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#10 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#707#11 acc=Taj1E4D3Z3Y02F7JQA len=21 def=
TGCCTGGCTCCCTGTATGCCA
>LIBTEST1#708#1 acc=Taj1E4D3Z3Y02IGEWK len=13 def=
TAATACTGATACT
>LIBTEST1#709#1 acc=Taj1E4D3Z3Y02GZN07 len=22 def=
AGGTTCTGGAAATGTTAACTTG
>LIBTEST1#710#1 acc=Taj1E4D3Z3Y02JRV06 len=25 def=
ATTGACTGGTGACCTTACACTCGTG
>LIBTEST1#711#1 acc=Taj1E4D3Z3Y02J3LYM len=19 def=
ATTGGAGTGAAGGGAGCTC
>LIBTEST1#711#2 acc=Taj1E4D3Z3Y02J3LYM len=19 def=
ATTGGAGTGAAGGGAGCTC
>LIBTEST1#712#1 acc=Taj1E4D3Z3Y02HETK6 len=21 def=
GATACCTGATAATTGATGGTG
>LIBTEST1#713#1 acc=Taj1E4D3Z3Y02H83H1 len=24 def=
ACGGACACGCCGCTTCTCCATCTC
>LIBTEST1#714#1 acc=Taj1E4D3Z3Y02HW0K3 len=13 def=
CGGTCCCTGACTA
>LIBTEST1#715#1 acc=Taj1E4D3Z3Y02HHNPH len=22 def=
TGAGTCTCTTAATTGCTGCTTC
>LIBTEST1#716#1 acc=Taj1E4D3Z3Y02G1HWR len=14 def=
AATCTCAAATAATC
>LIBTEST1#717#1 acc=Taj1E4D3Z3Y02GU01D len=30 def=
TCAGCCCTTGTCGCTTCGATTCGTATTGAT
>LIBTEST1#718#1 acc=Taj1E4D3Z3Y02GPHV2 len=22 def=
TCGGGTCCCACCGTGGTCGCCA
>LIBTEST1#718#2 acc=Taj1E4D3Z3Y02GPHV2 len=22 def=
TCGGGTCCCACCGTGGTCGCCA
>LIBTEST1#719#1 acc=Taj1E4D3Z3Y02GLHUR len=16 def=
ATACGCCCTCGAGATA
>LIBTEST1#720#1 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#2 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#3 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#4 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#5 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#6 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#7 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#8 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#9 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#10 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#11 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#720#12 acc=Taj1E4D3Z3Y02GCGND len=18 def=
CTAGTTCTCTTTAAATTG
>LIBTEST1#721#1 acc=>Taj1E4D3Z3Y02G8O3K len=16 def=
TCCACAGTAGCACACC
>LIBTEST1#721#2 acc=>Taj1E4D3Z3Y02G8O3K len=16 def=
TCCACAGTAGCACACC
>LIBTEST1#721#3 acc=>Taj1E4D3Z3Y02G8O3K len=16 def=
TCCACAGTAGCACACC
>LIBTEST1#722#1 acc=Taj1E4D3Z3Y02GMT8G len=20 def=
TGCATAGGCTGGCGCACCCC
>LIBTEST1#723#1 acc=Taj1E4D3Z3Y02GABHJ len=29 def=
CTGAGACACGCAGCAGGGGATAGGCAAGG
>LIBTEST1#724#1 acc=Taj1E4D3Z3Y02J0RNQ len=17 def=
CGATAAATTTAGTATGG
>LIBTEST1#725#1 acc=Taj1E4D3Z3Y02IQF6M len=24 def=
AAGCGAGATGCCCAGAACTGCACT
>LIBTEST1#726#1 acc=Taj1E4D3Z3Y02H40UT len=13 def=
GTCTCTAAGCGCC
>LIBTEST1#727#1 acc=Taj1E4D3Z3Y02H2XUX len=17 def=
TCGGACCAGGCTTCATT
>LIBTEST1#728#1 acc=Taj1E4D3Z3Y02IEHDW len=29 def=
ATTGACTCGGTGCCTAATACTCGTGGCGT
>LIBTEST1#729#1 acc=Taj1E4D3Z3Y02H7Q2T len=14 def=
CTGATACTGATATA
>LIBTEST1#730#1 acc=Taj1E4D3Z3Y02FZKJQ len=15 def=
TCGGGGGCATTCATA
>LIBTEST1#731#1 acc=Taj1E4D3Z3Y02HMT5Z len=23 def=
TAACACTAAGACGTGTCACACGC
>LIBTEST1#731#2 acc=Taj1E4D3Z3Y02HMT5Z len=23 def=
TAACACTAAGACGTGTCACACGC
>LIBTEST1#732#1 acc=Taj1E4D3Z3Y02JVFKP len=16 def=
CGACGTTGGAAGGGAT
>LIBTEST1#733#1 acc=Taj1E4D3Z3Y02JIITU len=18 def=
AGGACGTCTACGATCGTG
>LIBTEST1#733#2 acc=Taj1E4D3Z3Y02JIITU len=18 def=
AGGACGTCTACGATCGTG
>LIBTEST1#734#1 acc=Taj1E4D3Z3Y02HUF77 len=18 def=
ATTGAGTGGTCGCCTACA
>LIBTEST1#735#1 acc=Taj1E4D3Z3Y02GUNQU len=25 def=
CTGCGGAAGGATCATTGATTGATGG
>LIBTEST1#736#1 acc=Taj1E4D3Z3Y02G0O7I len=21 def=
AAAAGCGCAAAAAATAAAAAT
>LIBTEST1#737#1 acc=Taj1E4D3Z3Y02J5YPH len=13 def=
GTAGCGTCCGTGA
>LIBTEST1#737#2 acc=Taj1E4D3Z3Y02J5YPH len=13 def=
GTAGCGTCCGTGA
>LIBTEST1#738#1 acc=Taj1E4D3Z3Y02GFPWB len=20 def=
GATATTTGTGAGTATCCAAG
>LIBTEST1#738#2 acc=Taj1E4D3Z3Y02GFPWB len=20 def=
GATATTTGTGAGTATCCAAG
>LIBTEST1#738#3 acc=Taj1E4D3Z3Y02GFPWB len=20 def=
GATATTTGTGAGTATCCAAG
>LIBTEST1#739#1 acc=Taj1E4D3Z3Y02H5B5Y len=25 def=
GTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#739#2 acc=Taj1E4D3Z3Y02H5B5Y len=25 def=
GTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#739#3 acc=Taj1E4D3Z3Y02H5B5Y len=25 def=
GTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#739#4 acc=Taj1E4D3Z3Y02H5B5Y len=25 def=
GTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#739#5 acc=Taj1E4D3Z3Y02H5B5Y len=25 def=
GTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#739#6 acc=Taj1E4D3Z3Y02H5B5Y len=25 def=
GTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#739#7 acc=Taj1E4D3Z3Y02H5B5Y len=25 def=
GTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#739#8 acc=Taj1E4D3Z3Y02H5B5Y len=25 def=
GTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#739#9 acc=Taj1E4D3Z3Y02H5B5Y len=25 def=
GTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#740#1 acc=Taj1E4D3Z3Y02G9L9B len=19 def=
GAATGATATGTGCAGACGG
>LIBTEST1#740#2 acc=Taj1E4D3Z3Y02G9L9B len=19 def=
GAATGATATGTGCAGACGG
>LIBTEST1#741#1 acc=Taj1E4D3Z3Y02GTTYQ len=21 def=
TATAGAGTTCGTCTCCGTTTT
>LIBTEST1#742#1 acc=Taj1E4D3Z3Y02F23IE len=16 def=
GGTGGTCTATTGGCGC
>LIBTEST1#743#1 acc=Taj1E4D3Z3Y02HK63U len=24 def=
ATCCGGAAGCATGAGTATTTCGGT
>LIBTEST1#744#1 acc=Taj1E4D3Z3Y02HSM1Q len=20 def=
AACATCAGACCAAGATGAGT
>LIBTEST1#744#2 acc=Taj1E4D3Z3Y02HSM1Q len=20 def=
AACATCAGACCAAGATGAGT
>LIBTEST1#744#3 acc=Taj1E4D3Z3Y02HSM1Q len=20 def=
AACATCAGACCAAGATGAGT
>LIBTEST1#745#1 acc=Taj1E4D3Z3Y02I9ZD3 len=16 def=
TCCTGATACGTCCTGA
>LIBTEST1#745#2 acc=Taj1E4D3Z3Y02I9ZD3 len=16 def=
TCCTGATACGTCCTGA
>LIBTEST1#746#1 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#2 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#3 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#4 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#5 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#6 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#7 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#8 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#9 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#10 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#11 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#12 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#13 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#14 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#746#15 acc=Taj1E4D3Z3Y02JG4X1 len=15 def=
GTCCTGATACTGATA
>LIBTEST1#747#1 acc=Taj1E4D3Z3Y02H251I len=18 def=
ACATCAGATAGCTCGTTC
>LIBTEST1#748#1 acc=Taj1E4D3Z3Y02GYR8R len=24 def=
AGGACACCTTACTTCTCCACATTT
>LIBTEST1#749#1 acc=Taj1E4D3Z3Y02H40N5 len=30 def=
CGTCATCATCAACGTATTGCGGGATTCGTG
>LIBTEST1#750#1 acc=Taj1E4D3Z3Y02GYLUW len=21 def=
CTGATACTGCTCTGTTGAGCA
>LIBTEST1#750#2 acc=Taj1E4D3Z3Y02GYLUW len=21 def=
CTGATACTGCTCTGTTGAGCA
>LIBTEST1#750#3 acc=Taj1E4D3Z3Y02GYLUW len=21 def=
CTGATACTGCTCTGTTGAGCA
>LIBTEST1#751#1 acc=Taj1E4D3Z3Y02F0DJQ len=13 def=
GTAACGTCTGATA
>LIBTEST1#752#1 acc=Taj1E4D3Z3Y02I1Q56 len=14 def=
CAGATAGTAGCGTC
>LIBTEST1#753#1 acc=Taj1E4D3Z3Y02HBXW7 len=17 def=
GCGCCCATTGCCTGATA
>LIBTEST1#754#1 acc=Taj1E4D3Z3Y02F1FHN len=18 def=
ACGCTAGCGGGATGCATA
>LIBTEST1#755#1 acc=Taj1E4D3Z3Y02GUERJ len=25 def=
ATTAGTATGGTGGCCTACCACTCTG
>LIBTEST1#756#1 acc=Taj1E4D3Z3Y02FSAH9 len=24 def=
CGACACTAGTTAGCGCCGTCGATA
>LIBTEST1#757#1 acc=Taj1E4D3Z3Y02JZTHF len=14 def=
TCCTGATAATTGAT
>LIBTEST1#757#2 acc=Taj1E4D3Z3Y02JZTHF len=14 def=
TCCTGATAATTGAT
>LIBTEST1#758#1 acc=Taj1E4D3Z3Y02IUHW1 len=14 def=
ATGCCCCTAGGGAC
>LIBTEST1#759#1 acc=Taj1E4D3Z3Y02GSZF4 len=19 def=
CTGATATCCTGATAGCGTC
>LIBTEST1#760#1 acc=Taj1E4D3Z3Y02IRZ20 len=20 def=
TCGGACCAGGCTTCATTCCT
>LIBTEST1#761#1 acc=Taj1E4D3Z3Y02ICWZZ len=24 def=
CTGATACCGGTTGGCTCGTCCCTT
>LIBTEST1#762#1 acc=Taj1E4D3Z3Y02JK63A len=17 def=
TGTCGACGCTCCTGATA
>LIBTEST1#763#1 acc=Taj1E4D3Z3Y02HACXC len=15 def=
TCGGTCGTTGGGGCA
>LIBTEST1#763#2 acc=Taj1E4D3Z3Y02HACXC len=15 def=
TCGGTCGTTGGGGCA
>LIBTEST1#764#1 acc=Taj1E4D3Z3Y02H4B8Z len=17 def=
TGATAGTGTGGCTGCTC
>LIBTEST1#765#1 acc=Taj1E4D3Z3Y02GYGAJ len=14 def=
TAGCGTCTGATAAT
>LIBTEST1#766#1 acc=Taj1E4D3Z3Y02J2G89 len=20 def=
TACTGATACCGACAGTGTCG
>LIBTEST1#767#1 acc=Taj1E4D3Z3Y02J5EYV len=15 def=
CTGATACTGATAATT
>LIBTEST1#768#1 acc=Taj1E4D3Z3Y02HVSU4 len=14 def=
CCGCATCTCCACCA
>LIBTEST1#769#1 acc=Taj1E4D3Z3Y02H3BJH len=19 def=
ACCTGGATAATTGATCGGT
>LIBTEST1#770#1 acc=Taj1E4D3Z3Y02HIX9F len=20 def=
GTAGCGTTTGATGGGCCTAC
>LIBTEST1#771#1 acc=Taj1E4D3Z3Y02H7GSM len=13 def=
GTAGCGCTGATAA
>LIBTEST1#772#1 acc=Taj1E4D3Z3Y02IMKGA len=13 def=
CTTGATGATGCTA
>LIBTEST1#772#2 acc=Taj1E4D3Z3Y02IMKGA len=13 def=
CTTGATGATGCTA
>LIBTEST1#773#1 acc=Taj1E4D3Z3Y02H1IBU len=22 def=
TGAAGCTGCCAGCATGATCTAG
>LIBTEST1#774#1 acc=Taj1E4D3Z3Y02GQ2XN len=23 def=
TACTCGGACCAGGCTTCATTCCC
>LIBTEST1#775#1 acc=Taj1E4D3Z3Y02GRI0O len=17 def=
CTCAGGTCAGGCTGATA
>LIBTEST1#776#1 acc=Taj1E4D3Z3Y02F8SBG len=19 def=
TGGTGGCTAGAATTCACCC
>LIBTEST1#777#1 acc=Taj1E4D3Z3Y02FVGQE len=29 def=
CCTGATATCTTTGAACGCAAGTTGCGCCC
>LIBTEST1#778#1 acc=Taj1E4D3Z3Y02H0QN2 len=22 def=
TGGGCGTGCTATGTAGGCTTGA
>LIBTEST1#778#2 acc=Taj1E4D3Z3Y02H0QN2 len=22 def=
TGGGCGTGCTATGTAGGCTTGA
>LIBTEST1#778#3 acc=Taj1E4D3Z3Y02H0QN2 len=22 def=
TGGGCGTGCTATGTAGGCTTGA
>LIBTEST1#778#4 acc=Taj1E4D3Z3Y02H0QN2 len=22 def=
TGGGCGTGCTATGTAGGCTTGA
>LIBTEST1#779#1 acc=Taj1E4D3Z3Y02H2NCZ len=24 def=
TGACGCAATGTGATTTCTGCCATT
>LIBTEST1#780#1 acc=Taj1E4D3Z3Y02HT8LQ len=16 def=
GCGTTCGCGCGGCCCC
>LIBTEST1#781#1 acc=Taj1E4D3Z3Y02HCSS2 len=23 def=
CGATAAATTAGTATGGTGGCCTA
>LIBTEST1#782#1 acc=Taj1E4D3Z3Y02F8YZS len=24 def=
GTTCCTCGGCGCCGCTTGGATCGT
>LIBTEST1#783#1 acc=Taj1E4D3Z3Y02HIU8R len=23 def=
AGAGAAGAGAACGTGCGACCTCA
>LIBTEST1#784#1 acc=Taj1E4D3Z3Y02JV4P0 len=22 def=
TTTTATGTCATCGTGAGCTTAA
>LIBTEST1#785#1 acc=Taj1E4D3Z3Y02JOOBQ len=23 def=
TATTAATCAGGGAAATCACAGTT
>LIBTEST1#786#1 acc=Taj1E4D3Z3Y02HLSYW len=14 def=
CGTCTACGAGTGTG
>LIBTEST1#787#1 acc=Taj1E4D3Z3Y02HQGKQ len=20 def=
TGGCATAGGGATAAAAACCT
>LIBTEST1#788#1 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#2 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#3 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#4 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#5 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#6 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#7 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#8 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#9 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#10 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#788#11 acc=Taj1E4D3Z3Y02HE0KG len=21 def=
TTGGACTGAAGGGAGCTCCCT
>LIBTEST1#789#1 acc=Taj1E4D3Z3Y02F9Q1M len=26 def=
CGACGGCGGTAGCGCAATCCGATAAT
>LIBTEST1#790#1 acc=Taj1E4D3Z3Y02H2S4A len=15 def=
CTGATACGTAGCGTC
>LIBTEST1#790#2 acc=Taj1E4D3Z3Y02H2S4A len=15 def=
CTGATACGTAGCGTC
>LIBTEST1#790#3 acc=Taj1E4D3Z3Y02H2S4A len=15 def=
CTGATACGTAGCGTC
>LIBTEST1#790#4 acc=Taj1E4D3Z3Y02H2S4A len=15 def=
CTGATACGTAGCGTC
>LIBTEST1#790#5 acc=Taj1E4D3Z3Y02H2S4A len=15 def=
CTGATACGTAGCGTC
>LIBTEST1#791#1 acc=Taj1E4D3Z3Y02G6YGW len=13 def=
ACTATTGATGGTG
>LIBTEST1#792#1 acc=Taj1E4D3Z3Y02IBVBO len=16 def=
GACTATTTTAGAGAAG
>LIBTEST1#793#1 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#793#2 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#793#3 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#793#4 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#793#5 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#793#6 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#793#7 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#793#8 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#793#9 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#793#10 acc=Taj1E4D3Z3Y02JI2DR len=21 def=
AGAATCTTGATGATGCTGCAG
>LIBTEST1#794#1 acc=Taj1E4D3Z3Y02J3S2S len=30 def=
AATTGTCTCATATCTAACCAACATTGATGG
>LIBTEST1#795#1 acc=Taj1E4D3Z3Y02I9BXM len=26 def=
AAAAAAAAAAAAAAAAAAAAAAAAAG
>LIBTEST1#796#1 acc=Taj1E4D3Z3Y02GB5IQ len=18 def=
ACGGTCGGTCGCGTGATA
>LIBTEST1#797#1 acc=Taj1E4D3Z3Y02H6YIV len=18 def=
GAGGCCTGCTGGAGGTAT
>LIBTEST1#798#1 acc=Taj1E4D3Z3Y02GHZG7 len=16 def=
TCCTGATAATTGATGG
>LIBTEST1#798#2 acc=Taj1E4D3Z3Y02GHZG7 len=16 def=
TCCTGATAATTGATGG
>LIBTEST1#798#3 acc=Taj1E4D3Z3Y02GHZG7 len=16 def=
TCCTGATAATTGATGG
>LIBTEST1#799#1 acc=Taj1E4D3Z3Y02JUSWF len=14 def=
CCACTGGCGTGCCA
>LIBTEST1#800#1 acc=Taj1E4D3Z3Y02HT8KY len=14 def=
CCTGATACTGATAA
>LIBTEST1#801#1 acc=Taj1E4D3Z3Y02HNZCU len=20 def=
CCGGTCGGGGACGGACTGGG
>LIBTEST1#802#1 acc=Taj1E4D3Z3Y02HCWBV len=23 def=
CCACATACGTTAGCGTCCGTGAT
>LIBTEST1#803#1 acc=Taj1E4D3Z3Y02I99PV len=13 def=
TACGTGGTCCACA
>LIBTEST1#804#1 acc=Taj1E4D3Z3Y02HYN2J len=17 def=
ATTCGATGGTTAGTCCT
>LIBTEST1#805#1 acc=Taj1E4D3Z3Y02GMZN4 len=22 def=
TCATCAGACCTTGACCATCTTG
>LIBTEST1#806#1 acc=Taj1E4D3Z3Y02JJONZ len=25 def=
GTCCTGATACTGATAATTGATGGTG
>LIBTEST1#807#1 acc=Taj1E4D3Z3Y02GAS7K len=20 def=
TTGTCTTACCCATTCCTCCC
>LIBTEST1#808#1 acc=Taj1E4D3Z3Y02I9O69 len=24 def=
AACTTTCCTATGGTGGAAAACTCT
>LIBTEST1#809#1 acc=Taj1E4D3Z3Y02HORPX len=22 def=
TTTCCAATTCCACCCATTCCTA
>LIBTEST1#809#2 acc=Taj1E4D3Z3Y02HORPX len=22 def=
TTTCCAATTCCACCCATTCCTA
>LIBTEST1#809#3 acc=Taj1E4D3Z3Y02HORPX len=22 def=
TTTCCAATTCCACCCATTCCTA
>LIBTEST1#810#1 acc=Taj1E4D3Z3Y02G2H8Q len=26 def=
AAATATATCAGCCTTCTTCCTCCTCT
>LIBTEST1#811#1 acc=Taj1E4D3Z3Y02H9MD6 len=15 def=
CTGATAGTAGCGTCC
>LIBTEST1#811#2 acc=Taj1E4D3Z3Y02H9MD6 len=15 def=
CTGATAGTAGCGTCC
>LIBTEST1#812#1 acc=Taj1E4D3Z3Y02GUHXF len=20 def=
GATCATATGGCAGCTTCACC
>LIBTEST1#813#1 acc=Taj1E4D3Z3Y02IW7I8 len=23 def=
CCTCGCTATGTTGGGCTACACTT
>LIBTEST1#814#1 acc=Taj1E4D3Z3Y02HL1J7 len=24 def=
TTGATCAACGGAATCTGCATTCAT
>LIBTEST1#815#1 acc=Taj1E4D3Z3Y02GBXGY len=17 def=
ATTAGCGTCCGTGACTA
>LIBTEST1#815#2 acc=Taj1E4D3Z3Y02GBXGY len=17 def=
ATTAGCGTCCGTGACTA
>LIBTEST1#815#3 acc=Taj1E4D3Z3Y02GBXGY len=17 def=
ATTAGCGTCCGTGACTA
>LIBTEST1#815#4 acc=Taj1E4D3Z3Y02GBXGY len=17 def=
ATTAGCGTCCGTGACTA
>LIBTEST1#815#5 acc=Taj1E4D3Z3Y02GBXGY len=17 def=
ATTAGCGTCCGTGACTA
>LIBTEST1#815#6 acc=Taj1E4D3Z3Y02GBXGY len=17 def=
ATTAGCGTCCGTGACTA
>LIBTEST1#816#1 acc=Taj1E4D3Z3Y02GESNR len=13 def=
TTCCACAGCTTTC
>LIBTEST1#817#1 acc=Taj1E4D3Z3Y02JP1XY len=24 def=
CGACCCTGGTTGGAGGAACTCTTT
>LIBTEST1#818#1 acc=Taj1E4D3Z3Y02HXHWR len=21 def=
CCTGATAGACCGACCCCGATC
>LIBTEST1#819#1 acc=Taj1E4D3Z3Y02H38DR len=24 def=
GGTCTTATCTATATGATGTGGGGT
>LIBTEST1#820#1 acc=Taj1E4D3Z3Y02GAC2P len=27 def=
CCTGATATCTAGATTATGCTAATGGTC
>LIBTEST1#821#1 acc=Taj1E4D3Z3Y02HACQ1 len=24 def=
AACTGCCGAATTATGGAACCGACT
>LIBTEST1#822#1 acc=Taj1E4D3Z3Y02HD5MS len=20 def=
GCTGCTTAGCTATGGATCCC
>LIBTEST1#823#1 acc=Taj1E4D3Z3Y02JQOYS len=26 def=
ATAGAGACCTCGCCTGGGTGTCACAT
>LIBTEST1#823#2 acc=Taj1E4D3Z3Y02JQOYS len=26 def=
ATAGAGACCTCGCCTGGGTGTCACAT
>LIBTEST1#824#1 acc=Taj1E4D3Z3Y02IR9Q0 len=13 def=
CGTCCATTGATGG
>LIBTEST1#825#1 acc=Taj1E4D3Z3Y02GN835 len=21 def=
TGAGCCAGGATGACTTGCCGG
>LIBTEST1#825#2 acc=Taj1E4D3Z3Y02GN835 len=21 def=
TGAGCCAGGATGACTTGCCGG
>LIBTEST1#825#3 acc=Taj1E4D3Z3Y02GN835 len=21 def=
TGAGCCAGGATGACTTGCCGG
>LIBTEST1#826#1 acc=Taj1E4D3Z3Y02HMLB0 len=24 def=
AGTATCCAAGGTTCGAACCCCGAC
>LIBTEST1#827#1 acc=Taj1E4D3Z3Y02FZ9HO len=15 def=
CTGATAAGCTCGCTT
>LIBTEST1#828#1 acc=Taj1E4D3Z3Y02JWD3Y len=24 def=
GCAAGAATGTGTCCTTCTAAAGCC
>LIBTEST1#829#1 acc=Taj1E4D3Z3Y02G5BHZ len=18 def=
ACTGAAGGGAGCTCCTTC
>LIBTEST1#830#1 acc=Taj1E4D3Z3Y02GMW0Q len=22 def=
TGAAGCTGCCAACATGATCTGG
>LIBTEST1#830#2 acc=Taj1E4D3Z3Y02GMW0Q len=22 def=
TGAAGCTGCCAACATGATCTGG
>LIBTEST1#831#1 acc=Taj1E4D3Z3Y02I07UZ len=14 def=
CTGATAGTCCTGAT
>LIBTEST1#831#2 acc=Taj1E4D3Z3Y02I07UZ len=14 def=
CTGATAGTCCTGAT
>LIBTEST1#831#3 acc=Taj1E4D3Z3Y02I07UZ len=14 def=
CTGATAGTCCTGAT
>LIBTEST1#831#4 acc=Taj1E4D3Z3Y02I07UZ len=14 def=
CTGATAGTCCTGAT
>LIBTEST1#832#1 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#832#2 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#832#3 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#832#4 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#832#5 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#832#6 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#832#7 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#832#8 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#832#9 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#832#10 acc=Taj1E4D3Z3Y02F1DAP len=13 def=
TCCTGATATGATA
>LIBTEST1#833#1 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#2 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#3 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#4 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#5 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#6 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#7 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#8 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#9 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#10 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#11 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#12 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#13 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#14 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#15 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#16 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#17 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#18 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#19 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#20 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#21 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#22 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#23 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#24 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#833#25 acc=Taj1E4D3Z3Y02F2AZC len=14 def=
TAGCGTCCTCGATA
>LIBTEST1#834#1 acc=Taj1E4D3Z3Y02JOSY4 len=27 def=
GCGGCGAGAGCGGGTCGATTGATGGTG
>LIBTEST1#834#2 acc=Taj1E4D3Z3Y02JOSY4 len=27 def=
GCGGCGAGAGCGGGTCGATTGATGGTG
>LIBTEST1#835#1 acc=Taj1E4D3Z3Y02FW0TO len=21 def=
CGTACAGGCTCATGTTGCACC
>LIBTEST1#836#1 acc=Taj1E4D3Z3Y02GIT8I len=21 def=
AAGCTCAGGAGGGATAGCGCC
>LIBTEST1#836#2 acc=Taj1E4D3Z3Y02GIT8I len=21 def=
AAGCTCAGGAGGGATAGCGCC
>LIBTEST1#836#3 acc=Taj1E4D3Z3Y02GIT8I len=21 def=
AAGCTCAGGAGGGATAGCGCC
>LIBTEST1#836#4 acc=Taj1E4D3Z3Y02GIT8I len=21 def=
AAGCTCAGGAGGGATAGCGCC
>LIBTEST1#836#5 acc=Taj1E4D3Z3Y02GIT8I len=21 def=
AAGCTCAGGAGGGATAGCGCC
>LIBTEST1#836#6 acc=Taj1E4D3Z3Y02GIT8I len=21 def=
AAGCTCAGGAGGGATAGCGCC
>LIBTEST1#836#7 acc=Taj1E4D3Z3Y02GIT8I len=21 def=
AAGCTCAGGAGGGATAGCGCC
>LIBTEST1#837#1 acc=Taj1E4D3Z3Y02JU5EG len=29 def=
TTTTGCAAATATCCTCCTGAAGTTATTGA
>LIBTEST1#837#2 acc=Taj1E4D3Z3Y02JU5EG len=29 def=
TTTTGCAAATATCCTCCTGAAGTTATTGA
>LIBTEST1#838#1 acc=Taj1E4D3Z3Y02IK24U len=13 def=
TTGGACTGAAGGG
>LIBTEST1#839#1 acc=Taj1E4D3Z3Y02HOD07 len=20 def=
CTGCTGCATGACAAAATGAT
>LIBTEST1#840#1 acc=Taj1E4D3Z3Y02HR2U1 len=14 def=
GACGTATAGGGTGT
>LIBTEST1#841#1 acc=Taj1E4D3Z3Y02GQLOE len=24 def=
TGGACAAGTGGTATAAAATGTTTT
>LIBTEST1#842#1 acc=Taj1E4D3Z3Y02GNTEH len=21 def=
TCACAGCCTTATGCTTCTCTT
>LIBTEST1#842#2 acc=Taj1E4D3Z3Y02GNTEH len=21 def=
TCACAGCCTTATGCTTCTCTT
>LIBTEST1#843#1 acc=Taj1E4D3Z3Y02IWRH9 len=14 def=
AGGTGTCTCGTTAA
>LIBTEST1#843#2 acc=Taj1E4D3Z3Y02IWRH9 len=14 def=
AGGTGTCTCGTTAA
>LIBTEST1#844#1 acc=Taj1E4D3Z3Y02GVZJT len=20 def=
CGCCGTGCCCGACCCGGCGT
>LIBTEST1#845#1 acc=Taj1E4D3Z3Y02GL7EU len=30 def=
AAGCTACCGTGCGTTGATTGATATTGATGG
>LIBTEST1#846#1 acc=Taj1E4D3Z3Y02HU0XN len=14 def=
CGGTGGAACCTCCA
>LIBTEST1#847#1 acc=>Taj1E4D3Z3Y02GBWQM len=13 def=
GGGAAATGATGAT
>LIBTEST1#848#1 acc=Taj1E4D3Z3Y02IYYST len=20 def=
AGGTGGTTAATGAGGCTCAT
>LIBTEST1#849#1 acc=Taj1E4D3Z3Y02I7TBC len=17 def=
TCCCACTGTGGTCGCCA
>LIBTEST1#849#2 acc=Taj1E4D3Z3Y02I7TBC len=17 def=
TCCCACTGTGGTCGCCA
>LIBTEST1#849#3 acc=Taj1E4D3Z3Y02I7TBC len=17 def=
TCCCACTGTGGTCGCCA
>LIBTEST1#849#4 acc=Taj1E4D3Z3Y02I7TBC len=17 def=
TCCCACTGTGGTCGCCA
>LIBTEST1#849#5 acc=Taj1E4D3Z3Y02I7TBC len=17 def=
TCCCACTGTGGTCGCCA
>LIBTEST1#849#6 acc=Taj1E4D3Z3Y02I7TBC len=17 def=
TCCCACTGTGGTCGCCA
>LIBTEST1#850#1 acc=Taj1E4D3Z3Y02GZXB9 len=30 def=
GTGCCTTGCCTTCCCTGTTGCGTGTCTCAG
>LIBTEST1#851#1 acc=Taj1E4D3Z3Y02HC8YM len=19 def=
GTCTGGGTGGTGTCTTGAT
>LIBTEST1#852#1 acc=Taj1E4D3Z3Y02GLV93 len=14 def=
TGCCTCGATAATTA
>LIBTEST1#853#1 acc=Taj1E4D3Z3Y02GF9VW len=16 def=
GTTAGCGTCCGTGATA
>LIBTEST1#853#2 acc=Taj1E4D3Z3Y02GF9VW len=16 def=
GTTAGCGTCCGTGATA
>LIBTEST1#853#3 acc=Taj1E4D3Z3Y02GF9VW len=16 def=
GTTAGCGTCCGTGATA
>LIBTEST1#853#4 acc=Taj1E4D3Z3Y02GF9VW len=16 def=
GTTAGCGTCCGTGATA
>LIBTEST1#854#1 acc=Taj1E4D3Z3Y02JCZ01 len=18 def=
TGATACGCGCAAATTACC
>LIBTEST1#854#2 acc=Taj1E4D3Z3Y02JCZ01 len=18 def=
TGATACGCGCAAATTACC
>LIBTEST1#855#1 acc=Taj1E4D3Z3Y02I020X len=16 def=
GTGACTAATTGATGGT
>LIBTEST1#855#2 acc=Taj1E4D3Z3Y02I020X len=16 def=
GTGACTAATTGATGGT
>LIBTEST1#855#3 acc=Taj1E4D3Z3Y02I020X len=16 def=
GTGACTAATTGATGGT
>LIBTEST1#856#1 acc=Taj1E4D3Z3Y02GOA4U len=23 def=
GACCTAACTTCTCCTTAAAATGT
>LIBTEST1#856#2 acc=Taj1E4D3Z3Y02GOA4U len=23 def=
GACCTAACTTCTCCTTAAAATGT
>LIBTEST1#857#1 acc=Taj1E4D3Z3Y02J2NGU len=18 def=
CATTTAAAGAGGTACGTG
>LIBTEST1#858#1 acc=Taj1E4D3Z3Y02GUU3C len=18 def=
GGCAATTGCAACGGATAT
>LIBTEST1#859#1 acc=Taj1E4D3Z3Y02GJHUH len=24 def=
GAGGGTTGAACTTCGGACACCCCT
>LIBTEST1#860#1 acc=Taj1E4D3Z3Y02JDK0P len=25 def=
TCCCTTGGACTATTCCGATTGGTCG
>LIBTEST1#861#1 acc=Taj1E4D3Z3Y02GL4XU len=17 def=
TAGCGTCCCTAGTGCCT
>LIBTEST1#862#1 acc=Taj1E4D3Z3Y02J1VGQ len=26 def=
TACATTGTGATTGATCGATGTCACCA
>LIBTEST1#863#1 acc=Taj1E4D3Z3Y02HZ5T7 len=13 def=
GTAGCGTCCGATT
>LIBTEST1#863#2 acc=Taj1E4D3Z3Y02HZ5T7 len=13 def=
GTAGCGTCCGATT
>LIBTEST1#864#1 acc=Taj1E4D3Z3Y02H8WFZ len=18 def=
CTGATAGTAGCGTCGATA
>LIBTEST1#865#1 acc=Taj1E4D3Z3Y02HWQ6F len=29 def=
CTACTATACTAGGACGCGTACGACTGTGC
>LIBTEST1#866#1 acc=Taj1E4D3Z3Y02JE9GX len=30 def=
TGCCTTGCCTATCCCTGCTGCGTGTCTCAG
>LIBTEST1#867#1 acc=Taj1E4D3Z3Y02I2HSO len=14 def=
GTAACGTCTTGATA
>LIBTEST1#868#1 acc=Taj1E4D3Z3Y02GPK2R len=25 def=
TTGTTGCCAATGCTGCAGGCATCGT
>LIBTEST1#868#2 acc=Taj1E4D3Z3Y02GPK2R len=25 def=
TTGTTGCCAATGCTGCAGGCATCGT
>LIBTEST1#869#1 acc=Taj1E4D3Z3Y02GLPS0 len=16 def=
TGGGAACAGTTGAAAA
>LIBTEST1#870#1 acc=Taj1E4D3Z3Y02FZIDO len=24 def=
TTCGAACTGGTTGTTGAAGCCTCT
>LIBTEST1#870#2 acc=Taj1E4D3Z3Y02FZIDO len=24 def=
TTCGAACTGGTTGTTGAAGCCTCT
>LIBTEST1#871#1 acc=Taj1E4D3Z3Y02HDO1E len=21 def=
TACTGATAGTCGACTGGTGCC
>LIBTEST1#872#1 acc=Taj1E4D3Z3Y02G9BJ3 len=19 def=
TCCTGATACTGATAGTAGC
>LIBTEST1#873#1 acc=Taj1E4D3Z3Y02GV131 len=25 def=
AGGATGTGTTGATACAATCAAGATA
>LIBTEST1#874#1 acc=Taj1E4D3Z3Y02J2AQL len=15 def=
TCCTGATACCATGAT
>LIBTEST1#875#1 acc=Taj1E4D3Z3Y02G1V57 len=16 def=
CTGATAATCTTCCTGC
>LIBTEST1#876#1 acc=Taj1E4D3Z3Y02GR22T len=17 def=
CGCGGCGAGAGCGGTCG
>LIBTEST1#876#2 acc=Taj1E4D3Z3Y02GR22T len=17 def=
CGCGGCGAGAGCGGTCG
>LIBTEST1#877#1 acc=Taj1E4D3Z3Y02HDMII len=16 def=
CGATAATTAGTATGTG
>LIBTEST1#877#2 acc=Taj1E4D3Z3Y02HDMII len=16 def=
CGATAATTAGTATGTG
>LIBTEST1#878#1 acc=Taj1E4D3Z3Y02GFJUW len=14 def=
TCGTAGCGTTGATA
>LIBTEST1#878#2 acc=Taj1E4D3Z3Y02GFJUW len=14 def=
TCGTAGCGTTGATA
>LIBTEST1#879#1 acc=Taj1E4D3Z3Y02F05X1 len=18 def=
TCGGAATGCCGGTCGAAT
>LIBTEST1#880#1 acc=Taj1E4D3Z3Y02GBUJY len=17 def=
TTTGGAAAGCTTCTGCC
>LIBTEST1#881#1 acc=Taj1E4D3Z3Y02I7G8H len=18 def=
GTCGGACCAGGCTTCATT
>LIBTEST1#882#1 acc=Taj1E4D3Z3Y02HKGX5 len=13 def=
GTCGGTCCTGAGA
>LIBTEST1#883#1 acc=Taj1E4D3Z3Y02HN1A4 len=21 def=
CGAGCCGAATCAATATCACTC
>LIBTEST1#883#2 acc=Taj1E4D3Z3Y02HN1A4 len=21 def=
CGAGCCGAATCAATATCACTC
>LIBTEST1#883#3 acc=Taj1E4D3Z3Y02HN1A4 len=21 def=
CGAGCCGAATCAATATCACTC
>LIBTEST1#883#4 acc=Taj1E4D3Z3Y02HN1A4 len=21 def=
CGAGCCGAATCAATATCACTC
>LIBTEST1#884#1 acc=Taj1E4D3Z3Y02IJLU2 len=15 def=
TCCTGATATTGATGG
>LIBTEST1#885#1 acc=Taj1E4D3Z3Y02H6IP5 len=13 def=
CCCTGATATGATA
>LIBTEST1#886#1 acc=Taj1E4D3Z3Y02IXMEU len=24 def=
TGTAGTGTCGTTATCTCTTGTCTT
>LIBTEST1#887#1 acc=Taj1E4D3Z3Y02JUPVW len=16 def=
CGTAGAGTCCTGACTA
>LIBTEST1#888#1 acc=Taj1E4D3Z3Y02GNJ44 len=24 def=
GTATTATGAGTCGACACATGCCCC
>LIBTEST1#888#2 acc=Taj1E4D3Z3Y02GNJ44 len=24 def=
GTATTATGAGTCGACACATGCCCC
>LIBTEST1#889#1 acc=Taj1E4D3Z3Y02F9C3Q len=24 def=
CGAACCTCGGTCATTACGTCCGGC
>LIBTEST1#890#1 acc=Taj1E4D3Z3Y02F3HUJ len=30 def=
CCTATCCCCTGTGTGCCTTGCGTGTCTCAG
>LIBTEST1#891#1 acc=Taj1E4D3Z3Y02FS8TS len=24 def=
AGTGGTCTCATAGGCACACCTTGT
>LIBTEST1#892#1 acc=Taj1E4D3Z3Y02IQ1GZ len=29 def=
CCTTGCATATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#893#1 acc=Taj1E4D3Z3Y02HNT6L len=24 def=
AACTTGGATTGAAGATGTCTCGCT
>LIBTEST1#894#1 acc=Taj1E4D3Z3Y02GLN8Z len=18 def=
ATCTGTCTTACAGTCACG
>LIBTEST1#895#1 acc=Taj1E4D3Z3Y02HRU8Y len=18 def=
GGAAACCAAAATGACCTA
>LIBTEST1#896#1 acc=Taj1E4D3Z3Y02I0JNI len=17 def=
GCGGGTGACCCGGTATA
>LIBTEST1#897#1 acc=Taj1E4D3Z3Y02HPSI6 len=14 def=
GCTGATACCTGATA
>LIBTEST1#898#1 acc=Taj1E4D3Z3Y02GYXY7 len=26 def=
ACTTGACTGGTCCGCCTTACACTCTG
>LIBTEST1#899#1 acc=Taj1E4D3Z3Y02JOWZK len=24 def=
GTGAGAAGCTATAAGCTATAAGCT
>LIBTEST1#900#1 acc=Taj1E4D3Z3Y02GR2T9 len=15 def=
CGTCCTAATTGATGG
>LIBTEST1#900#2 acc=Taj1E4D3Z3Y02GR2T9 len=15 def=
CGTCCTAATTGATGG
>LIBTEST1#901#1 acc=Taj1E4D3Z3Y02JKZUV len=28 def=
TACGTGTGTCTTCACCTCTGAAATTGAT
>LIBTEST1#902#1 acc=Taj1E4D3Z3Y02HTKUO len=19 def=
CTGGGAGTGTGCTCCTCCT
>LIBTEST1#902#2 acc=Taj1E4D3Z3Y02HTKUO len=19 def=
CTGGGAGTGTGCTCCTCCT
>LIBTEST1#903#1 acc=Taj1E4D3Z3Y02GBIBR len=16 def=
CCTGATATAACTCTCT
>LIBTEST1#904#1 acc=Taj1E4D3Z3Y02HP9YX len=19 def=
ATTGTAAGACTATTGTGAT
>LIBTEST1#905#1 acc=Taj1E4D3Z3Y02F7V7I len=15 def=
GTGACTGCGGAAACT
>LIBTEST1#906#1 acc=Taj1E4D3Z3Y02JFSV2 len=14 def=
TGTCTGGGGTAGTC
>LIBTEST1#907#1 acc=Taj1E4D3Z3Y02GOUIR len=21 def=
TCAGAAATCCACTCAAGACCG
>LIBTEST1#908#1 acc=Taj1E4D3Z3Y02F7S8R len=30 def=
TAGCGTCCGTGATATAGCGTCCTCGATACT
>LIBTEST1#909#1 acc=Taj1E4D3Z3Y02HZQUB len=24 def=
GTAGTTATGCTCCGTTATTGCGGA
>LIBTEST1#910#1 acc=Taj1E4D3Z3Y02G1OSE len=25 def=
ATTAGCGTCCGTGATAATTGATGGT
>LIBTEST1#910#2 acc=Taj1E4D3Z3Y02G1OSE len=25 def=
ATTAGCGTCCGTGATAATTGATGGT
>LIBTEST1#911#1 acc=Taj1E4D3Z3Y02JSALT len=16 def=
TACGATCGTGCCAGAC
>LIBTEST1#912#1 acc=Taj1E4D3Z3Y02GZQNP len=29 def=
CGATAATTGTATGGTGGCCTACCACTCTG
>LIBTEST1#913#1 acc=Taj1E4D3Z3Y02HTV0C len=24 def=
TAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#913#2 acc=Taj1E4D3Z3Y02HTV0C len=24 def=
TAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#913#3 acc=Taj1E4D3Z3Y02HTV0C len=24 def=
TAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#913#4 acc=Taj1E4D3Z3Y02HTV0C len=24 def=
TAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#913#5 acc=Taj1E4D3Z3Y02HTV0C len=24 def=
TAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#913#6 acc=Taj1E4D3Z3Y02HTV0C len=24 def=
TAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#913#7 acc=Taj1E4D3Z3Y02HTV0C len=24 def=
TAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#914#1 acc=Taj1E4D3Z3Y02F9U7T len=24 def=
ACTCGATAACAGGTGGTCCGGTGT
>LIBTEST1#915#1 acc=Taj1E4D3Z3Y02F7VUI len=14 def=
GTAGCGTCCGATAA
>LIBTEST1#915#2 acc=Taj1E4D3Z3Y02F7VUI len=14 def=
GTAGCGTCCGATAA
>LIBTEST1#915#3 acc=Taj1E4D3Z3Y02F7VUI len=14 def=
GTAGCGTCCGATAA
>LIBTEST1#916#1 acc=Taj1E4D3Z3Y02G9HU9 len=13 def=
TAGCGTCTGATAC
>LIBTEST1#916#2 acc=Taj1E4D3Z3Y02G9HU9 len=13 def=
TAGCGTCTGATAC
>LIBTEST1#916#3 acc=Taj1E4D3Z3Y02G9HU9 len=13 def=
TAGCGTCTGATAC
>LIBTEST1#917#1 acc=Taj1E4D3Z3Y02GOPTA len=21 def=
ACTGCACTCCATGTGACATTG
>LIBTEST1#918#1 acc=Taj1E4D3Z3Y02JLBU8 len=24 def=
TATCTAGGACGCGTACGACTGTGC
>LIBTEST1#919#1 acc=Taj1E4D3Z3Y02ITXFB len=26 def=
ATTGACTCGGTGCCTTAACACTCTGT
>LIBTEST1#920#1 acc=Taj1E4D3Z3Y02FRIKM len=24 def=
ATCATATGATATACTGCTTTTGAT
>LIBTEST1#921#1 acc=Taj1E4D3Z3Y02FRU4I len=13 def=
CTGATAGAATCAT
>LIBTEST1#922#1 acc=Taj1E4D3Z3Y02FMN5H len=24 def=
GTCTGATGTGACAACGGACAGTGA
>LIBTEST1#923#1 acc=Taj1E4D3Z3Y02JN9MN len=18 def=
GTCCCACTGGGCGTGCCA
>LIBTEST1#923#2 acc=Taj1E4D3Z3Y02JN9MN len=18 def=
GTCCCACTGGGCGTGCCA
>LIBTEST1#923#3 acc=Taj1E4D3Z3Y02JN9MN len=18 def=
GTCCCACTGGGCGTGCCA
>LIBTEST1#924#1 acc=Taj1E4D3Z3Y02G1DLS len=24 def=
GAAATGATTGGGCCACGTGGCACT
>LIBTEST1#925#1 acc=Taj1E4D3Z3Y02G160J len=24 def=
AGTCGTCCTGGATAATTGATGGTG
>LIBTEST1#926#1 acc=Taj1E4D3Z3Y02IFF7R len=24 def=
TCTTGCCGATTCAGATTATATGGT
>LIBTEST1#927#1 acc=Taj1E4D3Z3Y02IMVDQ len=24 def=
GTTTGGTTTAGCGGTGGTTACTAG
>LIBTEST1#928#1 acc=Taj1E4D3Z3Y02HE34E len=23 def=
ATTGGGGTTTGAATCCCGGATTC
>LIBTEST1#929#1 acc=Taj1E4D3Z3Y02IVLWB len=16 def=
ACGTGTGTCTTCACCT
>LIBTEST1#930#1 acc=Taj1E4D3Z3Y02GQH13 len=27 def=
TCGTACGCGTCCTAGTATAATTGGATC
>LIBTEST1#930#2 acc=Taj1E4D3Z3Y02GQH13 len=27 def=
TCGTACGCGTCCTAGTATAATTGGATC
>LIBTEST1#931#1 acc=Taj1E4D3Z3Y02HJ63W len=16 def=
TACGCCTACGATCGTG
>LIBTEST1#932#1 acc=Taj1E4D3Z3Y02G2DJX len=14 def=
GTAGCGTCATAATA
>LIBTEST1#932#2 acc=Taj1E4D3Z3Y02G2DJX len=14 def=
GTAGCGTCATAATA
>LIBTEST1#933#1 acc=Taj1E4D3Z3Y02GBHKD len=24 def=
CAGCTCTTATCCACCACTACATTC
>LIBTEST1#934#1 acc=Taj1E4D3Z3Y02GWG1M len=21 def=
TTTTGGCGTGGCCTACGTCAT
>LIBTEST1#934#2 acc=Taj1E4D3Z3Y02GWG1M len=21 def=
TTTTGGCGTGGCCTACGTCAT
>LIBTEST1#935#1 acc=Taj1E4D3Z3Y02G53IF len=30 def=
CTGATACCAGCTAGCCCAATCATCACTTAC
>LIBTEST1#935#2 acc=Taj1E4D3Z3Y02G53IF len=30 def=
CTGATACCAGCTAGCCCAATCATCACTTAC
>LIBTEST1#936#1 acc=Taj1E4D3Z3Y02GYFJE len=24 def=
AGTTCGGTCCAACTTGACCTACTA
>LIBTEST1#937#1 acc=Taj1E4D3Z3Y02FP3KF len=19 def=
TCCTGATAAACCAAATGAT
>LIBTEST1#938#1 acc=Taj1E4D3Z3Y02IR8W7 len=16 def=
TCGGATCTCATCGTCG
>LIBTEST1#939#1 acc=Taj1E4D3Z3Y02G448J len=20 def=
AGCCCGTACGGTGCTTGGCA
>LIBTEST1#940#1 acc=Taj1E4D3Z3Y02GV4KL len=13 def=
CGTAGCGTCGATA
>LIBTEST1#940#2 acc=Taj1E4D3Z3Y02GV4KL len=13 def=
CGTAGCGTCGATA
>LIBTEST1#940#3 acc=Taj1E4D3Z3Y02GV4KL len=13 def=
CGTAGCGTCGATA
>LIBTEST1#940#4 acc=Taj1E4D3Z3Y02GV4KL len=13 def=
CGTAGCGTCGATA
>LIBTEST1#941#1 acc=Taj1E4D3Z3Y02JUZNY len=15 def=
CGAAGCGTCCTAATA
>LIBTEST1#942#1 acc=Taj1E4D3Z3Y02GXONR len=14 def=
CCTCGTTCCATACA
>LIBTEST1#943#1 acc=Taj1E4D3Z3Y02JYO88 len=20 def=
ACCAGGCTCTGATACCATGA
>LIBTEST1#944#1 acc=Taj1E4D3Z3Y02H3ZJ0 len=22 def=
TTAATCTAGGAAAATACGGTGG
>LIBTEST1#944#2 acc=Taj1E4D3Z3Y02H3ZJ0 len=22 def=
TTAATCTAGGAAAATACGGTGG
>LIBTEST1#944#3 acc=Taj1E4D3Z3Y02H3ZJ0 len=22 def=
TTAATCTAGGAAAATACGGTGG
>LIBTEST1#944#4 acc=Taj1E4D3Z3Y02H3ZJ0 len=22 def=
TTAATCTAGGAAAATACGGTGG
>LIBTEST1#944#5 acc=Taj1E4D3Z3Y02H3ZJ0 len=22 def=
TTAATCTAGGAAAATACGGTGG
>LIBTEST1#944#6 acc=Taj1E4D3Z3Y02H3ZJ0 len=22 def=
TTAATCTAGGAAAATACGGTGG
>LIBTEST1#944#7 acc=Taj1E4D3Z3Y02H3ZJ0 len=22 def=
TTAATCTAGGAAAATACGGTGG
>LIBTEST1#945#1 acc=Taj1E4D3Z3Y02ITSB5 len=17 def=
GTAACCACATACATTAT
>LIBTEST1#946#1 acc=Taj1E4D3Z3Y02FTBXZ len=14 def=
CGTTGCGCCTGATA
>LIBTEST1#947#1 acc=Taj1E4D3Z3Y02H45MB len=25 def=
AGTAATCTTGGATCGATGCTGCATA
>LIBTEST1#948#1 acc=Taj1E4D3Z3Y02J5TJT len=14 def=
ATTAGTATGGTTGG
>LIBTEST1#949#1 acc=Taj1E4D3Z3Y02F5AJN len=17 def=
ATACGGCTACGGAACCA
>LIBTEST1#950#1 acc=Taj1E4D3Z3Y02JK1XP len=15 def=
CGTCTGCCTGGGATA
>LIBTEST1#951#1 acc=Taj1E4D3Z3Y02JBLIJ len=22 def=
TGAGCCAAGGATGACTTGCCGG
>LIBTEST1#951#2 acc=Taj1E4D3Z3Y02JBLIJ len=22 def=
TGAGCCAAGGATGACTTGCCGG
>LIBTEST1#952#1 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#2 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#3 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#4 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#5 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#6 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#7 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#8 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#9 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#10 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#11 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#12 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#13 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#14 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#15 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#16 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#952#17 acc=Taj1E4D3Z3Y02HUIRJ len=21 def=
CGTGTCCCACCGGGTGTGCCA
>LIBTEST1#953#1 acc=Taj1E4D3Z3Y02I2FHN len=18 def=
TCCTGGGCAGCAACACCA
>LIBTEST1#954#1 acc=Taj1E4D3Z3Y02HVGGF len=24 def=
AGCGTGCAATCATGTTAGACGATG
>LIBTEST1#954#2 acc=Taj1E4D3Z3Y02HVGGF len=24 def=
AGCGTGCAATCATGTTAGACGATG
>LIBTEST1#955#1 acc=Taj1E4D3Z3Y02F75AP len=19 def=
GATACGGATGGGGGCCGGC
>LIBTEST1#956#1 acc=Taj1E4D3Z3Y02H3636 len=16 def=
CGGCGGTCGCCTGATA
>LIBTEST1#957#1 acc=Taj1E4D3Z3Y02JUJAE len=23 def=
ATTGATGGTCGCCTACCACTCTG
>LIBTEST1#957#2 acc=Taj1E4D3Z3Y02JUJAE len=23 def=
ATTGATGGTCGCCTACCACTCTG
>LIBTEST1#958#1 acc=Taj1E4D3Z3Y02GD37S len=21 def=
TGTGGCGGATCTGATGACGGC
>LIBTEST1#958#2 acc=Taj1E4D3Z3Y02GD37S len=21 def=
TGTGGCGGATCTGATGACGGC
>LIBTEST1#959#1 acc=>Taj1E4D3Z3Y02IF6O5 len=22 def=
TCGGCCGTGGAATTCTCGGTTG
>LIBTEST1#959#2 acc=>Taj1E4D3Z3Y02IF6O5 len=22 def=
TCGGCCGTGGAATTCTCGGTTG
>LIBTEST1#960#1 acc=Taj1E4D3Z3Y02IMZFH len=22 def=
TAGCGTCCGTGACTAATGATGG
>LIBTEST1#961#1 acc=Taj1E4D3Z3Y02FXPH5 len=24 def=
TCGGACCAGGCTTCATTCCCCATA
>LIBTEST1#962#1 acc=Taj1E4D3Z3Y02H11J9 len=19 def=
TGGCCTGACGGCAACGTTA
>LIBTEST1#963#1 acc=Taj1E4D3Z3Y02GRFF6 len=19 def=
GGGGATGTAGCTCAAGCAG
>LIBTEST1#964#1 acc=Taj1E4D3Z3Y02HMUP9 len=13 def=
TTGATGTTGCCAT
>LIBTEST1#964#2 acc=Taj1E4D3Z3Y02HMUP9 len=13 def=
TTGATGTTGCCAT
>LIBTEST1#965#1 acc=Taj1E4D3Z3Y02H0ROG len=23 def=
AAATTGGAGTGAAGGGAGCTCCA
>LIBTEST1#966#1 acc=Taj1E4D3Z3Y02IPTKG len=15 def=
GATAGCCGAGGTGAT
>LIBTEST1#966#2 acc=Taj1E4D3Z3Y02IPTKG len=15 def=
GATAGCCGAGGTGAT
>LIBTEST1#967#1 acc=Taj1E4D3Z3Y02GHCB1 len=20 def=
GTTTCCCACAGACGGCGCCA
>LIBTEST1#968#1 acc=Taj1E4D3Z3Y02I8WH3 len=17 def=
GCTGGGAGATCCTGATA
>LIBTEST1#969#1 acc=Taj1E4D3Z3Y02F7JMQ len=22 def=
CATGTGATTGGACATGATTTAC
>LIBTEST1#970#1 acc=Taj1E4D3Z3Y02IO06K len=24 def=
AGGATCTGATACCATCTTAGAAAT
>LIBTEST1#971#1 acc=Taj1E4D3Z3Y02GWKBH len=24 def=
ATTGGATATCATGTAGCCAACCTC
>LIBTEST1#972#1 acc=Taj1E4D3Z3Y02F8LVH len=25 def=
ACTTGACTGGTCGCCTTACACTCTG
>LIBTEST1#973#1 acc=Taj1E4D3Z3Y02HRHO2 len=23 def=
TGTAGATATCAATGATCACTTCA
>LIBTEST1#974#1 acc=Taj1E4D3Z3Y02IGWEA len=24 def=
TGGGTGGCTAGATACCGTTTGACC
>LIBTEST1#975#1 acc=Taj1E4D3Z3Y02G7XH6 len=13 def=
GTAGCGTTTGATA
>LIBTEST1#975#2 acc=Taj1E4D3Z3Y02G7XH6 len=13 def=
GTAGCGTTTGATA
>LIBTEST1#976#1 acc=Taj1E4D3Z3Y02HJQOG len=15 def=
ATACTGATACTGATA
>LIBTEST1#976#2 acc=Taj1E4D3Z3Y02HJQOG len=15 def=
ATACTGATACTGATA
>LIBTEST1#976#3 acc=Taj1E4D3Z3Y02HJQOG len=15 def=
ATACTGATACTGATA
>LIBTEST1#977#1 acc=Taj1E4D3Z3Y02I0V18 len=27 def=
CGGCGGCGCCGACATGCCGGTGGTGGT
>LIBTEST1#978#1 acc=Taj1E4D3Z3Y02I78LK len=15 def=
TAGCGGTACCTGATA
>LIBTEST1#979#1 acc=Taj1E4D3Z3Y02JYV9F len=14 def=
CGGATGTGATGATA
>LIBTEST1#980#1 acc=Taj1E4D3Z3Y02GA6Q7 len=19 def=
CCGGTACGATAATCCGACT
>LIBTEST1#981#1 acc=Taj1E4D3Z3Y02G3C8V len=24 def=
AATAACCGTCCAAAACCACATCCT
>LIBTEST1#981#2 acc=Taj1E4D3Z3Y02G3C8V len=24 def=
AATAACCGTCCAAAACCACATCCT
>LIBTEST1#981#3 acc=Taj1E4D3Z3Y02G3C8V len=24 def=
AATAACCGTCCAAAACCACATCCT
>LIBTEST1#981#4 acc=Taj1E4D3Z3Y02G3C8V len=24 def=
AATAACCGTCCAAAACCACATCCT
>LIBTEST1#981#5 acc=Taj1E4D3Z3Y02G3C8V len=24 def=
AATAACCGTCCAAAACCACATCCT
>LIBTEST1#981#6 acc=Taj1E4D3Z3Y02G3C8V len=24 def=
AATAACCGTCCAAAACCACATCCT
>LIBTEST1#981#7 acc=Taj1E4D3Z3Y02G3C8V len=24 def=
AATAACCGTCCAAAACCACATCCT
>LIBTEST1#981#8 acc=Taj1E4D3Z3Y02G3C8V len=24 def=
AATAACCGTCCAAAACCACATCCT
>LIBTEST1#981#9 acc=Taj1E4D3Z3Y02G3C8V len=24 def=
AATAACCGTCCAAAACCACATCCT
>LIBTEST1#982#1 acc=Taj1E4D3Z3Y02JUF7M len=14 def=
TAGCGGTCCTGATA
>LIBTEST1#982#2 acc=Taj1E4D3Z3Y02JUF7M len=14 def=
TAGCGGTCCTGATA
>LIBTEST1#982#3 acc=Taj1E4D3Z3Y02JUF7M len=14 def=
TAGCGGTCCTGATA
>LIBTEST1#982#4 acc=Taj1E4D3Z3Y02JUF7M len=14 def=
TAGCGGTCCTGATA
>LIBTEST1#982#5 acc=Taj1E4D3Z3Y02JUF7M len=14 def=
TAGCGGTCCTGATA
>LIBTEST1#983#1 acc=Taj1E4D3Z3Y02FV8GF len=14 def=
TGTGATCCATATCT
>LIBTEST1#983#2 acc=Taj1E4D3Z3Y02FV8GF len=14 def=
TGTGATCCATATCT
>LIBTEST1#984#1 acc=Taj1E4D3Z3Y02H4OD3 len=23 def=
AGAATGACTCTCGGCAACATTGA
>LIBTEST1#984#2 acc=Taj1E4D3Z3Y02H4OD3 len=23 def=
AGAATGACTCTCGGCAACATTGA
>LIBTEST1#985#1 acc=Taj1E4D3Z3Y02HX2T6 len=16 def=
GTAGCGTACCTGGATA
>LIBTEST1#986#1 acc=Taj1E4D3Z3Y02G5HME len=27 def=
AGTCAACATTTTTGGATGATGTGCCAT
>LIBTEST1#987#1 acc=Taj1E4D3Z3Y02JX8TE len=16 def=
TAGCGTACCTGATAAG
>LIBTEST1#988#1 acc=Taj1E4D3Z3Y02JY69C len=15 def=
TCGTAGCTCCTTGCG
>LIBTEST1#988#2 acc=Taj1E4D3Z3Y02JY69C len=15 def=
TCGTAGCTCCTTGCG
>LIBTEST1#989#1 acc=Taj1E4D3Z3Y02FTLOW len=21 def=
AGAATCTTGATGATCCTGCAG
>LIBTEST1#990#1 acc=Taj1E4D3Z3Y02G6P8D len=21 def=
TTCCACAGCTTTCTTGAACTA
>LIBTEST1#991#1 acc=Taj1E4D3Z3Y02JWENB len=29 def=
CCTGATACCGATGGGACGAAGAGATGAAC
>LIBTEST1#992#1 acc=Taj1E4D3Z3Y02JZKTH len=20 def=
TGATATTGATCCGGCTCATC
>LIBTEST1#993#1 acc=Taj1E4D3Z3Y02GTI58 len=22 def=
TCAGACGCTGATGTGGCACGCC
>LIBTEST1#994#1 acc=Taj1E4D3Z3Y02FLCUW len=13 def=
CTGATACTGATAA
>LIBTEST1#994#2 acc=Taj1E4D3Z3Y02FLCUW len=13 def=
CTGATACTGATAA
>LIBTEST1#995#1 acc=Taj1E4D3Z3Y02ISWCQ len=19 def=
CTACTCCTGTGCGTGTCTC
>LIBTEST1#996#1 acc=Taj1E4D3Z3Y02I2CX6 len=18 def=
CCTGATAGAGGTACGGGG
>LIBTEST1#996#2 acc=Taj1E4D3Z3Y02I2CX6 len=18 def=
CCTGATAGAGGTACGGGG
>LIBTEST1#997#1 acc=Taj1E4D3Z3Y02HB60L len=14 def=
TACATGTCACAACT
>LIBTEST1#998#1 acc=Taj1E4D3Z3Y02H2HYT len=24 def=
TGTGGGATCCATTTAAGACCTCAA
>LIBTEST1#999#1 acc=Taj1E4D3Z3Y02I1OGN len=24 def=
TTCTTTGGCTTTAGTCAAGCATTT
>LIBTEST1#1000#1 acc=Taj1E4D3Z3Y02FU8CR len=23 def=
TCGGACCAGGCTTCATTCCCCAC
>LIBTEST1#1000#2 acc=Taj1E4D3Z3Y02FU8CR len=23 def=
TCGGACCAGGCTTCATTCCCCAC
>LIBTEST1#1001#1 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1001#2 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1001#3 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1001#4 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1001#5 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1001#6 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1001#7 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1001#8 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1001#9 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1001#10 acc=Taj1E4D3Z3Y02GFLIU len=22 def=
TCGGACCAGGCTTCATTCCCCA
>LIBTEST1#1002#1 acc=Taj1E4D3Z3Y02HZVM7 len=20 def=
AGCTGCTTAGCTATGGATCC
>LIBTEST1#1002#2 acc=Taj1E4D3Z3Y02HZVM7 len=20 def=
AGCTGCTTAGCTATGGATCC
>LIBTEST1#1003#1 acc=Taj1E4D3Z3Y02GIY15 len=21 def=
CGATACGTAGCCGTCTGATAC
>LIBTEST1#1004#1 acc=Taj1E4D3Z3Y02HQ9LJ len=13 def=
CCTGATATAGATA
>LIBTEST1#1005#1 acc=Taj1E4D3Z3Y02GI53E len=21 def=
ACTTCAAAATGGTGTTTGGAT
>LIBTEST1#1006#1 acc=Taj1E4D3Z3Y02IZ2YT len=13 def=
CTTGAGCTGCATA
>LIBTEST1#1007#1 acc=Taj1E4D3Z3Y02IASI3 len=13 def=
GGCGGTCGCTATA
>LIBTEST1#1008#1 acc=Taj1E4D3Z3Y02GL1NE len=22 def=
CGGCCAACCAAAGTTATCAGGA
>LIBTEST1#1008#2 acc=Taj1E4D3Z3Y02GL1NE len=22 def=
CGGCCAACCAAAGTTATCAGGA
>LIBTEST1#1009#1 acc=Taj1E4D3Z3Y02GKP9J len=19 def=
TGAAGCTGCCAGCATGATC
>LIBTEST1#1010#1 acc=Taj1E4D3Z3Y02GM7V5 len=22 def=
TCTCGATCAATTCAAGTGCATA
>LIBTEST1#1010#2 acc=Taj1E4D3Z3Y02GM7V5 len=22 def=
TCTCGATCAATTCAAGTGCATA
>LIBTEST1#1011#1 acc=Taj1E4D3Z3Y02HVVZL len=16 def=
ATTGATGGGTGCNCAC
>LIBTEST1#1011#2 acc=Taj1E4D3Z3Y02HVVZL len=16 def=
ATTGATGGGTGCNCAC
>LIBTEST1#1012#1 acc=Taj1E4D3Z3Y02F5OGR len=14 def=
CTGATACCTGATAT
>LIBTEST1#1013#1 acc=Taj1E4D3Z3Y02G3B6Z len=22 def=
TGATGGAGTAGAGCATGAATCT
>LIBTEST1#1014#1 acc=Taj1E4D3Z3Y02JEZ15 len=20 def=
GCCCCACGGTGGGCGCCAAT
>LIBTEST1#1015#1 acc=Taj1E4D3Z3Y02I8XVP len=14 def=
TCGGATACCTGATA
>LIBTEST1#1016#1 acc=Taj1E4D3Z3Y02IK57F len=18 def=
TTCTCTGGAGTTAACTGC
>LIBTEST1#1017#1 acc=Taj1E4D3Z3Y02HQDSL len=23 def=
CAACGGTCACCTGCTTTGGTGTA
>LIBTEST1#1018#1 acc=Taj1E4D3Z3Y02HF3EW len=15 def=
TTTGTGAAGGGAGCT
>LIBTEST1#1019#1 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#2 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#3 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#4 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#5 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#6 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#7 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#8 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#9 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#10 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#11 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#12 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#13 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#14 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#15 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#16 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#17 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#18 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1019#19 acc=Taj1E4D3Z3Y02GRRF5 len=17 def=
TGCTGTTAAAAAGCTCG
>LIBTEST1#1020#1 acc=Taj1E4D3Z3Y02F2ZNH len=24 def=
TTAGGTATGCTAAGCTTGTGCCTC
>LIBTEST1#1021#1 acc=Taj1E4D3Z3Y02IOVHT len=18 def=
CGGTTGGCTCGTCCCATA
>LIBTEST1#1022#1 acc=Taj1E4D3Z3Y02GCX3Q len=24 def=
CTGGATGCGCACCAATTGATGGTG
>LIBTEST1#1023#1 acc=Taj1E4D3Z3Y02I7XPN len=21 def=
CTGATACCTGATAATTATGGT
>LIBTEST1#1024#1 acc=Taj1E4D3Z3Y02II89L len=21 def=
GAAAGACGTAGTAGCCTGCGA
>LIBTEST1#1025#1 acc=Taj1E4D3Z3Y02GRMTW len=24 def=
ATGGAGAGATGACTAGGTCAATCG
>LIBTEST1#1026#1 acc=Taj1E4D3Z3Y02GUD9K len=22 def=
TCTCGGACCAGGCTTCATTCCA
>LIBTEST1#1027#1 acc=Taj1E4D3Z3Y02G4WK8 len=21 def=
TTCAAGGACGATCACTCGCTT
>LIBTEST1#1028#1 acc=Taj1E4D3Z3Y02JGB0B len=14 def=
GCAGCGTCCGGATA
>LIBTEST1#1029#1 acc=Taj1E4D3Z3Y02HB7EN len=23 def=
GTAGCGTCTGATAGCGTCTGATA
>LIBTEST1#1030#1 acc=Taj1E4D3Z3Y02INO4I len=18 def=
ACCCTGCTGTCGACGCCA
>LIBTEST1#1031#1 acc=Taj1E4D3Z3Y02JSGU9 len=26 def=
ATCTTCTTTTACGCTGCAGCGATGAT
>LIBTEST1#1032#1 acc=Taj1E4D3Z3Y02HYDGY len=23 def=
TACTCACCTGTTGCGTGTCTCAG
>LIBTEST1#1033#1 acc=Taj1E4D3Z3Y02G58K3 len=19 def=
TAGTCAGGAGATGTAACCC
>LIBTEST1#1034#1 acc=Taj1E4D3Z3Y02JQT33 len=21 def=
ACGTATACAGGACGCGTACGA
>LIBTEST1#1035#1 acc=Taj1E4D3Z3Y02I2X5O len=18 def=
TAGCGTCCGTGAGTAATT
>LIBTEST1#1036#1 acc=Taj1E4D3Z3Y02FNADO len=14 def=
GGTAGGTCGGACCA
>LIBTEST1#1037#1 acc=Taj1E4D3Z3Y02GHXXP len=13 def=
GATAGTCCTGATA
>LIBTEST1#1037#2 acc=Taj1E4D3Z3Y02GHXXP len=13 def=
GATAGTCCTGATA
>LIBTEST1#1037#3 acc=Taj1E4D3Z3Y02GHXXP len=13 def=
GATAGTCCTGATA
>LIBTEST1#1038#1 acc=Taj1E4D3Z3Y02IPS3T len=21 def=
TTAGATGCATAATATCTACTT
>LIBTEST1#1038#2 acc=Taj1E4D3Z3Y02IPS3T len=21 def=
TTAGATGCATAATATCTACTT
>LIBTEST1#1039#1 acc=Taj1E4D3Z3Y02IJ6PL len=25 def=
ACTTGATAGGTTGCCTACGACTCTG
>LIBTEST1#1040#1 acc=Taj1E4D3Z3Y02JHYN5 len=22 def=
GATGGCGTATGAGGAGCCAAGC
>LIBTEST1#1040#2 acc=Taj1E4D3Z3Y02JHYN5 len=22 def=
GATGGCGTATGAGGAGCCAAGC
>LIBTEST1#1041#1 acc=Taj1E4D3Z3Y02G0FWW len=27 def=
CAGCCCTTGTCGCTTCGATTCGTATTG
>LIBTEST1#1042#1 acc=Taj1E4D3Z3Y02IX1PF len=14 def=
TCTGATACTGATAA
>LIBTEST1#1043#1 acc=Taj1E4D3Z3Y02JNMQS len=17 def=
TAGTCAGGACGCGTACG
>LIBTEST1#1044#1 acc=Taj1E4D3Z3Y02HHHC0 len=20 def=
ACGGGCCAGTCCGTCCCCCT
>LIBTEST1#1045#1 acc=Taj1E4D3Z3Y02JVL00 len=25 def=
GACATCACACACGGTGGTGCATTGA
>LIBTEST1#1046#1 acc=Taj1E4D3Z3Y02HAGQ2 len=26 def=
CGAAAGACTAAGGTTTCCTGGGCGAC
>LIBTEST1#1047#1 acc=Taj1E4D3Z3Y02G2RMA len=22 def=
TGGTCAGCAATGAACAGGTCTG
>LIBTEST1#1047#2 acc=Taj1E4D3Z3Y02G2RMA len=22 def=
TGGTCAGCAATGAACAGGTCTG
>LIBTEST1#1048#1 acc=Taj1E4D3Z3Y02F6O02 len=16 def=
GTAGCGTTACCTGATA
>LIBTEST1#1049#1 acc=Taj1E4D3Z3Y02JP2QW len=22 def=
GTCCTGATAGTCATTGATGGTG
>LIBTEST1#1050#1 acc=Taj1E4D3Z3Y02ICJUP len=17 def=
ATTAAGCGTCCGTGATA
>LIBTEST1#1051#1 acc=Taj1E4D3Z3Y02HJW5G len=26 def=
TAGCGGTCCTGATATAATTGATGGTG
>LIBTEST1#1052#1 acc=Taj1E4D3Z3Y02H1F3T len=16 def=
GTAGCGTCCATTGATG
>LIBTEST1#1053#1 acc=Taj1E4D3Z3Y02HP6BV len=18 def=
TAGATGAGGCGTGATAAC
>LIBTEST1#1054#1 acc=Taj1E4D3Z3Y02GI7JI len=24 def=
AATTGTGAAAATGACAAGGACTGG
>LIBTEST1#1055#1 acc=Taj1E4D3Z3Y02JB8MC len=19 def=
GGCATTCAGGCGAGCCGCC
>LIBTEST1#1056#1 acc=Taj1E4D3Z3Y02HDVZP len=22 def=
ATATTTGGATTGAAGGGAGCTC
>LIBTEST1#1057#1 acc=Taj1E4D3Z3Y02IC3WS len=16 def=
CAAGATAGTTCATGGA
>LIBTEST1#1058#1 acc=Taj1E4D3Z3Y02GGH5B len=24 def=
TATCATAAATCCATGTGTTATGCC
>LIBTEST1#1059#1 acc=Taj1E4D3Z3Y02FY12V len=25 def=
ATTCGATGGTAGTCCTACACGTCTC
>LIBTEST1#1060#1 acc=Taj1E4D3Z3Y02G2HN1 len=23 def=
TGCCTGGCACGTGTGCACTTCCC
>LIBTEST1#1061#1 acc=Taj1E4D3Z3Y02JETZY len=24 def=
TCGACTTTCGACACCAGATCCACG
>LIBTEST1#1062#1 acc=Taj1E4D3Z3Y02HBMK3 len=19 def=
ACCGGGCACTACGGTGAGA
>LIBTEST1#1063#1 acc=Taj1E4D3Z3Y02IH6N1 len=24 def=
TGCTTTGATTTTTGTATCACTACC
>LIBTEST1#1064#1 acc=Taj1E4D3Z3Y02F1QYX len=15 def=
CCCGCGACCTGATAG
>LIBTEST1#1065#1 acc=Taj1E4D3Z3Y02G01JN len=24 def=
GCGCGCTAACCTAGATTGATGGTG
>LIBTEST1#1066#1 acc=Taj1E4D3Z3Y02GDGRP len=15 def=
GTAGGTCCTGATAAT
>LIBTEST1#1067#1 acc=Taj1E4D3Z3Y02JE6OS len=13 def=
TAGCGTCGAGATA
>LIBTEST1#1068#1 acc=Taj1E4D3Z3Y02JMSA5 len=21 def=
TCCTGATATCCTTATTGATGG
>LIBTEST1#1069#1 acc=Taj1E4D3Z3Y02JPLS5 len=17 def=
ATCGAGCGTCTCGATAA
>LIBTEST1#1070#1 acc=Taj1E4D3Z3Y02J35SV len=15 def=
ATTGATGGTGGCCTA
>LIBTEST1#1070#2 acc=Taj1E4D3Z3Y02J35SV len=15 def=
ATTGATGGTGGCCTA
>LIBTEST1#1071#1 acc=Taj1E4D3Z3Y02INYS1 len=20 def=
CTACTTTTAACGTTATGATA
>LIBTEST1#1072#1 acc=Taj1E4D3Z3Y02F4MV4 len=22 def=
TTTGTGAGTATCCAAGCAGTTG
>LIBTEST1#1073#1 acc=Taj1E4D3Z3Y02HMNFM len=21 def=
GAAGCTGCCAGCATGATCTGT
>LIBTEST1#1074#1 acc=Taj1E4D3Z3Y02HZXI1 len=13 def=
ATTTTTGATGGTG
>LIBTEST1#1075#1 acc=Taj1E4D3Z3Y02IG0DR len=16 def=
TCCTGATACTGATATA
>LIBTEST1#1075#2 acc=Taj1E4D3Z3Y02IG0DR len=16 def=
TCCTGATACTGATATA
>LIBTEST1#1076#1 acc=Taj1E4D3Z3Y02HECHQ len=24 def=
CAGGGTGCCACGTCTAACACCGCT
>LIBTEST1#1077#1 acc=Taj1E4D3Z3Y02HDQBY len=20 def=
CCGGAGAGATCTGGGAGTGC
>LIBTEST1#1078#1 acc=Taj1E4D3Z3Y02GLRBJ len=21 def=
GTCCTCGGGATGCTGATTACC
>LIBTEST1#1079#1 acc=Taj1E4D3Z3Y02IWV7E len=14 def=
ATTGATGTGCTACA
>LIBTEST1#1079#2 acc=Taj1E4D3Z3Y02IWV7E len=14 def=
ATTGATGTGCTACA
>LIBTEST1#1080#1 acc=Taj1E4D3Z3Y02HOJBO len=21 def=
TTTCCAATTCCACCCATTCCT
>LIBTEST1#1081#1 acc=Taj1E4D3Z3Y02JSPZH len=16 def=
TAGCATAGTGCTTCCG
>LIBTEST1#1082#1 acc=Taj1E4D3Z3Y02HPYCN len=14 def=
TGATAGTCCTGATA
>LIBTEST1#1082#2 acc=Taj1E4D3Z3Y02HPYCN len=14 def=
TGATAGTCCTGATA
>LIBTEST1#1082#3 acc=Taj1E4D3Z3Y02HPYCN len=14 def=
TGATAGTCCTGATA
>LIBTEST1#1083#1 acc=Taj1E4D3Z3Y02HPTG7 len=24 def=
CCTGATATCGGCTGTTGGCGGACT
>LIBTEST1#1084#1 acc=Taj1E4D3Z3Y02GA12B len=22 def=
ATTGGAGTGAAGGGAGCTCCAT
>LIBTEST1#1085#1 acc=Taj1E4D3Z3Y02IILND len=24 def=
TCCTGCTCCTGCTCCATCCAGTCC
>LIBTEST1#1086#1 acc=Taj1E4D3Z3Y02J0YBX len=22 def=
TCGATCCACGCTCACCGCACCA
>LIBTEST1#1087#1 acc=Taj1E4D3Z3Y02GK9S3 len=28 def=
GACCGACGCGGATTGTGATGGTGGCATA
>LIBTEST1#1088#1 acc=Taj1E4D3Z3Y02GWLUT len=19 def=
GGTCCCACCGTGATCGCCA
>LIBTEST1#1088#2 acc=Taj1E4D3Z3Y02GWLUT len=19 def=
GGTCCCACCGTGATCGCCA
>LIBTEST1#1089#1 acc=>Taj1E4D3Z3Y02G3YT1 len=13 def=
TGATAGTAGCGTC
>LIBTEST1#1089#2 acc=>Taj1E4D3Z3Y02G3YT1 len=13 def=
TGATAGTAGCGTC
>LIBTEST1#1089#3 acc=>Taj1E4D3Z3Y02G3YT1 len=13 def=
TGATAGTAGCGTC
>LIBTEST1#1089#4 acc=>Taj1E4D3Z3Y02G3YT1 len=13 def=
TGATAGTAGCGTC
>LIBTEST1#1090#1 acc=Taj1E4D3Z3Y02JCHF6 len=23 def=
TGGGTACGGGGTGGGCATTGGGT
>LIBTEST1#1090#2 acc=Taj1E4D3Z3Y02JCHF6 len=23 def=
TGGGTACGGGGTGGGCATTGGGT
>LIBTEST1#1091#1 acc=Taj1E4D3Z3Y02F97H8 len=22 def=
TCACCGTCAAGACATAGACCTT
>LIBTEST1#1091#2 acc=Taj1E4D3Z3Y02F97H8 len=22 def=
TCACCGTCAAGACATAGACCTT
>LIBTEST1#1091#3 acc=Taj1E4D3Z3Y02F97H8 len=22 def=
TCACCGTCAAGACATAGACCTT
>LIBTEST1#1092#1 acc=Taj1E4D3Z3Y02FU299 len=22 def=
GTTATTGGGTCTTGTTAACGAT
>LIBTEST1#1093#1 acc=Taj1E4D3Z3Y02IMWUC len=15 def=
CCTGATAGATATAGC
>LIBTEST1#1094#1 acc=Taj1E4D3Z3Y02JAS47 len=20 def=
TGGAGAAGCAGGGCACGTGC
>LIBTEST1#1094#2 acc=Taj1E4D3Z3Y02JAS47 len=20 def=
TGGAGAAGCAGGGCACGTGC
>LIBTEST1#1095#1 acc=Taj1E4D3Z3Y02HA0WZ len=22 def=
CCTCCGGACCTTAGCCAACTCC
>LIBTEST1#1096#1 acc=Taj1E4D3Z3Y02HAAAM len=24 def=
GGGATAGCTTTTGCCACGTGGCCC
>LIBTEST1#1097#1 acc=Taj1E4D3Z3Y02JHP2O len=19 def=
TATACTAGGACGCGTACGA
>LIBTEST1#1098#1 acc=Taj1E4D3Z3Y02FPSH2 len=21 def=
ATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#1098#2 acc=Taj1E4D3Z3Y02FPSH2 len=21 def=
ATCCCCTGTTGCGTGTCTCAG
>LIBTEST1#1099#1 acc=Taj1E4D3Z3Y02GHRYR len=26 def=
TCCTGATACTGATAATTGATGGATTG
>LIBTEST1#1099#2 acc=Taj1E4D3Z3Y02GHRYR len=26 def=
TCCTGATACTGATAATTGATGGATTG
>LIBTEST1#1100#1 acc=Taj1E4D3Z3Y02G385D len=14 def=
GTTGCGTGTCTCAG
>LIBTEST1#1101#1 acc=Taj1E4D3Z3Y02H8XTL len=25 def=
ACGATGCCTGCAGCATTGGCAACAA
>LIBTEST1#1101#2 acc=Taj1E4D3Z3Y02H8XTL len=25 def=
ACGATGCCTGCAGCATTGGCAACAA
>LIBTEST1#1102#1 acc=Taj1E4D3Z3Y02IATE0 len=24 def=
AGAGACCCCCATCCTCTACCGCCG
>LIBTEST1#1103#1 acc=Taj1E4D3Z3Y02GYVF6 len=20 def=
AAGCTGCCAGCATGATCTGT
>LIBTEST1#1103#2 acc=Taj1E4D3Z3Y02GYVF6 len=20 def=
AAGCTGCCAGCATGATCTGT
>LIBTEST1#1104#1 acc=Taj1E4D3Z3Y02J5MQT len=15 def=
GATAGTCCTGATAAT
>LIBTEST1#1105#1 acc=Taj1E4D3Z3Y02IPTUB len=14 def=
CTGATATAAACACC
>LIBTEST1#1106#1 acc=Taj1E4D3Z3Y02IR1DI len=16 def=
AGTTGTGGGACTCAAT
>LIBTEST1#1107#1 acc=Taj1E4D3Z3Y02G29T0 len=21 def=
ACCGACGTGTTGGCAGTTGTC
>LIBTEST1#1107#2 acc=Taj1E4D3Z3Y02G29T0 len=21 def=
ACCGACGTGTTGGCAGTTGTC
>LIBTEST1#1108#1 acc=Taj1E4D3Z3Y02H1YMA len=17 def=
CGAGGACCTATTTTGCT
>LIBTEST1#1109#1 acc=Taj1E4D3Z3Y02GWP42 len=13 def=
GTGCGTGTCTCAG
>LIBTEST1#1110#1 acc=Taj1E4D3Z3Y02G4QGQ len=24 def=
TCGTGCGACGTTGGTTTGTTCGTC
>LIBTEST1#1111#1 acc=Taj1E4D3Z3Y02IN06S len=27 def=
GCACGATCCGTAGCGTACCTTGATAAG
>LIBTEST1#1112#1 acc=Taj1E4D3Z3Y02GHAGM len=15 def=
AGCGAATTGTCTGGT
>LIBTEST1#1112#2 acc=Taj1E4D3Z3Y02GHAGM len=15 def=
AGCGAATTGTCTGGT
>LIBTEST1#1112#3 acc=Taj1E4D3Z3Y02GHAGM len=15 def=
AGCGAATTGTCTGGT
>LIBTEST1#1113#1 acc=Taj1E4D3Z3Y02FJU5P len=21 def=
TCCCTTGAAGTAGTGATGTTG
>LIBTEST1#1113#2 acc=Taj1E4D3Z3Y02FJU5P len=21 def=
TCCCTTGAAGTAGTGATGTTG
>LIBTEST1#1113#3 acc=Taj1E4D3Z3Y02FJU5P len=21 def=
TCCCTTGAAGTAGTGATGTTG
>LIBTEST1#1113#4 acc=Taj1E4D3Z3Y02FJU5P len=21 def=
TCCCTTGAAGTAGTGATGTTG
>LIBTEST1#1113#5 acc=Taj1E4D3Z3Y02FJU5P len=21 def=
TCCCTTGAAGTAGTGATGTTG
>LIBTEST1#1114#1 acc=Taj1E4D3Z3Y02GBUIY len=15 def=
AGCTTGGGTGGCGCA
>LIBTEST1#1115#1 acc=Taj1E4D3Z3Y02IUPOW len=24 def=
TAGCCTCGATGTGGATGGTCCCCC
>LIBTEST1#1116#1 acc=Taj1E4D3Z3Y02HISZI len=13 def=
ACGCTATTATATC
>LIBTEST1#1117#1 acc=Taj1E4D3Z3Y02HGQ3R len=13 def=
CTGATAGGTTCTG
>LIBTEST1#1118#1 acc=Taj1E4D3Z3Y02I5XEI len=24 def=
GTGTCGTGTTCGGGGTTTGAATCC
>LIBTEST1#1119#1 acc=Taj1E4D3Z3Y02HR9MN len=13 def=
ACTTTGACTGGTC
>LIBTEST1#1120#1 acc=Taj1E4D3Z3Y02IZMCC len=20 def=
ATCATCACGATTGGTGGGCT
>LIBTEST1#1121#1 acc=Taj1E4D3Z3Y02FXYEX len=27 def=
TTTCACGTCAGGTTCACCAATTGATGG
>LIBTEST1#1122#1 acc=Taj1E4D3Z3Y02GAIWG len=22 def=
CTGTCGCAGGAGTGATGGGACC
>LIBTEST1#1123#1 acc=Taj1E4D3Z3Y02JTJ0M len=21 def=
GCGTCCTAGTATAATTGGATC
>LIBTEST1#1124#1 acc=Taj1E4D3Z3Y02JV06V len=24 def=
ATATGGAGAAGCAGGGCACGTGCA
>LIBTEST1#1125#1 acc=Taj1E4D3Z3Y02IUSAX len=25 def=
TCTGATTGGTTTGGGAATGCAGCCC
>LIBTEST1#1126#1 acc=Taj1E4D3Z3Y02IEERE len=17 def=
ATACGGTACAGACCCCG
>LIBTEST1#1127#1 acc=Taj1E4D3Z3Y02HT1NT len=24 def=
TGCTTCAATGTGATTCTATCAACA
>LIBTEST1#1128#1 acc=Taj1E4D3Z3Y02IFZ96 len=17 def=
TTCTTGTCGACAGTTTA
>LIBTEST1#1129#1 acc=Taj1E4D3Z3Y02JSG96 len=25 def=
CGTCATCATCACGATTGATGGTGAT
>LIBTEST1#1130#1 acc=Taj1E4D3Z3Y02I3R2E len=15 def=
TGGGAGAAAAGATAG
>LIBTEST1#1131#1 acc=Taj1E4D3Z3Y02GODEM len=16 def=
AACTGATATCCTGATA
>LIBTEST1#1132#1 acc=Taj1E4D3Z3Y02IKR40 len=20 def=
TTTGGATTGAAGGAGCTCTA
>LIBTEST1#1133#1 acc=Taj1E4D3Z3Y02HN7M5 len=15 def=
TTAGCGTCCGTGATA
>LIBTEST1#1133#2 acc=Taj1E4D3Z3Y02HN7M5 len=15 def=
TTAGCGTCCGTGATA
>LIBTEST1#1133#3 acc=Taj1E4D3Z3Y02HN7M5 len=15 def=
TTAGCGTCCGTGATA
>LIBTEST1#1134#1 acc=Taj1E4D3Z3Y02HZUD7 len=15 def=
TTGAGCGCGATTAGT
>LIBTEST1#1135#1 acc=Taj1E4D3Z3Y02ICB2O len=16 def=
ATTAAGATGTACCATT
>LIBTEST1#1136#1 acc=Taj1E4D3Z3Y02GWM67 len=14 def=
TCCTGATAATGATA
>LIBTEST1#1137#1 acc=Taj1E4D3Z3Y02GAHBO len=24 def=
ACGAATATCTTGATTTGTAAAAAT
>LIBTEST1#1138#1 acc=Taj1E4D3Z3Y02F9N7Y len=15 def=
CTCTGATAGATAGTC
>LIBTEST1#1139#1 acc=Taj1E4D3Z3Y02GX92E len=20 def=
TCGGACCAGGCTTCATTCCA
>LIBTEST1#1140#1 acc=Taj1E4D3Z3Y02F274A len=26 def=
CCTTGCCTATCCCCTGTTGCGTGTCT
>LIBTEST1#1141#1 acc=Taj1E4D3Z3Y02F4593 len=13 def=
TAATCTGATATCT
>LIBTEST1#1142#1 acc=Taj1E4D3Z3Y02HVFWX len=16 def=
ATGTTACTTTAGTTAC
>LIBTEST1#1143#1 acc=Taj1E4D3Z3Y02G3FAD len=15 def=
TCGTAGCGTATATTT
>LIBTEST1#1144#1 acc=Taj1E4D3Z3Y02GQDOU len=15 def=
CTACGCAAGAGCACT
>LIBTEST1#1145#1 acc=Taj1E4D3Z3Y02FXY7A len=15 def=
ATAATAGTCTGGGTT
>LIBTEST1#1146#1 acc=Taj1E4D3Z3Y02GZNXE len=16 def=
ACGTCTCCAGAGTAGT
>LIBTEST1#1147#1 acc=Taj1E4D3Z3Y02GF57E len=14 def=
AGTTCTTCTGGTTA
>LIBTEST1#1148#1 acc=Taj1E4D3Z3Y02IAI5K len=24 def=
ATATAAGATCTGGGGTTCAAACCT
>LIBTEST1#1149#1 acc=Taj1E4D3Z3Y02I0E8E len=24 def=
CCCAATGACTGTAGCGGGAAACCC
>LIBTEST1#1150#1 acc=Taj1E4D3Z3Y02IE9MI len=15 def=
TTAATCAGGGAAATC
>LIBTEST1#1150#2 acc=Taj1E4D3Z3Y02IE9MI len=15 def=
TTAATCAGGGAAATC
>LIBTEST1#1150#3 acc=Taj1E4D3Z3Y02IE9MI len=15 def=
TTAATCAGGGAAATC
>LIBTEST1#1151#1 acc=Taj1E4D3Z3Y02ISC0B len=24 def=
AATGAGATGTAGGAATAAAGGGTG
>LIBTEST1#1152#1 acc=Taj1E4D3Z3Y02JS0C5 len=24 def=
TTCCGGTGTCGGACATGCATCGGC
>LIBTEST1#1153#1 acc=Taj1E4D3Z3Y02HWMY4 len=13 def=
GCACAAGGGAGCT
>LIBTEST1#1154#1 acc=Taj1E4D3Z3Y02F1EBV len=18 def=
TCCGTCGTAGTAATTAGT
>LIBTEST1#1155#1 acc=Taj1E4D3Z3Y02HCCEA len=13 def=
CTTGTTACCGATG
>LIBTEST1#1156#1 acc=Taj1E4D3Z3Y02IL6TB len=15 def=
GTCCTGTACGGTCGG
>LIBTEST1#1157#1 acc=Taj1E4D3Z3Y02IL65A len=21 def=
TGAAGTGTTTGGGGGAACTCT
>LIBTEST1#1158#1 acc=Taj1E4D3Z3Y02H6Q3G len=14 def=
CAGAGTGGTAGGCA
>LIBTEST1#1159#1 acc=Taj1E4D3Z3Y02GM9L5 len=13 def=
GTCCTGATATGAT
>LIBTEST1#1159#2 acc=Taj1E4D3Z3Y02GM9L5 len=13 def=
GTCCTGATATGAT
>LIBTEST1#1159#3 acc=Taj1E4D3Z3Y02GM9L5 len=13 def=
GTCCTGATATGAT
>LIBTEST1#1159#4 acc=Taj1E4D3Z3Y02GM9L5 len=13 def=
GTCCTGATATGAT
>LIBTEST1#1160#1 acc=Taj1E4D3Z3Y02IPS2F len=19 def=
GAGAAGTCCACTGAACATA
>LIBTEST1#1160#2 acc=Taj1E4D3Z3Y02IPS2F len=19 def=
GAGAAGTCCACTGAACATA
>LIBTEST1#1161#1 acc=Taj1E4D3Z3Y02JFAX0 len=27 def=
CCTGATAGACTGCTTGAGCTGCTCCCC
>LIBTEST1#1162#1 acc=Taj1E4D3Z3Y02IHTO1 len=26 def=
GTCCTGATATCGGACCAGGCTTCATT
>LIBTEST1#1163#1 acc=Taj1E4D3Z3Y02I6EFE len=24 def=
GGGGAATGAAGCCTGGTCCGATAT
>LIBTEST1#1164#1 acc=Taj1E4D3Z3Y02FVWIA len=15 def=
TATTGTAAGTGACAA
>LIBTEST1#1164#2 acc=Taj1E4D3Z3Y02FVWIA len=15 def=
TATTGTAAGTGACAA
>LIBTEST1#1164#3 acc=Taj1E4D3Z3Y02FVWIA len=15 def=
TATTGTAAGTGACAA
>LIBTEST1#1165#1 acc=Taj1E4D3Z3Y02GFHY8 len=26 def=
CGACGCATCATTCAAATTATTGATGG
>LIBTEST1#1165#2 acc=Taj1E4D3Z3Y02GFHY8 len=26 def=
CGACGCATCATTCAAATTATTGATGG
>LIBTEST1#1166#1 acc=Taj1E4D3Z3Y02JZHN0 len=24 def=
AGGATGTTACATGGTCCACCCCCC
>LIBTEST1#1167#1 acc=Taj1E4D3Z3Y02HZ2L9 len=20 def=
TCCTGATACATAAGCTGATA
>LIBTEST1#1168#1 acc=Taj1E4D3Z3Y02JPG14 len=23 def=
TCCAGTGCGCCCCTGGCGGCCCT
>LIBTEST1#1169#1 acc=Taj1E4D3Z3Y02FVZVW len=24 def=
ACCATAGATTTGGCCAAATAAACT
>LIBTEST1#1170#1 acc=Taj1E4D3Z3Y02JUC1R len=13 def=
AAATGTTGGAAGA
>LIBTEST1#1171#1 acc=Taj1E4D3Z3Y02JW60E len=20 def=
TCGCCTACACTGAGGAGTGN
>LIBTEST1#1172#1 acc=Taj1E4D3Z3Y02G7O0N len=16 def=
CTCTAAGGAGACTGCC
>LIBTEST1#1172#2 acc=Taj1E4D3Z3Y02G7O0N len=16 def=
CTCTAAGGAGACTGCC
>LIBTEST1#1173#1 acc=Taj1E4D3Z3Y02HI9HE len=24 def=
ATTCCGGGCACTCCACTTCTCTTC
>LIBTEST1#1174#1 acc=Taj1E4D3Z3Y02GS5XV len=23 def=
AATGTGCATGTGGCACCTCCACA
>LIBTEST1#1175#1 acc=Taj1E4D3Z3Y02GKPR3 len=18 def=
TACCTAGGCTCGCCGGAT
>LIBTEST1#1176#1 acc=Taj1E4D3Z3Y02IGLCK len=24 def=
GCCTTCCCTCGTTGCGTGTCTCAG
>LIBTEST1#1177#1 acc=Taj1E4D3Z3Y02HLU43 len=24 def=
CGACGAAGATGACCACGAGAACGA
>LIBTEST1#1178#1 acc=Taj1E4D3Z3Y02ISW3G len=19 def=
TTTGGATTGAAGGGAGCTC
>LIBTEST1#1178#2 acc=Taj1E4D3Z3Y02ISW3G len=19 def=
TTTGGATTGAAGGGAGCTC
>LIBTEST1#1178#3 acc=Taj1E4D3Z3Y02ISW3G len=19 def=
TTTGGATTGAAGGGAGCTC
>LIBTEST1#1179#1 acc=Taj1E4D3Z3Y02JFQRE len=24 def=
AATATCAACGGCTACGGCTGTGGA
>LIBTEST1#1180#1 acc=Taj1E4D3Z3Y02HRAYE len=16 def=
CCTATTGATGCTACAT
>LIBTEST1#1181#1 acc=Taj1E4D3Z3Y02F4WE3 len=24 def=
ACGTCTCTCTTGCTTGTGCGGTTG
>LIBTEST1#1182#1 acc=Taj1E4D3Z3Y02FR7BI len=21 def=
CCTGTCTAAACGCATGCCAGC
>LIBTEST1#1183#1 acc=Taj1E4D3Z3Y02I7QKQ len=14 def=
TTGGTTAGGCCTCC
>LIBTEST1#1184#1 acc=Taj1E4D3Z3Y02IX5F9 len=24 def=
ACGCGGGTTCGCTGGGTTGCACCC
>LIBTEST1#1185#1 acc=Taj1E4D3Z3Y02I42W0 len=27 def=
CTGAGACACGCAACAGGGGATAGTGAC
>LIBTEST1#1186#1 acc=Taj1E4D3Z3Y02FP3O8 len=24 def=
TAGGCCAAGCTTAAAATAAAGCCT
>LIBTEST1#1186#2 acc=Taj1E4D3Z3Y02FP3O8 len=24 def=
TAGGCCAAGCTTAAAATAAAGCCT
>LIBTEST1#1187#1 acc=Taj1E4D3Z3Y02I5DIL len=23 def=
TAGCGTCCCTGATAATTGATGGT
>LIBTEST1#1188#1 acc=Taj1E4D3Z3Y02GJ741 len=23 def=
GACATTGTCAGGTATTGAGTGGT
>LIBTEST1#1189#1 acc=Taj1E4D3Z3Y02JWPCI len=26 def=
CCGACCTTAGCTCAGTATTGATGGTG
>LIBTEST1#1189#2 acc=Taj1E4D3Z3Y02JWPCI len=26 def=
CCGACCTTAGCTCAGTATTGATGGTG
>LIBTEST1#1189#3 acc=Taj1E4D3Z3Y02JWPCI len=26 def=
CCGACCTTAGCTCAGTATTGATGGTG
>LIBTEST1#1190#1 acc=Taj1E4D3Z3Y02I0SNQ len=15 def=
TCCTGATGCCTGATA
>LIBTEST1#1191#1 acc=Taj1E4D3Z3Y02IK35O len=14 def=
CGGAGCGTCCGATA
>LIBTEST1#1192#1 acc=Taj1E4D3Z3Y02JIU2Y len=20 def=
AGGGACCGCTACCGATGTGC
>LIBTEST1#1193#1 acc=Taj1E4D3Z3Y02GPXQN len=23 def=
TAATAATATTGGTTGATTATGTG
>LIBTEST1#1194#1 acc=Taj1E4D3Z3Y02I6ZTN len=16 def=
CACTCTGGTCCTGATA
>LIBTEST1#1195#1 acc=Taj1E4D3Z3Y02J242X len=24 def=
TCGCAAATTAAGGTGTACCGATAC
>LIBTEST1#1196#1 acc=Taj1E4D3Z3Y02GSFMO len=25 def=
TATGCACTTGAATTGATCGAGATAT
>LIBTEST1#1197#1 acc=Taj1E4D3Z3Y02HQWDD len=13 def=
TCCTGATACTGAT
>LIBTEST1#1197#2 acc=Taj1E4D3Z3Y02HQWDD len=13 def=
TCCTGATACTGAT
>LIBTEST1#1197#3 acc=Taj1E4D3Z3Y02HQWDD len=13 def=
TCCTGATACTGAT
>LIBTEST1#1197#4 acc=Taj1E4D3Z3Y02HQWDD len=13 def=
TCCTGATACTGAT
>LIBTEST1#1198#1 acc=Taj1E4D3Z3Y02HJ0X8 len=24 def=
AAGGACCTCGAGTAAGGCTACTGC
>LIBTEST1#1199#1 acc=Taj1E4D3Z3Y02GWJ44 len=27 def=
TCCGGAGAGGGAGCCTGATTGATGGTG
>LIBTEST1#1199#2 acc=Taj1E4D3Z3Y02GWJ44 len=27 def=
TCCGGAGAGGGAGCCTGATTGATGGTG
>LIBTEST1#1200#1 acc=Taj1E4D3Z3Y02HFISY len=25 def=
ATACTTAGACTGAAGGGAGCTCCCT
>LIBTEST1#1201#1 acc=Taj1E4D3Z3Y02F5JGS len=15 def=
TCGGACCAGGCTTCA
>LIBTEST1#1201#2 acc=Taj1E4D3Z3Y02F5JGS len=15 def=
TCGGACCAGGCTTCA
>LIBTEST1#1201#3 acc=Taj1E4D3Z3Y02F5JGS len=15 def=
TCGGACCAGGCTTCA
>LIBTEST1#1202#1 acc=Taj1E4D3Z3Y02H5QLR len=14 def=
ATTGGATGTGCCTA
>LIBTEST1#1203#1 acc=>Taj1E4D3Z3Y02JVRZC len=29 def=
GGGCACGTCTGCCTGGGTGTCAATTCGAT
>LIBTEST1#1204#1 acc=Taj1E4D3Z3Y02JKY5Y len=24 def=
ACATCAGACCTGAGATGAGTTTCT
>LIBTEST1#1205#1 acc=Taj1E4D3Z3Y02F1CET len=24 def=
ATAGGGTCGATGCCCGAGCGGTTA
>LIBTEST1#1206#1 acc=Taj1E4D3Z3Y02J2GKY len=24 def=
TTACTCTCTTCACTCTATTTTTGT
BIOSGetSequencesFromSequenceIds 2017.04.28 02:02:13 Execution time: 19 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetSequencesFromSequenceIds.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr,jonathan.kreplak@dijon.inra.fr

Sequences

Format

Show or HideShow perl code used to test Sequences format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromSequenceIds/test/BIOSGetSequencesFromSequenceIds.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromSequenceIds/test/BIOSGetSequencesFromSequenceIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test Sequences content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromSequenceIds/test/BIOSGetSequencesFromSequenceIds.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSequencesFromSequenceIds/test/BIOSGetSequencesFromSequenceIds.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for Sequences

>LIBTEST1#15#1 acc=Taj1E4D3Z3Y02IF2C0 len=28 def=
CTATATACTAGGACGCGTACGACTGTGC
>LIBTEST1#158#1 acc=Taj1E4D3Z3Y02JP28A len=23 def=
TATCTCCCTGTTGCGTGTCTCAG
>LIBTEST1#654#1 acc=Taj1E4D3Z3Y02GY7P8 len=27 def=
AGTTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#654#2 acc=Taj1E4D3Z3Y02GY7P8 len=27 def=
AGTTAGCGTCCGTGACTAATTGATGGT
>LIBTEST1#654#3 acc=Taj1E4D3Z3Y02GY7P8 len=27 def=
AGTTAGCGTCCGTGACTAATTGATGGT
BIOSGetSpecies 2017.04.28 02:02:16 Execution time: 2 s.

Functionnal tests failed

Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetSpecies.rdf
  • Contact: jonathan.kreplak@dijon.inra.fr

BIOS_species

Format

Show or HideShow perl code used to test BIOS_species format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSpecies/test/BIOSGetSpecies.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSpecies/test/BIOSGetSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"

Show or HideTest results

{pscam" cultivar="Cameor" ecotype="" isolate="" strain="" subspecies="" substrain="" variety="">Pisum sativum cv. Cameor</species>
  <taxonomy id="3888" ontology="NCBI"/>
  <organelle/>
</organism><?xml version="1.0"?>
<organism>
  <species code="}

Content

Show or Hide Show perl code used to test BIOS_species content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetSpecies/test/BIOSGetSpecies.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetSpecies/test/BIOSGetSpecies.xml.new Differences are reported as "[string in reference]{string in new result}"

Show or HideTest results

{pscam" cultivar="Cameor" ecotype="" isolate="" strain="" subspecies="" substrain="" variety="">Pisum sativum cv. Cameor</species>
  <taxonomy id="3888" ontology="NCBI"/>
  <organelle/>
</organism><?xml version="1.0"?>
<organism>
  <species code="}

Raw

Show or Hide Show raw output data for BIOS_species

<?xml version="1.0"?>
<organism>
  <species code="pscam" cultivar="Cameor" ecotype="" isolate="" strain="" subspecies="" substrain="" variety="">Pisum sativum cv. Cameor</species>
  <taxonomy id="3888" ontology="NCBI"/>
  <organelle/>
</organism><?xml version="1.0"?>
<organism>
  <species code="TEST" cultivar="lastachoeras" ecotype="" isolate="" strain="samatan" subspecies="" substrain="bezeril" variety="">Homo gascon gersus</species>
  <taxonomy id="32" ontology="NCBI"/>
  <organelle/>
</organism>
BIOSGetTableClusterExpression 2017.04.28 02:02:39 Execution time: 20 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetTableClusterExpression.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr,jonathan.kreplak@dijon.inra.fr

expression_data

Format

Show or HideShow perl code used to test expression_data format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test expression_data content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for expression_data

gene	length	type	version	product	pool1	pool2	TESTPROPERTY [LIBTEST1] [20140916]	TESTPROPERTY [LIBTEST2] [20140916]
4#CLUSTERTEST004					0	0	2	35
1#CLUSTERTEST002	79	mRNA	20140916	IPR000347:Plant metallothionein, family 15;	0	10	1	NULL
3#CLUSTERTEST001	111	mRNA	20140916	IPR003612:Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor;	40	14	12	22
2#CLUSTERTEST003	61	mRNA	20140916	IPR002067:Mitochondrial carrier protein; IPR018108:;	0	12
TOTAL					40	36

libraries_with_counts

Format

Show or HideShow perl code used to test libraries_with_counts format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test libraries_with_counts content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableClusterExpression/test/BIOSGetTableClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for libraries_with_counts

<?xml version="1.0"?>
<collection>
  <class count_nr="1206" count_raw="40" definition="" id="pool1" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="1206" count_raw="4348" definition="Test import BIOS DATA number 1" id="LIBTEST1" key="test_library1" tag="Taj" url=""/>
  </class>
  <class count_nr="3644" count_raw="36" definition="" id="pool2" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="3644" count_raw="4263" definition="Test import BIOS DATA number 2" id="LIBTEST2" key="test_library2" tag="Tax" url=""/>
  </class>
</collection>
BIOSGetTableRawExpression 2017.04.28 02:03:01 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetTableRawExpression.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr,jonathan.kreplak@dijon.inra.fr

expression_data

Format

Show or HideShow perl code used to test expression_data format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test expression_data content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for expression_data

gene	length	type	version	product	pool1	pool2
1801#Tax1E4D3Z3Y02JV1YZ	15				0	1
3074#Tax1E4D3Z3Y02HWG2H	23				0	1
3509#Tax1E4D3Z3Y02G7GAQ	15				0	1
3163#Tax1E4D3Z3Y02GL7JT	15				0	1
1178#Taj1E4D3Z3Y02ISW3G	19				3	0
4628#Tax1E4D3Z3Y02J3FXV	24				0	1
1387#Tax1E4D3Z3Y02GE196	21				0	1
1932#Tax1E4D3Z3Y02F835A	24				0	1
458#Taj1E4D3Z3Y02F01RE	13				49	0
1785#Tax1E4D3Z3Y02FSME6	16				0	1
2634#Tax1E4D3Z3Y02HWAPY	21				0	1
4361#Tax1E4D3Z3Y02J1DMG	14				0	1
1250#Tax1E4D3Z3Y02GJXQ5	22				0	1
2507#Tax1E4D3Z3Y02I9S1V	29				0	1
3957#Tax1E4D3Z3Y02GKAGZ	28				0	1
1630#Tax1E4D3Z3Y02GJBNQ	24				0	1
3497#Tax1E4D3Z3Y02HOQW6	21				0	1
3109#Tax1E4D3Z3Y02JYE4T	17				0	1
3185#Tax1E4D3Z3Y02GRCJ6	15				0	1
4340#Tax1E4D3Z3Y02IZUK5	29				0	1
3919#Tax1E4D3Z3Y02JBUQP	15				0	1
728#Taj1E4D3Z3Y02IEHDW	29				1	0
1244#Tax1E4D3Z3Y02I53RG	21				0	2
1638#Tax1E4D3Z3Y02G8C2E	13				0	1
3936#Tax1E4D3Z3Y02H76N4	18				0	1
29#Taj1E4D3Z3Y02G5B3E	16				1	0
350#Taj1E4D3Z3Y02GPDR3	23				1	0
4087#Tax1E4D3Z3Y02JJ72F	19				0	1
1969#Tax1E4D3Z3Y02GGUD6	20				0	1
1810#Tax1E4D3Z3Y02I2SEV	15				0	1
2203#Tax1E4D3Z3Y02JHS18	25				0	1
4358#Tax1E4D3Z3Y02HWFQQ	14				0	1
2754#Tax1E4D3Z3Y02IKZZF	24				0	1
1546#Tax1E4D3Z3Y02JBG47	21				0	1
2994#Tax1E4D3Z3Y02IZIJ8	22				0	1
3256#Tax1E4D3Z3Y02GIO49	16				0	1
4003#Tax1E4D3Z3Y02HYUMZ	30				0	1
311#Taj1E4D3Z3Y02J2M33	19				1	0
4537#Tax1E4D3Z3Y02G4IXA	21				0	1
4836#Tax1E4D3Z3Y02IEIXI	29				0	1
3844#Tax1E4D3Z3Y02JC18J	23				0	1
825#Taj1E4D3Z3Y02GN835	21				3	0
917#Taj1E4D3Z3Y02GOPTA	21				1	0
3431#Tax1E4D3Z3Y02H6N2G	21				0	1
495#Taj1E4D3Z3Y02IY12B	15				1	0
4501#Tax1E4D3Z3Y02JCYPV	20				0	1
3889#Tax1E4D3Z3Y02HEHEW	14				0	1
3302#Tax1E4D3Z3Y02I7FN3	27				0	1
1322#Tax1E4D3Z3Y02IXLZ2	17				0	1
2086#Tax1E4D3Z3Y02IMAM6	19				0	1
1816#Tax1E4D3Z3Y02JLGPN	24				0	2
2460#Tax1E4D3Z3Y02JXZIK	15				0	1
4293#Tax1E4D3Z3Y02HX53L	16				0	1
2699#Tax1E4D3Z3Y02IMWFW	19				0	1
1259#Tax1E4D3Z3Y02I74EN	22				0	1
2976#Tax1E4D3Z3Y02HK07P	16				0	3
3574#Tax1E4D3Z3Y02HO050	17				0	1
3824#Tax1E4D3Z3Y02HCDUR	23				0	1
3475#Tax1E4D3Z3Y02HA3JA	24				0	1
4319#Tax1E4D3Z3Y02JF1CC	18				0	1
3238#Tax1E4D3Z3Y02HBFBY	20				0	1
3421#Tax1E4D3Z3Y02JKUA0	21				0	1
2274#Tax1E4D3Z3Y02H06MV	21				0	1
2002#Tax1E4D3Z3Y02IZBFL	19				0	2
4591#Tax1E4D3Z3Y02HRERH	16				0	1
1203#>Taj1E4D3Z3Y02JVRZC	29				1	0
4261#Tax1E4D3Z3Y02JGKF6	15				0	3
2088#Tax1E4D3Z3Y02I1GM8	24				0	1
1068#Taj1E4D3Z3Y02JMSA5	21				1	0
4429#Tax1E4D3Z3Y02IZG88	15				0	1
486#Taj1E4D3Z3Y02HPCP0	24				1	0
1354#Tax1E4D3Z3Y02GJH47	27				0	1
2134#Tax1E4D3Z3Y02IJ3NF	24				0	1
4066#Tax1E4D3Z3Y02GFPIZ	27				0	1
4213#Tax1E4D3Z3Y02GCFPD	18				0	1
8#Taj1E4D3Z3Y02GEIUM	16				32	0
2359#Tax1E4D3Z3Y02JD18T	16				0	1
3239#Tax1E4D3Z3Y02G6TQG	14				0	1
2045#Tax1E4D3Z3Y02J0E0E	24				0	1
686#Taj1E4D3Z3Y02GRHJJ	18				1	0
3149#Tax1E4D3Z3Y02G8IEF	15				0	1
943#Taj1E4D3Z3Y02JYO88	20				1	0
1887#Tax1E4D3Z3Y02G971Y	23				0	1
4258#Tax1E4D3Z3Y02JRJ9H	24				0	1
1585#Tax1E4D3Z3Y02FS8ZX	24				0	1
4709#Tax1E4D3Z3Y02G3AWQ	17				0	1
2705#Tax1E4D3Z3Y02HXGEG	28				0	1
4474#Tax1E4D3Z3Y02FPNSH	14				0	1
690#Taj1E4D3Z3Y02GL9WT	21				6	0
61#Taj1E4D3Z3Y02HFJU1	21				1	0
4475#Tax1E4D3Z3Y02IUBD0	27				0	2
4094#Tax1E4D3Z3Y02HZCB0	19				0	1
3540#Tax1E4D3Z3Y02JUOJP	21				0	1
1266#Tax1E4D3Z3Y02JKWXD	14				0	1
2394#Tax1E4D3Z3Y02JR61H	24				0	2
4704#Tax1E4D3Z3Y02H2IW0	20				0	2
3326#Tax1E4D3Z3Y02GGEYA	21				0	2
3419#Tax1E4D3Z3Y02H22WR	14				0	1
2654#Tax1E4D3Z3Y02HY8NZ	16				0	1
4209#Tax1E4D3Z3Y02HN8Y6	16				0	1
4144#Tax1E4D3Z3Y02H2F3H	25				0	1
4784#Tax1E4D3Z3Y02H26Z2	16				0	1
3627#Tax1E4D3Z3Y02JNIQ6	17				0	1
39#Taj1E4D3Z3Y02HS0NG	25				1	0
558#Taj1E4D3Z3Y02IDUPA	14				1	0
3200#Tax1E4D3Z3Y02JJIK2	27				0	1
573#Taj1E4D3Z3Y02HM0DL	21				1	0
2710#Tax1E4D3Z3Y02IPPRC	13				0	8
1084#Taj1E4D3Z3Y02GA12B	22				1	0
4570#Tax1E4D3Z3Y02IGA2D	25				0	1
3446#Tax1E4D3Z3Y02JYD25	21				0	1
638#Taj1E4D3Z3Y02GOKNT	23				1	0
2350#Tax1E4D3Z3Y02GPEO0	22				0	1
2479#Tax1E4D3Z3Y02HPFPG	26				0	1
1#Taj1E4D3Z3Y02GXVWK	21				1	0
3218#Tax1E4D3Z3Y02JXI50	21				0	1
506#Taj1E4D3Z3Y02G14O5	18				1	0
4184#Tax1E4D3Z3Y02IAKUQ	23				0	1
2937#Tax1E4D3Z3Y02IXHE1	24				0	1
661#Taj1E4D3Z3Y02I6V3M	18				1	0
3157#Tax1E4D3Z3Y02HPM5B	15				0	1
2845#Tax1E4D3Z3Y02H80RO	22				0	1
2482#Tax1E4D3Z3Y02GBYE5	19				0	1
1935#Tax1E4D3Z3Y02F08LK	24				0	1
2719#Tax1E4D3Z3Y02IBGVP	22				0	1
2690#Tax1E4D3Z3Y02GX227	15				0	2
581#Taj1E4D3Z3Y02J1OSX	16				1	0
2727#Tax1E4D3Z3Y02F7VG6	20				0	1
4046#Tax1E4D3Z3Y02F4DGC	27				0	1
4676#Tax1E4D3Z3Y02FVC20	21				0	1
4200#Tax1E4D3Z3Y02JEG3K	20				0	1
4567#Tax1E4D3Z3Y02G9UKM	19				0	1
678#Taj1E4D3Z3Y02IP0BZ	22				1	0
4328#Tax1E4D3Z3Y02HCNTQ	15				0	1
1517#Tax1E4D3Z3Y02GTADW	19				0	1
3862#Tax1E4D3Z3Y02HQB1Q	20				0	1
2808#Tax1E4D3Z3Y02H8FTJ	16				0	1
1975#Tax1E4D3Z3Y02I85KX	26				0	1
3025#Tax1E4D3Z3Y02HA71V	13				0	1
1973#Tax1E4D3Z3Y02HPO8P	24				0	1
2910#Tax1E4D3Z3Y02GKJ1B	23				0	1
1991#Tax1E4D3Z3Y02FJSIQ	18				0	1
927#Taj1E4D3Z3Y02IMVDQ	24				1	0
3180#Tax1E4D3Z3Y02H57IH	27				0	1
2302#Tax1E4D3Z3Y02GTF6N	21				0	1
4827#Tax1E4D3Z3Y02I7PK7	14				0	1
3849#Tax1E4D3Z3Y02IKNV1	14				0	1
2745#Tax1E4D3Z3Y02GRQRG	14				0	2
652#Taj1E4D3Z3Y02G9DO1	26				1	0
2034#Tax1E4D3Z3Y02HZ57Z	21				0	1
2400#Tax1E4D3Z3Y02H0T23	14				0	1
4445#Tax1E4D3Z3Y02IGFSV	14				0	1
3851#Tax1E4D3Z3Y02HVYZP	15				0	2
4405#Tax1E4D3Z3Y02JLS27	26				0	1
2029#Tax1E4D3Z3Y02H2KC1	26				0	1
3552#Tax1E4D3Z3Y02G62TN	13				0	1
844#Taj1E4D3Z3Y02GVZJT	20				1	0
4447#Tax1E4D3Z3Y02JX014	24				0	1
4552#Tax1E4D3Z3Y02IM2U0	23				0	1
2723#Tax1E4D3Z3Y02JK15Z	27				0	1
4218#Tax1E4D3Z3Y02IB3B7	13				0	1
272#Taj1E4D3Z3Y02HXKSN	22				1	0
775#Taj1E4D3Z3Y02GRI0O	17				1	0
2518#Tax1E4D3Z3Y02FZFW9	25				0	1
20#Taj1E4D3Z3Y02GCC2Z	20				2	0
2376#Tax1E4D3Z3Y02GIPW5	24				0	1
1983#Tax1E4D3Z3Y02J3XKD	21				0	1
3100#Tax1E4D3Z3Y02GDCWT	17				0	1
3787#Tax1E4D3Z3Y02GOL5R	22				0	1
1627#Tax1E4D3Z3Y02IA7VO	16				0	1
3562#Tax1E4D3Z3Y02GROQF	13				0	1
4304#Tax1E4D3Z3Y02JDENS	24				0	4
4180#Tax1E4D3Z3Y02ILDSV	21				0	1
4139#Tax1E4D3Z3Y02JSADL	24				0	1
468#Taj1E4D3Z3Y02HUY56	14				22	0
3030#Tax1E4D3Z3Y02GBLOY	14				0	2
1019#Taj1E4D3Z3Y02GRRF5	17				19	0
700#Taj1E4D3Z3Y02IZWQW	13				4	0
78#Taj1E4D3Z3Y02IXDDG	15				1	0
3369#Tax1E4D3Z3Y02JE6LC	30				0	1
413#Taj1E4D3Z3Y02IG662	28				4	0
294#Taj1E4D3Z3Y02IWBVZ	24				1	0
764#Taj1E4D3Z3Y02H4B8Z	17				1	0
2075#Tax1E4D3Z3Y02FWJN8	17				0	1
1981#Tax1E4D3Z3Y02JJQPH	15				0	1
4582#Tax1E4D3Z3Y02GHRCK	26				0	1
3638#Tax1E4D3Z3Y02HAN7V	16				0	1
2081#Tax1E4D3Z3Y02IEBEO	15				0	1
606#Taj1E4D3Z3Y02IH2HW	17				1	0
4416#Tax1E4D3Z3Y02HYYK0	13				0	1
1855#Tax1E4D3Z3Y02HEL7D	15				0	1
2522#Tax1E4D3Z3Y02H0JVE	22				0	1
3559#Tax1E4D3Z3Y02IFQB5	23				0	1
432#Taj1E4D3Z3Y02HM3R3	21				1	0
4235#Tax1E4D3Z3Y02IMK76	14				0	1
2415#Tax1E4D3Z3Y02IBKMJ	22				0	2
708#Taj1E4D3Z3Y02IGEWK	13				1	0
2583#Tax1E4D3Z3Y02JHUVT	30				0	1
2589#Tax1E4D3Z3Y02JTCA6	24				0	1
3286#Tax1E4D3Z3Y02FS09W	29				0	1
2814#Tax1E4D3Z3Y02GIGQR	18				0	1
4764#Tax1E4D3Z3Y02JSL4L	16				0	1
710#Taj1E4D3Z3Y02JRV06	25				1	0
1656#Tax1E4D3Z3Y02JP21U	25				0	1
856#Taj1E4D3Z3Y02GOA4U	23				2	0
1664#Tax1E4D3Z3Y02I312M	13				0	1
112#Taj1E4D3Z3Y02GF2SB	14				18	0
3211#Tax1E4D3Z3Y02HWP2Z	19				0	1
191#Taj1E4D3Z3Y02IR7HE	26				1	0
4613#Tax1E4D3Z3Y02GUMOQ	27				0	1
3612#Tax1E4D3Z3Y02HL7I6	19				0	1
588#Taj1E4D3Z3Y02JU4RT	13				1	0
1684#Tax1E4D3Z3Y02H7EGA	14				0	1
756#Taj1E4D3Z3Y02FSAH9	24				1	0
262#Taj1E4D3Z3Y02HYKHX	17				1	0
1944#Tax1E4D3Z3Y02JL6OC	23				0	1
4422#Tax1E4D3Z3Y02HC2HU	21				0	1
2590#Tax1E4D3Z3Y02GXX4J	20				0	1
542#Taj1E4D3Z3Y02HLB3B	19				3	0
3114#Tax1E4D3Z3Y02G1MOQ	20				0	1
3750#Tax1E4D3Z3Y02IVSVB	28				0	1
4649#Tax1E4D3Z3Y02HN3LN	18				0	1
2099#Tax1E4D3Z3Y02I7I4E	15				0	1
2476#Tax1E4D3Z3Y02GMIHZ	24				0	1
2988#Tax1E4D3Z3Y02GBH39	19				0	1
170#Taj1E4D3Z3Y02G61S0	14				47	0
1921#Tax1E4D3Z3Y02HUFHZ	22				0	1
3217#Tax1E4D3Z3Y02H8FP0	15				0	1
26#Taj1E4D3Z3Y02G7KIZ	15				1	0
2116#Tax1E4D3Z3Y02JCCEZ	16				0	1
2250#Tax1E4D3Z3Y02I53FM	13				0	1
526#Taj1E4D3Z3Y02GFGMG	17				3	0
1901#Tax1E4D3Z3Y02IN4K1	22				0	1
3500#Tax1E4D3Z3Y02HVLOL	15				0	1
359#Taj1E4D3Z3Y02HGPBE	25				1	0
1229#Tax1E4D3Z3Y02JGQ54	25				0	1
2608#Tax1E4D3Z3Y02GN4PM	18				0	1
2614#Tax1E4D3Z3Y02HCLIA	24				0	2
1001#Taj1E4D3Z3Y02GFLIU	22				10	0
3694#Tax1E4D3Z3Y02GHBHO	24				0	1
232#Taj1E4D3Z3Y02JR8RV	15				1	0
3054#Tax1E4D3Z3Y02HHL5Z	21				0	1
3458#Tax1E4D3Z3Y02JMY9B	24				0	1
1182#Taj1E4D3Z3Y02FR7BI	21				1	0
225#Taj1E4D3Z3Y02FWUY7	25				1	0
1447#Tax1E4D3Z3Y02J2DUA	16				0	5
207#Taj1E4D3Z3Y02IGIZJ	24				1	0
142#Taj1E4D3Z3Y02HWRHS	25				5	0
1510#Tax1E4D3Z3Y02IZZQX	21				0	1
48#Taj1E4D3Z3Y02GNMG2	24				1	0
4491#>Tax1E4D3Z3Y02HSSVY	20				0	1
3641#Tax1E4D3Z3Y02HM6GN	29				0	1
3585#Tax1E4D3Z3Y02IE6D2	14				0	1
3170#Tax1E4D3Z3Y02JX1LO	16				0	1
1988#Tax1E4D3Z3Y02H1B7G	23				0	2
3923#Tax1E4D3Z3Y02I138S	17				0	1
3135#Tax1E4D3Z3Y02I6Q6J	27				0	1
3730#Tax1E4D3Z3Y02HJ4R2	26				0	1
4128#Tax1E4D3Z3Y02I5HCC	30				0	1
3665#Tax1E4D3Z3Y02JYOSB	21				0	1
4356#Tax1E4D3Z3Y02I5A71	20				0	1
4343#Tax1E4D3Z3Y02GC19S	19				0	1
4376#Tax1E4D3Z3Y02IY2WG	21				0	1
4243#Tax1E4D3Z3Y02HZJET	15				0	1
659#Taj1E4D3Z3Y02J1PDF	23				1	0
2763#Tax1E4D3Z3Y02I2HEZ	18				0	2
2774#Tax1E4D3Z3Y02JLSOI	16				0	1
1141#Taj1E4D3Z3Y02F4593	13				1	0
984#Taj1E4D3Z3Y02H4OD3	23				2	0
1155#Taj1E4D3Z3Y02HCCEA	13				1	0
3372#Tax1E4D3Z3Y02JUA8M	16				0	1
1485#Tax1E4D3Z3Y02G9ZV8	17				0	1
788#Taj1E4D3Z3Y02HE0KG	21				11	0
128#Taj1E4D3Z3Y02GDX0O	15				1	0
4797#Tax1E4D3Z3Y02G13RN	16				0	1
4115#Tax1E4D3Z3Y02JZ59C	18				0	9
1313#Tax1E4D3Z3Y02FY8EX	24				0	1
278#Taj1E4D3Z3Y02G6QMV	15				1	0
1617#Tax1E4D3Z3Y02H1UZT	24				0	1
3521#Tax1E4D3Z3Y02J1HVU	20				0	1
490#Taj1E4D3Z3Y02GPCBZ	24				3	0
1843#Tax1E4D3Z3Y02ITRIT	27				0	1
2626#Tax1E4D3Z3Y02JQR6B	13				0	2
1112#Taj1E4D3Z3Y02GHAGM	15				3	0
1294#Tax1E4D3Z3Y02J0OVE	22				0	1
461#Taj1E4D3Z3Y02GA389	24				1	0
2712#Tax1E4D3Z3Y02H82D8	24				0	1
1426#Tax1E4D3Z3Y02HOYR4	22				0	1
1562#Tax1E4D3Z3Y02GY1L7	17				0	1
3451#Tax1E4D3Z3Y02I84ZB	24				0	1
1358#Tax1E4D3Z3Y02F4XHX	24				0	1
4640#Tax1E4D3Z3Y02JAEOL	26				0	1
782#Taj1E4D3Z3Y02F8YZS	24				1	0
3647#Tax1E4D3Z3Y02IW1ZY	19				0	1
1557#Tax1E4D3Z3Y02JY5Q1	15				0	1
2281#Tax1E4D3Z3Y02HA3D2	18				0	1
1486#Tax1E4D3Z3Y02H7PVG	17				0	2
425#Taj1E4D3Z3Y02I3PBU	21				1	0
2056#Tax1E4D3Z3Y02IX2YZ	16				0	1
2876#Tax1E4D3Z3Y02GJLJU	26				0	1
3607#Tax1E4D3Z3Y02IG6YV	28				0	1
3428#Tax1E4D3Z3Y02HTG4Q	18				0	1
3648#Tax1E4D3Z3Y02G7JQP	24				0	2
781#Taj1E4D3Z3Y02HCSS2	23				1	0
3015#Tax1E4D3Z3Y02GDFHS	16				0	1
1950#Tax1E4D3Z3Y02JEB3Q	14				0	1
2782#Tax1E4D3Z3Y02IN24G	29				0	1
2037#Tax1E4D3Z3Y02I31K6	16				0	1
532#Taj1E4D3Z3Y02FYMKM	21				1	0
1193#Taj1E4D3Z3Y02GPXQN	23				1	0
2455#Tax1E4D3Z3Y02H3UWT	17				0	4
3963#Tax1E4D3Z3Y02J0J02	16				0	1
55#Taj1E4D3Z3Y02GHAQG	16				1	0
1890#Tax1E4D3Z3Y02JCY80	22				0	1
3592#Tax1E4D3Z3Y02GRUYJ	23				0	1
1681#Tax1E4D3Z3Y02GO83D	26				0	1
872#Taj1E4D3Z3Y02G9BJ3	19				1	0
1146#Taj1E4D3Z3Y02GZNXE	16				1	0
395#Taj1E4D3Z3Y02IE6CV	13				2	0
89#Taj1E4D3Z3Y02G65IQ	28				9	0
988#Taj1E4D3Z3Y02JY69C	15				2	0
4342#Tax1E4D3Z3Y02HR6EZ	16				0	1
2295#Tax1E4D3Z3Y02JWZ7X	14				0	2
3584#Tax1E4D3Z3Y02FE3D5	18				0	1
1550#Tax1E4D3Z3Y02FY2C8	14				0	1
1454#Tax1E4D3Z3Y02GN3HA	18				0	3
2533#Tax1E4D3Z3Y02IR6IY	24				0	1
3960#Tax1E4D3Z3Y02GHEXV	13				0	1
1584#Tax1E4D3Z3Y02H7QVI	17				0	1
4434#Tax1E4D3Z3Y02HYSP4	22				0	2
1675#Tax1E4D3Z3Y02F5AKU	24				0	1
649#Taj1E4D3Z3Y02G1Y5Q	21				1	0
1318#Tax1E4D3Z3Y02HSYY1	18				0	1
2150#Tax1E4D3Z3Y02I25YG	14				0	1
3903#Tax1E4D3Z3Y02GGOQJ	22				0	1
642#Taj1E4D3Z3Y02G6NU7	16				1	0
1764#Tax1E4D3Z3Y02I7MX1	14				0	1
3348#Tax1E4D3Z3Y02GB4SU	26				0	1
1908#Tax1E4D3Z3Y02J3R4G	20				0	1
4291#Tax1E4D3Z3Y02JH763	21				0	1
1718#Tax1E4D3Z3Y02IXMEX	16				0	1
2792#Tax1E4D3Z3Y02JFD09	27				0	1
1098#Taj1E4D3Z3Y02FPSH2	21				2	0
3003#Tax1E4D3Z3Y02ICWRT	15				0	1
4849#Tax1E4D3Z3Y02I23HZ	27				0	1
2665#Tax1E4D3Z3Y02JD76Z	22				0	1
4609#Tax1E4D3Z3Y02IC8BJ	21				0	1
184#Taj1E4D3Z3Y02HCTA2	25				1	0
776#Taj1E4D3Z3Y02F8SBG	19				1	0
3738#Tax1E4D3Z3Y02IYPO0	22				0	1
1570#Tax1E4D3Z3Y02JUJ3R	23				0	1
2673#Tax1E4D3Z3Y02FE1H1	27				0	1
1269#Tax1E4D3Z3Y02IS2A4	21				0	1
181#Taj1E4D3Z3Y02I18ZW	14				1	0
412#Taj1E4D3Z3Y02GMSEF	24				5	0
1671#Tax1E4D3Z3Y02HL33Z	15				0	1
4242#Tax1E4D3Z3Y02G1UV9	16				0	1
830#Taj1E4D3Z3Y02GMW0Q	22				2	0
3721#Tax1E4D3Z3Y02JN1EF	24				0	1
2062#Tax1E4D3Z3Y02IL4ZX	21				0	1
2893#Tax1E4D3Z3Y02F05F2	24				0	1
3935#Tax1E4D3Z3Y02JFEA5	13				0	1
1101#Taj1E4D3Z3Y02H8XTL	25				2	0
326#Taj1E4D3Z3Y02HFNCT	25				1	0
1165#Taj1E4D3Z3Y02GFHY8	26				2	0
2886#Tax1E4D3Z3Y02JNVDX	14				0	1
2543#Tax1E4D3Z3Y02JNBK1	14				0	2
3940#Tax1E4D3Z3Y02H08F9	19				0	1
335#Taj1E4D3Z3Y02JB5MA	18				1	0
3531#Tax1E4D3Z3Y02IABQ9	21				0	1
4681#Tax1E4D3Z3Y02ILMM3	19				0	1
4287#Tax1E4D3Z3Y02I2RFI	13				0	1
2791#Tax1E4D3Z3Y02F1A2F	15				0	1
4481#Tax1E4D3Z3Y02I58YG	25				0	1
1867#Tax1E4D3Z3Y02F1EC7	24				0	1
4742#Tax1E4D3Z3Y02IDYCK	19				0	1
3969#Tax1E4D3Z3Y02I3LJG	15				0	1
4664#Tax1E4D3Z3Y02ISN0P	24				0	1
2505#Tax1E4D3Z3Y02JJU7Q	25				0	1
3533#Tax1E4D3Z3Y02H625Q	20				0	1
2936#Tax1E4D3Z3Y02JSJ1Z	21				0	1
440#Taj1E4D3Z3Y02HL7VG	21				1	0
1289#Tax1E4D3Z3Y02JHFVA	21				0	2
2525#Tax1E4D3Z3Y02HKNEM	28				0	1
841#Taj1E4D3Z3Y02GQLOE	24				1	0
1898#Tax1E4D3Z3Y02FVUXC	16				0	1
4668#Tax1E4D3Z3Y02H6Y9O	23				0	1
1044#Taj1E4D3Z3Y02HHHC0	20				1	0
3513#Tax1E4D3Z3Y02FR8VY	23				0	1
1751#Tax1E4D3Z3Y02HJDYD	13				0	1
4029#Tax1E4D3Z3Y02HEROT	27				0	1
91#Taj1E4D3Z3Y02HL29K	25				2	0
2137#Tax1E4D3Z3Y02IIWG0	14				0	1
4116#Tax1E4D3Z3Y02IRS19	15				0	1
467#Taj1E4D3Z3Y02GWHF9	21				3	0
2121#Tax1E4D3Z3Y02IMMNX	18				0	1
474#Taj1E4D3Z3Y02H9KU7	24				1	0
3563#Tax1E4D3Z3Y02II80H	25				0	1
563#Taj1E4D3Z3Y02GDP5A	20				1	0
2919#Tax1E4D3Z3Y02ICPOA	15				0	1
3248#Tax1E4D3Z3Y02IQSUU	14				0	2
2953#Tax1E4D3Z3Y02HSF7E	16				0	1
4058#Tax1E4D3Z3Y02HTY0Z	28				0	1
3489#Tax1E4D3Z3Y02HANP4	27				0	1
68#Taj1E4D3Z3Y02GKF96	22				1	0
4106#Tax1E4D3Z3Y02FTYCB	16				0	1
2514#Tax1E4D3Z3Y02J2BDB	24				0	1
3628#Tax1E4D3Z3Y02IXNPO	15				0	1
4176#Tax1E4D3Z3Y02IQA8R	23				0	1
3807#Tax1E4D3Z3Y02HYIER	13				0	1
3995#Tax1E4D3Z3Y02JA2PL	15				0	1
222#Taj1E4D3Z3Y02JAER4	22				2	0
2911#Tax1E4D3Z3Y02HPH1J	23				0	1
2418#Tax1E4D3Z3Y02JVO6D	24				0	1
3132#Tax1E4D3Z3Y02HR7KA	24				0	1
305#Taj1E4D3Z3Y02HYF79	30				1	0
928#Taj1E4D3Z3Y02HE34E	23				1	0
1644#Tax1E4D3Z3Y02J15SP	13				0	1
1526#Tax1E4D3Z3Y02GREWM	16				0	1
4560#Tax1E4D3Z3Y02H38BA	18				0	1
3245#Tax1E4D3Z3Y02GMJSI	18				0	1
4276#Tax1E4D3Z3Y02HOMPH	18				0	3
217#Taj1E4D3Z3Y02GW1JI	19				1	0
4815#Tax1E4D3Z3Y02FEU6P	28				0	1
4076#Tax1E4D3Z3Y02IBGOD	23				0	1
281#Taj1E4D3Z3Y02FIWVN	14				1	0
158#Taj1E4D3Z3Y02JP28A	23				1	0
3412#Tax1E4D3Z3Y02JYPY6	25				0	1
3832#Tax1E4D3Z3Y02I33CO	24				0	1
3658#Tax1E4D3Z3Y02JH3YZ	17				0	1
1418#Tax1E4D3Z3Y02F0519	24				0	1
36#Taj1E4D3Z3Y02JD0LJ	25				1	0
1368#Tax1E4D3Z3Y02JB6WV	24				0	1
472#Taj1E4D3Z3Y02IWJKR	24				1	0
748#Taj1E4D3Z3Y02GYR8R	24				1	0
1655#Tax1E4D3Z3Y02JG4SS	21				0	2
1943#Tax1E4D3Z3Y02FSRSI	13				0	1
132#Taj1E4D3Z3Y02HQPKQ	21				4	0
711#Taj1E4D3Z3Y02J3LYM	19				2	0
1791#Tax1E4D3Z3Y02H5U8K	13				0	3
3779#Tax1E4D3Z3Y02JEEHR	22				0	1
3747#Tax1E4D3Z3Y02I3HK8	14				0	1
2180#Tax1E4D3Z3Y02HHO4O	17				0	1
1428#Tax1E4D3Z3Y02GHD15	24				0	1
2769#Tax1E4D3Z3Y02JOUTR	14				0	1
4081#Tax1E4D3Z3Y02JCOC9	15				0	1
1018#Taj1E4D3Z3Y02HF3EW	15				1	0
1125#Taj1E4D3Z3Y02IUSAX	25				1	0
2279#Tax1E4D3Z3Y02J5SYS	25				0	1
741#Taj1E4D3Z3Y02GTTYQ	21				1	0
998#Taj1E4D3Z3Y02H2HYT	24				1	0
2806#Tax1E4D3Z3Y02GVJAB	15				0	1
1789#Tax1E4D3Z3Y02FW6WX	24				0	1
3032#Tax1E4D3Z3Y02HNXO0	18				0	1
4621#Tax1E4D3Z3Y02IP544	23				0	1
4831#Tax1E4D3Z3Y02GKYBQ	15				0	1
3880#Tax1E4D3Z3Y02G9U4R	13				0	1
2076#Tax1E4D3Z3Y02JZSQO	20				0	1
3192#Tax1E4D3Z3Y02GBDMS	16				0	1
3947#Tax1E4D3Z3Y02FN2NS	13				0	1
4757#Tax1E4D3Z3Y02J1WG2	20				0	1
4294#Tax1E4D3Z3Y02HVYUD	14				0	2
1545#Tax1E4D3Z3Y02JSRQD	16				0	1
1838#Tax1E4D3Z3Y02FZTMV	21				0	1
1773#Tax1E4D3Z3Y02J4I88	24				0	1
1058#Taj1E4D3Z3Y02GGH5B	24				1	0
3883#Tax1E4D3Z3Y02FO77V	26				0	1
3166#Tax1E4D3Z3Y02GBFO7	15				0	2
3704#Tax1E4D3Z3Y02I0W58	28				0	1
3392#Tax1E4D3Z3Y02HGQ33	14				0	2
2860#Tax1E4D3Z3Y02IJBQM	14				0	1
1535#Tax1E4D3Z3Y02IVX9P	14				0	1
3141#Tax1E4D3Z3Y02GSAAE	25				0	1
3775#Tax1E4D3Z3Y02ICMRB	16				0	1
4253#Tax1E4D3Z3Y02IEN42	24				0	1
1335#Tax1E4D3Z3Y02JBV45	16				0	2
3780#Tax1E4D3Z3Y02IY0JE	14				0	1
4652#Tax1E4D3Z3Y02HAO79	23				0	1
3974#Tax1E4D3Z3Y02JD7KT	26				0	1
4847#Tax1E4D3Z3Y02GYM10	18				0	1
3409#Tax1E4D3Z3Y02IJCC8	16				0	1
3918#Tax1E4D3Z3Y02GW6D3	24				0	2
4490#Tax1E4D3Z3Y02G65T9	22				0	1
165#Taj1E4D3Z3Y02F0FGF	24				3	0
2351#Tax1E4D3Z3Y02GREAK	13				0	2
4579#Tax1E4D3Z3Y02GZA2O	17				0	1
729#Taj1E4D3Z3Y02H7Q2T	14				1	0
4509#Tax1E4D3Z3Y02F2Q52	15				0	1
2#>Taj1E4D3Z3Y02GVGKD	17				1	0
4229#Tax1E4D3Z3Y02HT0IH	22				0	1
2125#Tax1E4D3Z3Y02I0BYJ	24				0	1
2553#Tax1E4D3Z3Y02GKMJR	24				0	1
1231#Tax1E4D3Z3Y02F73KK	29				0	1
2979#Tax1E4D3Z3Y02FTCJF	28				0	1
3270#Tax1E4D3Z3Y02JKCYG	16				0	1
2446#Tax1E4D3Z3Y02G0WBQ	14				0	1
973#Taj1E4D3Z3Y02HRHO2	23				1	0
2569#Tax1E4D3Z3Y02HV08Q	15				0	1
2961#Tax1E4D3Z3Y02GPM6Q	25				0	1
1046#Taj1E4D3Z3Y02HAGQ2	26				1	0
319#Taj1E4D3Z3Y02FTSPF	15				1	0
2571#Tax1E4D3Z3Y02H44UP	18				0	1
4021#Tax1E4D3Z3Y02I7NG0	24				0	1
2857#Tax1E4D3Z3Y02HVGPK	24				0	1
1179#Taj1E4D3Z3Y02JFQRE	24				1	0
1922#Tax1E4D3Z3Y02H0MZ3	13				0	1
735#Taj1E4D3Z3Y02GUNQU	25				1	0
3048#Tax1E4D3Z3Y02F5QOF	18				0	1
2948#Tax1E4D3Z3Y02J3FUL	17				0	1
1271#Tax1E4D3Z3Y02HXNO0	16				0	1
4566#Tax1E4D3Z3Y02IXRD0	16				0	1
344#Taj1E4D3Z3Y02HR6JQ	18				12	0
4682#Tax1E4D3Z3Y02H0C7L	16				0	1
2103#Tax1E4D3Z3Y02IUXR8	23				0	1
2949#Tax1E4D3Z3Y02JDGXP	16				0	1
1710#Tax1E4D3Z3Y02JL9TC	15				0	1
2224#Tax1E4D3Z3Y02JZEDM	25				0	1
4783#Tax1E4D3Z3Y02IAOBF	26				0	1
1133#Taj1E4D3Z3Y02HN7M5	15				3	0
2421#Tax1E4D3Z3Y02JOECL	14				0	1
209#Taj1E4D3Z3Y02HFNMR	23				1	0
2837#Tax1E4D3Z3Y02H37O3	23				0	1
4132#Tax1E4D3Z3Y02HOQ0M	24				0	1
4456#Tax1E4D3Z3Y02JQJPN	16				0	1
1118#Taj1E4D3Z3Y02I5XEI	24				1	0
1575#Tax1E4D3Z3Y02JUKO4	26				0	1
2428#Tax1E4D3Z3Y02JPWM1	19				0	2
4460#Tax1E4D3Z3Y02HGBAJ	16				0	1
4718#Tax1E4D3Z3Y02HRQXL	24				0	1
4191#Tax1E4D3Z3Y02H1TD5	26				0	1
80#Taj1E4D3Z3Y02HP5NA	25				1	0
600#Taj1E4D3Z3Y02HVE5R	23				2	0
336#Taj1E4D3Z3Y02I5DU4	24				2	0
457#Taj1E4D3Z3Y02IX77B	20				1	0
1301#Tax1E4D3Z3Y02I9TGY	23				0	1
383#Taj1E4D3Z3Y02H16WK	27				1	0
2532#Tax1E4D3Z3Y02IRBGR	13				0	1
3817#Tax1E4D3Z3Y02G99NA	13				0	1
1873#Tax1E4D3Z3Y02G4PZM	22				0	1
2497#Tax1E4D3Z3Y02IT5BE	24				0	1
3651#Tax1E4D3Z3Y02G6V5Q	18				0	1
4157#Tax1E4D3Z3Y02G1YXY	22				0	1
92#Taj1E4D3Z3Y02IUV12	21				1	0
1212#Tax1E4D3Z3Y02G0M2Y	13				0	1
3687#Tax1E4D3Z3Y02J5Y52	27				0	1
4791#Tax1E4D3Z3Y02HLDKB	18				0	1
2253#Tax1E4D3Z3Y02IRQRD	21				0	2
2433#Tax1E4D3Z3Y02GP5JC	21				0	1
2787#Tax1E4D3Z3Y02H1H0B	18				0	1
1477#Tax1E4D3Z3Y02HFNPE	17				0	1
1164#Taj1E4D3Z3Y02FVWIA	15				3	0
2824#Tax1E4D3Z3Y02FV5OH	20				0	1
4597#Tax1E4D3Z3Y02ING5A	24				0	1
505#Taj1E4D3Z3Y02FZ9YC	13				1	0
2739#Tax1E4D3Z3Y02JCE52	24				0	1
670#Taj1E4D3Z3Y02JIQ4Z	22				1	0
1094#Taj1E4D3Z3Y02JAS47	20				2	0
419#Taj1E4D3Z3Y02F9KYH	13				1	0
995#Taj1E4D3Z3Y02ISWCQ	19				1	0
837#Taj1E4D3Z3Y02JU5EG	29				2	0
2015#Tax1E4D3Z3Y02IFX9X	24				0	1
4521#Tax1E4D3Z3Y02I7RIC	14				0	2
149#Taj1E4D3Z3Y02GV8P5	15				3	0
625#Taj1E4D3Z3Y02HCAP1	24				1	0
3208#Tax1E4D3Z3Y02GQI96	16				0	2
3839#Tax1E4D3Z3Y02JI6YK	20				0	1
406#Taj1E4D3Z3Y02I3I35	20				1	0
2289#Tax1E4D3Z3Y02G2MOF	24				0	1
4798#Tax1E4D3Z3Y02IS6JA	15				0	1
3283#Tax1E4D3Z3Y02IQMGO	21				0	2
2312#Tax1E4D3Z3Y02IHQWY	24				0	1
19#Taj1E4D3Z3Y02HMG2U	13				1	0
3096#Tax1E4D3Z3Y02HVJUN	24				0	1
3637#Tax1E4D3Z3Y02IH6K1	15				0	1
365#Taj1E4D3Z3Y02HZB7A	24				1	0
1030#Taj1E4D3Z3Y02INO4I	18				1	0
2730#Tax1E4D3Z3Y02JV2KY	16				0	1
763#Taj1E4D3Z3Y02HACXC	15				2	0
3255#Tax1E4D3Z3Y02JGSDD	26				0	1
3332#Tax1E4D3Z3Y02F2M8K	17				0	1
4632#Tax1E4D3Z3Y02G7ZZY	22				0	1
2021#Tax1E4D3Z3Y02I486Z	24				0	1
3430#Tax1E4D3Z3Y02IZGPL	24				0	1
4590#Tax1E4D3Z3Y02FZNP2	16				0	1
3318#Tax1E4D3Z3Y02JU5G2	18				0	1
570#Taj1E4D3Z3Y02J3MGQ	28				1	0
1880#Tax1E4D3Z3Y02FSPSU	17				0	2
3123#Tax1E4D3Z3Y02G107F	17				0	1
3761#Tax1E4D3Z3Y02JDDD2	24				0	1
252#Taj1E4D3Z3Y02G3XJZ	16				1	0
3389#Tax1E4D3Z3Y02JA16T	20				0	1
4063#Tax1E4D3Z3Y02H87YN	16				0	1
883#Taj1E4D3Z3Y02HN1A4	21				4	0
4805#Tax1E4D3Z3Y02JPQ68	18				0	1
4610#Tax1E4D3Z3Y02HV1FJ	13				0	1
1998#Tax1E4D3Z3Y02HYLCQ	15				0	3
2930#Tax1E4D3Z3Y02HEVUQ	18				0	1
1367#Tax1E4D3Z3Y02JMMX5	25				0	1
3825#Tax1E4D3Z3Y02HBWG9	30				0	1
1070#Taj1E4D3Z3Y02J35SV	15				2	0
3117#Tax1E4D3Z3Y02HPFYD	16				0	1
3618#Tax1E4D3Z3Y02JJEV1	30				0	1
3275#Tax1E4D3Z3Y02IN9LB	27				0	1
2463#Tax1E4D3Z3Y02FTSJR	13				0	1
4332#Tax1E4D3Z3Y02F0H2X	29				0	1
2493#Tax1E4D3Z3Y02JBXCS	23				0	1
105#Taj1E4D3Z3Y02GPPPC	23				1	0
2380#Tax1E4D3Z3Y02JBGBH	20				0	1
4500#Tax1E4D3Z3Y02F78OK	26				0	1
111#Taj1E4D3Z3Y02G0PSO	26				1	0
3549#Tax1E4D3Z3Y02JOE7Q	24				0	1
408#Taj1E4D3Z3Y02GF26G	20				1	0
4776#Tax1E4D3Z3Y02HP2U4	15				0	1
3577#Tax1E4D3Z3Y02IU51O	13				0	1
2777#Tax1E4D3Z3Y02H1FYJ	15				0	1
559#Taj1E4D3Z3Y02GPQWQ	21				1	0
3601#Tax1E4D3Z3Y02HO1FX	14				0	1
580#Taj1E4D3Z3Y02HJXZ9	24				1	0
2800#Tax1E4D3Z3Y02I2RFY	14				0	1
2523#Tax1E4D3Z3Y02HIVZO	20				0	1
4618#Tax1E4D3Z3Y02JH13R	26				0	1
3808#Tax1E4D3Z3Y02H2BOS	19				0	1
1257#Tax1E4D3Z3Y02GTNXN	24				0	1
31#Taj1E4D3Z3Y02FX6AC	20				3	0
4717#Tax1E4D3Z3Y02JK2R9	27				0	1
4093#Tax1E4D3Z3Y02IWWXR	14				0	1
2307#Tax1E4D3Z3Y02HQVI9	21				0	1
2706#Tax1E4D3Z3Y02IQZU6	18				0	1
4439#Tax1E4D3Z3Y02HDNM0	13				0	1
4160#Tax1E4D3Z3Y02IQJXE	18				0	1
3336#Tax1E4D3Z3Y02IWUHP	28				0	1
2133#Tax1E4D3Z3Y02F99Q6	14				0	3
4629#Tax1E4D3Z3Y02GVURT	14				0	1
968#Taj1E4D3Z3Y02I8WH3	17				1	0
675#Taj1E4D3Z3Y02J2QRB	16				2	0
4722#Tax1E4D3Z3Y02I3FA2	13				0	1
431#Taj1E4D3Z3Y02F9W0J	17				1	0
3541#Tax1E4D3Z3Y02JNSUB	21				0	1
382#Taj1E4D3Z3Y02GJSWE	15				1	0
3487#Tax1E4D3Z3Y02HQWK7	16				0	1
2846#Tax1E4D3Z3Y02IOMLV	21				0	1
4208#Tax1E4D3Z3Y02GR4HP	19				0	1
4729#Tax1E4D3Z3Y02GNECV	23				0	1
4329#Tax1E4D3Z3Y02I35E9	23				0	1
3863#Tax1E4D3Z3Y02ISFUJ	15				0	1
139#Taj1E4D3Z3Y02GBBWC	24				1	0
129#Taj1E4D3Z3Y02H0PCC	13				73	0
4662#Tax1E4D3Z3Y02GIU7S	15				0	1
3008#Tax1E4D3Z3Y02GFD58	19				0	1
926#Taj1E4D3Z3Y02IFF7R	24				1	0
1246#Tax1E4D3Z3Y02JEDTH	29				0	1
4377#Tax1E4D3Z3Y02JDR6Q	17				0	1
1083#Taj1E4D3Z3Y02HPTG7	24				1	0
1293#Tax1E4D3Z3Y02FXQZA	30				0	1
4000#Tax1E4D3Z3Y02JW97T	20				0	1
1792#Tax1E4D3Z3Y02G55TB	13				0	1
3024#Tax1E4D3Z3Y02F8AR3	23				0	1
662#Taj1E4D3Z3Y02G5O7U	19				1	0
168#Taj1E4D3Z3Y02JHC0W	22				1	0
4789#Tax1E4D3Z3Y02JZ0GV	22				0	1
1518#Tax1E4D3Z3Y02GQBPT	14				0	1
3447#Tax1E4D3Z3Y02G3BO1	17				0	1
3444#Tax1E4D3Z3Y02G8IKC	28				0	1
178#Taj1E4D3Z3Y02JLAKL	23				1	0
2728#Tax1E4D3Z3Y02GJZ6U	21				0	1
3156#Tax1E4D3Z3Y02GWPCV	24				0	1
3439#Tax1E4D3Z3Y02FTO0Y	30				0	1
3992#Tax1E4D3Z3Y02FOUS6	14				0	1
124#Taj1E4D3Z3Y02JGIJE	14				1	0
1429#Tax1E4D3Z3Y02JYVZ2	25				0	1
4259#Tax1E4D3Z3Y02JHS2S	24				0	1
1974#Tax1E4D3Z3Y02G5P1B	24				0	1
2536#Tax1E4D3Z3Y02GXCDD	15				0	1
2483#Tax1E4D3Z3Y02IH806	23				0	1
3611#Tax1E4D3Z3Y02J3IK1	14				0	1
4350#Tax1E4D3Z3Y02I2VOD	15				0	1
1374#Tax1E4D3Z3Y02G5HBG	19				0	2
2303#Tax1E4D3Z3Y02JNM60	17				0	1
2807#Tax1E4D3Z3Y02F97OW	13				0	1
2259#Tax1E4D3Z3Y02JGD77	19				0	1
2212#Tax1E4D3Z3Y02JLPOB	19				0	1
716#Taj1E4D3Z3Y02G1HWR	14				1	0
1886#Tax1E4D3Z3Y02HTOW1	28				0	1
1972#Tax1E4D3Z3Y02IOHO7	24				0	1
940#Taj1E4D3Z3Y02GV4KL	13				4	0
685#Taj1E4D3Z3Y02GI6SQ	26				1	0
4169#Tax1E4D3Z3Y02HDNFW	16				0	1
21#Taj1E4D3Z3Y02J5PK2	15				3	0
523#Taj1E4D3Z3Y02G2JHZ	21				1	0
2377#Tax1E4D3Z3Y02HA9H8	20				0	1
3823#Tax1E4D3Z3Y02F8NP0	20				0	1
4360#Tax1E4D3Z3Y02F41YP	24				0	1
3975#Tax1E4D3Z3Y02JP0LP	23				0	1
1460#Tax1E4D3Z3Y02G0YVK	19				0	1
453#Taj1E4D3Z3Y02GBHX2	19				2	0
2500#Tax1E4D3Z3Y02JSI67	26				0	1
3937#Tax1E4D3Z3Y02HXO3L	13				0	1
1202#Taj1E4D3Z3Y02H5QLR	14				1	0
3162#Tax1E4D3Z3Y02JCW64	14				0	1
3303#Tax1E4D3Z3Y02I01CH	16				0	1
3895#Tax1E4D3Z3Y02H421L	18				0	1
351#Taj1E4D3Z3Y02GS6E2	13				1	0
2838#Tax1E4D3Z3Y02I5WK2	24				0	2
595#Taj1E4D3Z3Y02H995A	23				1	0
1854#Tax1E4D3Z3Y02IUZBZ	22				0	3
2926#Tax1E4D3Z3Y02IACI4	14				0	1
1498#Tax1E4D3Z3Y02F9V2F	18				0	1
835#Taj1E4D3Z3Y02FW0TO	21				1	0
1267#Tax1E4D3Z3Y02H4ICW	15				0	10
4620#Tax1E4D3Z3Y02GQ1RS	18				0	1
4015#Tax1E4D3Z3Y02JP5R3	16				0	1
113#Taj1E4D3Z3Y02IFY8G	21				20	0
901#Taj1E4D3Z3Y02JKZUV	28				1	0
2191#Tax1E4D3Z3Y02GNQ83	17				0	1
1056#Taj1E4D3Z3Y02HDVZP	22				1	0
3664#Tax1E4D3Z3Y02JOT2Q	17				0	1
3108#Tax1E4D3Z3Y02HKV9F	14				0	1
4285#Tax1E4D3Z3Y02G7HM6	17				0	1
4365#Tax1E4D3Z3Y02HPWMP	24				0	1
1473#Tax1E4D3Z3Y02HWX8A	19				0	1
2753#Tax1E4D3Z3Y02IJZUH	28				0	1
881#Taj1E4D3Z3Y02I7G8H	18				1	0
2461#Tax1E4D3Z3Y02HWNPM	16				0	1
3186#Tax1E4D3Z3Y02JBR0Y	14				0	1
405#Taj1E4D3Z3Y02FV1HY	21				1	0
507#Taj1E4D3Z3Y02IZ33M	24				1	0
1734#Tax1E4D3Z3Y02I6EUZ	24				0	1
3843#Tax1E4D3Z3Y02G8B8V	27				0	1
3565#Tax1E4D3Z3Y02IBKAJ	23				0	2
3230#Tax1E4D3Z3Y02ISLOR	14				0	1
1258#Tax1E4D3Z3Y02HIOHK	22				0	2
4030#Tax1E4D3Z3Y02JWD7H	15				0	1
2313#Tax1E4D3Z3Y02IFNO2	26				0	1
392#Taj1E4D3Z3Y02GQZJK	21				9	0
3653#Tax1E4D3Z3Y02I1AN6	27				0	1
2242#Tax1E4D3Z3Y02H0Z78	17				0	1
2254#Tax1E4D3Z3Y02JC81V	17				0	1
3354#Tax1E4D3Z3Y02HZW0R	22				0	1
813#Taj1E4D3Z3Y02IW7I8	23				1	0
2014#Tax1E4D3Z3Y02HNYPX	21				0	1
644#Taj1E4D3Z3Y02IHTDP	19				1	0
2477#Tax1E4D3Z3Y02IX48Z	19				0	1
1820#Tax1E4D3Z3Y02IEEJB	23				0	1
3360#Tax1E4D3Z3Y02JR1IR	13				0	1
2110#Tax1E4D3Z3Y02JRJLT	21				0	1
1342#Tax1E4D3Z3Y02I5SHG	25				0	1
1802#Tax1E4D3Z3Y02JV9J2	13				0	32
1968#Tax1E4D3Z3Y02JKITM	16				0	1
2457#Tax1E4D3Z3Y02F5RIU	16				0	1
4185#Tax1E4D3Z3Y02I5GS9	15				0	1
4359#Tax1E4D3Z3Y02GJ7AS	17				0	1
2775#Tax1E4D3Z3Y02IM6NQ	14				0	1
4009#Tax1E4D3Z3Y02I6AH6	24				0	1
4065#Tax1E4D3Z3Y02FR4EU	15				0	1
2273#Tax1E4D3Z3Y02HKSUC	24				0	1
3476#Tax1E4D3Z3Y02H60NX	22				0	1
791#Taj1E4D3Z3Y02G6YGW	13				1	0
3330#Tax1E4D3Z3Y02IQJLT	17				0	1
1355#Tax1E4D3Z3Y02G1V51	17				0	1
2231#Tax1E4D3Z3Y02IU6QG	18				0	1
3640#Tax1E4D3Z3Y02F3W7T	24				0	1
3095#Tax1E4D3Z3Y02GITWS	19				0	1
3231#Tax1E4D3Z3Y02IDJW7	21				0	1
3617#Tax1E4D3Z3Y02HBVBM	14				0	1
916#Taj1E4D3Z3Y02G9HU9	13				3	0
2043#Tax1E4D3Z3Y02GMRSC	23				0	1
3646#Tax1E4D3Z3Y02G7G6O	25				0	1
4828#Tax1E4D3Z3Y02G1ZET	16				0	1
329#Taj1E4D3Z3Y02GM580	26				1	0
525#Taj1E4D3Z3Y02GPG45	16				1	0
4476#Tax1E4D3Z3Y02F9NM6	14				0	1
787#Taj1E4D3Z3Y02HQGKQ	20				1	0
27#Taj1E4D3Z3Y02HX3AX	22				1	0
1561#Tax1E4D3Z3Y02HG0LZ	20				0	1
1902#Tax1E4D3Z3Y02H9J3N	16				0	1
2331#Tax1E4D3Z3Y02IBPO9	25				0	1
3909#Tax1E4D3Z3Y02HOT4K	24				0	1
1866#Tax1E4D3Z3Y02IUWGF	16				0	1
2001#Tax1E4D3Z3Y02GL3WL	20				0	1
3731#Tax1E4D3Z3Y02I333J	14				0	1
3736#Tax1E4D3Z3Y02HZEKG	27				0	1
4394#Tax1E4D3Z3Y02H2OR6	14				0	1
1310#Tax1E4D3Z3Y02JMHKQ	15				0	1
3216#Tax1E4D3Z3Y02IT97S	19				0	1
3459#Tax1E4D3Z3Y02IX13O	23				0	1
2115#Tax1E4D3Z3Y02F86UC	13				0	1
4703#Tax1E4D3Z3Y02IBTY4	22				0	1
4357#Tax1E4D3Z3Y02H36I6	19				0	1
4234#Tax1E4D3Z3Y02GPIQN	23				0	1
4578#Tax1E4D3Z3Y02IN0DH	27				0	1
3695#Tax1E4D3Z3Y02H836D	17				0	4
1239#Tax1E4D3Z3Y02G8SWT	14				0	1
4489#Tax1E4D3Z3Y02H3EIN	17				0	1
3035#Tax1E4D3Z3Y02J54I6	17				0	1
769#Taj1E4D3Z3Y02H3BJH	19				1	0
1181#Taj1E4D3Z3Y02F4WE3	24				1	0
1809#Tax1E4D3Z3Y02GUAFV	14				0	1
803#Taj1E4D3Z3Y02I99PV	13				1	0
2744#Tax1E4D3Z3Y02JP3V3	18				0	2
2559#Tax1E4D3Z3Y02JC851	14				0	1
4133#Tax1E4D3Z3Y02GXO4X	22				0	1
4796#Tax1E4D3Z3Y02JJDIF	15				0	1
3199#Tax1E4D3Z3Y02IPT3D	14				0	1
4669#Tax1E4D3Z3Y02G3FIG	21				0	1
60#Taj1E4D3Z3Y02I3RDT	22				1	0
1245#Tax1E4D3Z3Y02IZ9OJ	28				0	1
1400#Tax1E4D3Z3Y02HVY82	13				0	2
691#Taj1E4D3Z3Y02JW78T	18				1	0
1067#Taj1E4D3Z3Y02JE6OS	13				1	0
2615#Tax1E4D3Z3Y02HI3Y8	26				0	1
1388#Tax1E4D3Z3Y02H50VJ	24				0	1
1676#Tax1E4D3Z3Y02I8TPJ	15				0	1
3134#Tax1E4D3Z3Y02IV4XK	20				0	3
346#Taj1E4D3Z3Y02J0HB1	27				2	0
3085#Tax1E4D3Z3Y02GNALA	15				0	1
3171#Tax1E4D3Z3Y02JELK6	13				0	1
427#Taj1E4D3Z3Y02JCP7X	21				1	0
4735#Tax1E4D3Z3Y02H49O0	19				0	1
82#Taj1E4D3Z3Y02GK5Y5	17				1	0
2202#Tax1E4D3Z3Y02H1W6O	29				0	3
3464#Tax1E4D3Z3Y02IV56A	13				0	1
650#Taj1E4D3Z3Y02JCDZ2	16				1	0
4635#Tax1E4D3Z3Y02GM4IP	23				0	1
1154#Taj1E4D3Z3Y02F1EBV	18				1	0
895#Taj1E4D3Z3Y02HRU8Y	18				1	0
1763#Tax1E4D3Z3Y02JD094	21				0	1
4499#Tax1E4D3Z3Y02J0YQS	21				0	1
69#Taj1E4D3Z3Y02GXYOI	30				1	0
1910#Tax1E4D3Z3Y02FN5P1	17				0	1
4299#Tax1E4D3Z3Y02JYKPN	17				0	1
2762#Tax1E4D3Z3Y02HT8F1	14				0	2
3076#Tax1E4D3Z3Y02H5C8X	28				0	1
224#Taj1E4D3Z3Y02F5WYG	24				10	0
3608#Tax1E4D3Z3Y02IZSNY	15				0	1
3264#Tax1E4D3Z3Y02G3ZVZ	16				0	1
3402#Tax1E4D3Z3Y02I4BE6	19				0	2
2711#Tax1E4D3Z3Y02IZU4U	13				0	1
3501#Tax1E4D3Z3Y02INY8I	24				0	2
1982#Tax1E4D3Z3Y02G46Z2	16				0	1
2393#Tax1E4D3Z3Y02HNGML	22				0	1
3423#Tax1E4D3Z3Y02F9WNO	20				0	1
426#Taj1E4D3Z3Y02GCY69	21				3	0
4127#Tax1E4D3Z3Y02HG521	21				0	1
3222#Tax1E4D3Z3Y02HPTH1	21				0	2
1435#Tax1E4D3Z3Y02HAAE3	21				0	1
279#Taj1E4D3Z3Y02FVCE7	15				1	0
2408#Tax1E4D3Z3Y02JRXSS	15				0	1
498#Taj1E4D3Z3Y02GC99S	21				1	0
483#Taj1E4D3Z3Y02GGIRL	20				1	0
3520#Tax1E4D3Z3Y02JRGP9	21				0	1
4145#Tax1E4D3Z3Y02G90BE	14				0	1
2055#Tax1E4D3Z3Y02GVS9O	24				0	1
1487#Tax1E4D3Z3Y02INY2H	19				0	1
4311#Tax1E4D3Z3Y02I60F8	15				0	1
4698#Tax1E4D3Z3Y02HAB4F	29				0	1
1540#Tax1E4D3Z3Y02IKHJ0	25				0	1
2028#Tax1E4D3Z3Y02GEJHG	21				0	1
3075#Tax1E4D3Z3Y02HZ6XN	15				0	1
1606#Tax1E4D3Z3Y02GUGTW	21				0	1
2064#Tax1E4D3Z3Y02FYENI	20				0	8
99#Taj1E4D3Z3Y02IJ2R0	30				1	0
4767#Tax1E4D3Z3Y02I7V55	28				0	1
3553#Tax1E4D3Z3Y02JH7FZ	26				0	1
1933#Tax1E4D3Z3Y02JILE6	27				0	1
2022#Tax1E4D3Z3Y02GWDPK	22				0	1
790#Taj1E4D3Z3Y02H2S4A	15				5	0
533#Taj1E4D3Z3Y02J31IV	21				1	0
2080#Tax1E4D3Z3Y02IFG61	24				0	1
4446#Tax1E4D3Z3Y02G8FFG	17				0	1
4448#Tax1E4D3Z3Y02IZ8HR	13				0	1
3551#Tax1E4D3Z3Y02HQUR4	21				0	1
1122#Taj1E4D3Z3Y02GAIWG	22				1	0
2416#Tax1E4D3Z3Y02GZN0Q	24				0	1
4643#Tax1E4D3Z3Y02JD7RU	22				0	1
1053#Taj1E4D3Z3Y02HP6BV	18				1	0
462#Taj1E4D3Z3Y02GGGRR	23				1	0
414#Taj1E4D3Z3Y02H2UBR	23				1	0
3852#Tax1E4D3Z3Y02HODTZ	24				0	1
4558#Tax1E4D3Z3Y02H0374	27				0	1
263#Taj1E4D3Z3Y02F2EP2	25				3	0
3746#Tax1E4D3Z3Y02IMPGE	15				0	1
4385#Tax1E4D3Z3Y02J2SOT	18				0	1
4536#Tax1E4D3Z3Y02I2SJK	20				0	1
3361#Tax1E4D3Z3Y02JURC0	13				0	1
2985#Tax1E4D3Z3Y02HMESM	20				0	3
3593#Tax1E4D3Z3Y02IHO2R	24				0	1
3210#Tax1E4D3Z3Y02GRYKM	16				0	2
3673#Tax1E4D3Z3Y02HQ0QA	22				0	1
1409#Tax1E4D3Z3Y02HLALX	24				0	1
4417#Tax1E4D3Z3Y02JZSRJ	18				0	2
1716#Tax1E4D3Z3Y02H93BO	24				0	1
4581#Tax1E4D3Z3Y02HOA2U	23				0	1
4219#Tax1E4D3Z3Y02I14XY	27				0	1
293#Taj1E4D3Z3Y02F2ZOT	28				1	0
1272#Tax1E4D3Z3Y02G3GPU	19				0	1
1663#Tax1E4D3Z3Y02G2M3R	24				0	1
2888#Tax1E4D3Z3Y02GNU9F	14				0	1
3818#Tax1E4D3Z3Y02GDXZ9	15				0	1
469#Taj1E4D3Z3Y02G4022	21				1	0
635#Taj1E4D3Z3Y02HNU2C	20				1	0
1088#Taj1E4D3Z3Y02GWLUT	19				2	0
1566#Tax1E4D3Z3Y02IAPDV	26				0	1
979#Taj1E4D3Z3Y02JYV9F	14				1	0
3737#Tax1E4D3Z3Y02F3W59	25				0	1
3950#Tax1E4D3Z3Y02IDGZT	13				0	1
709#Taj1E4D3Z3Y02GZN07	22				1	0
3603#Tax1E4D3Z3Y02HKRJ3	17				0	1
310#Taj1E4D3Z3Y02IWRGM	22				3	0
40#Taj1E4D3Z3Y02IWGIB	21				14	0
192#Taj1E4D3Z3Y02F7NQN	22				2	0
1115#Taj1E4D3Z3Y02IUPOW	24				1	0
4421#Tax1E4D3Z3Y02IRLPN	22				0	1
3529#Tax1E4D3Z3Y02J1SEK	17				0	1
4262#Tax1E4D3Z3Y02GW8WC	24				0	1
4320#Tax1E4D3Z3Y02IUV31	14				0	1
4406#Tax1E4D3Z3Y02FOLTY	15				0	1
4303#Tax1E4D3Z3Y02H5I6A	22				0	1
1707#Tax1E4D3Z3Y02HL5SN	29				0	1
2293#Tax1E4D3Z3Y02JFVJ5	13				0	1
3764#Tax1E4D3Z3Y02II14D	19				0	1
3103#Tax1E4D3Z3Y02G0Z5T	16				0	1
543#Taj1E4D3Z3Y02IYY65	14				3	0
267#Taj1E4D3Z3Y02GBYJ4	15				2	0
1892#Tax1E4D3Z3Y02H1IDP	21				0	1
2044#Tax1E4D3Z3Y02G1HOQ	23				0	1
4553#Tax1E4D3Z3Y02H63ZS	15				0	1
4561#Tax1E4D3Z3Y02JLYDV	18				0	1
1437#Tax1E4D3Z3Y02JNYC0	21				0	2
4231#Tax1E4D3Z3Y02ITNZ1	16				0	1
2813#Tax1E4D3Z3Y02HYPGV	15				0	3
4648#Tax1E4D3Z3Y02IMWI1	23				0	1
2724#Tax1E4D3Z3Y02H0TXG	16				0	1
2517#Tax1E4D3Z3Y02JOF5Y	24				0	1
757#Taj1E4D3Z3Y02JZTHF	14				2	0
2577#Tax1E4D3Z3Y02HWEEQ	18				0	1
9#Taj1E4D3Z3Y02H7RB3	20				1	0
3359#Tax1E4D3Z3Y02JQ4DF	27				0	1
1600#Tax1E4D3Z3Y02JF8YA	13				0	1
1740#Tax1E4D3Z3Y02J3FA0	15				0	1
603#Taj1E4D3Z3Y02H5XL1	21				1	0
90#Taj1E4D3Z3Y02HQXLM	17				1	0
3514#Tax1E4D3Z3Y02IFGG6	28				0	1
4712#Tax1E4D3Z3Y02H2SU0	20				0	1
565#Taj1E4D3Z3Y02IJG1G	13				1	0
3102#Tax1E4D3Z3Y02HLS6C	20				0	1
3247#Tax1E4D3Z3Y02IBIJ6	20				0	1
850#Taj1E4D3Z3Y02GZXB9	30				1	0
4057#Tax1E4D3Z3Y02H16HS	16				0	1
1360#Tax1E4D3Z3Y02HTPMV	24				0	1
2696#Tax1E4D3Z3Y02HA4L3	13				0	1
4683#Tax1E4D3Z3Y02HITI9	20				0	1
3620#Tax1E4D3Z3Y02F77G8	18				0	1
233#Taj1E4D3Z3Y02JUO1E	16				1	0
1490#Tax1E4D3Z3Y02G18EO	24				0	1
2198#Tax1E4D3Z3Y02I257H	24				0	1
2947#Tax1E4D3Z3Y02G7EKK	26				0	1
4199#Tax1E4D3Z3Y02HCPJV	29				0	1
4480#Tax1E4D3Z3Y02HFPUA	13				0	1
4105#Tax1E4D3Z3Y02IOF47	16				0	1
2288#Tax1E4D3Z3Y02HR642	24				0	1
4777#Tax1E4D3Z3Y02GQD34	16				0	1
2954#Tax1E4D3Z3Y02JN9W2	18				0	1
11#Taj1E4D3Z3Y02HDAHD	17				6	0
4841#Tax1E4D3Z3Y02G8FN0	17				0	1
4117#Tax1E4D3Z3Y02GOTEN	14				0	1
842#Taj1E4D3Z3Y02GNTEH	21				2	0
4288#Tax1E4D3Z3Y02GBV17	17				0	1
2000#Tax1E4D3Z3Y02IEF1X	27				0	1
3340#Tax1E4D3Z3Y02JXSN4	26				0	1
2531#Tax1E4D3Z3Y02GEA2H	24				0	1
199#Taj1E4D3Z3Y02HYUP6	17				1	0
2410#Tax1E4D3Z3Y02ISDHE	28				0	1
1899#Tax1E4D3Z3Y02JXBVQ	25				0	1
4606#Tax1E4D3Z3Y02HF9F7	16				0	1
1929#Tax1E4D3Z3Y02GMZ5Y	23				0	1
1737#Tax1E4D3Z3Y02HQHPC	16				0	1
3143#Tax1E4D3Z3Y02JOM93	25				0	1
4814#Tax1E4D3Z3Y02G8CE5	14				0	1
3411#Tax1E4D3Z3Y02GRPWP	24				0	1
3284#Tax1E4D3Z3Y02JOTNC	15				0	1
3223#Tax1E4D3Z3Y02I8GLR	25				0	1
2122#Tax1E4D3Z3Y02HNNG2	13				0	1
3244#Tax1E4D3Z3Y02JLE49	13				0	1
2280#Tax1E4D3Z3Y02HHJFV	21				0	1
280#Taj1E4D3Z3Y02G1XGS	17				1	0
273#Taj1E4D3Z3Y02HFV3S	19				1	0
471#Taj1E4D3Z3Y02JVDM8	16				1	0
3498#Tax1E4D3Z3Y02G2BFE	13				0	1
1509#Tax1E4D3Z3Y02IM1IY	22				0	2
2262#Tax1E4D3Z3Y02IF29Q	23				0	1
4177#Tax1E4D3Z3Y02F33BR	22				0	1
1936#Tax1E4D3Z3Y02HBIO4	17				0	5
2912#Tax1E4D3Z3Y02JLVLT	23				0	1
1325#Tax1E4D3Z3Y02G3BTQ	21				0	1
1643#Tax1E4D3Z3Y02JYTML	25				0	1
131#Taj1E4D3Z3Y02HB1K3	15				2	0
1565#Tax1E4D3Z3Y02JRWPU	17				0	9
4277#Tax1E4D3Z3Y02JC954	24				0	1
4075#Tax1E4D3Z3Y02IXBCI	24				0	1
1502#Tax1E4D3Z3Y02IQ5NV	24				0	1
1872#Tax1E4D3Z3Y02HUJTC	18				0	1
4743#Tax1E4D3Z3Y02G59YV	16				0	1
3488#Tax1E4D3Z3Y02I94U3	24				0	1
4665#Tax1E4D3Z3Y02I7313	23				0	1
2935#Tax1E4D3Z3Y02IINOC	17				0	1
2513#Tax1E4D3Z3Y02HAZ6K	14				0	1
3875#Tax1E4D3Z3Y02JEJYG	16				0	2
4270#Tax1E4D3Z3Y02JW08X	22				0	1
37#Taj1E4D3Z3Y02IE207	24				3	0
855#Taj1E4D3Z3Y02I020X	16				3	0
3659#Tax1E4D3Z3Y02G89KX	18				0	1
1706#Tax1E4D3Z3Y02JUGHA	21				0	1
1788#Tax1E4D3Z3Y02IRAOM	24				0	1
1839#Tax1E4D3Z3Y02GDVMK	15				0	1
2186#Tax1E4D3Z3Y02IM21X	13				0	1
680#Taj1E4D3Z3Y02HX20Z	21				1	0
3962#Tax1E4D3Z3Y02JP92X	15				0	1
1147#Taj1E4D3Z3Y02GF57E	14				1	0
2783#Tax1E4D3Z3Y02IPBYF	18				0	2
334#Taj1E4D3Z3Y02GKV0K	18				13	0
2292#Tax1E4D3Z3Y02ID3AW	24				0	1
3902#Tax1E4D3Z3Y02JUD0G	15				0	1
3582#Tax1E4D3Z3Y02HZ54Y	24				0	4
1997#Tax1E4D3Z3Y02HMK0P	16				0	1
4675#Tax1E4D3Z3Y02I9VQ5	15				0	1
1680#Tax1E4D3Z3Y02GJFMI	20				0	1
2879#Tax1E4D3Z3Y02JI7ZA	24				0	1
1139#Taj1E4D3Z3Y02GX92E	20				1	0
1319#Tax1E4D3Z3Y02GK8M7	23				0	1
1826#Tax1E4D3Z3Y02IAVLG	23				0	1
4043#Tax1E4D3Z3Y02JGPFE	14				0	1
2454#Tax1E4D3Z3Y02HAI2D	18				0	1
2077#Tax1E4D3Z3Y02GITDL	22				0	1
2036#Tax1E4D3Z3Y02HWK3S	22				0	1
1747#Tax1E4D3Z3Y02J01NF	22				0	1
820#Taj1E4D3Z3Y02GAC2P	27				1	0
1799#Tax1E4D3Z3Y02IT0BV	14				0	1
1552#Tax1E4D3Z3Y02G44OT	15				0	1
1194#Taj1E4D3Z3Y02I6ZTN	16				1	0
3716#Tax1E4D3Z3Y02GT1IG	23				0	1
4433#Tax1E4D3Z3Y02FP6XU	23				0	1
41#Taj1E4D3Z3Y02GT4IQ	24				2	0
3014#Tax1E4D3Z3Y02JXYDX	15				0	1
2887#Tax1E4D3Z3Y02I7YRT	23				0	1
3084#Tax1E4D3Z3Y02HUJFQ	22				0	1
1453#Tax1E4D3Z3Y02FYBS1	24				0	1
866#Taj1E4D3Z3Y02JE9GX	30				1	0
2223#Tax1E4D3Z3Y02I42UZ	24				0	1
3532#Tax1E4D3Z3Y02IE8Q8	14				0	1
770#Taj1E4D3Z3Y02HIX9F	20				1	0
3380#Tax1E4D3Z3Y02GA5CK	21				0	1
4292#Tax1E4D3Z3Y02HQQ6S	22				0	1
641#Taj1E4D3Z3Y02GKRYZ	18				2	0
1097#Taj1E4D3Z3Y02JHP2O	19				1	0
4734#Tax1E4D3Z3Y02IE0NT	24				0	1
838#Taj1E4D3Z3Y02IK24U	13				1	0
2664#Tax1E4D3Z3Y02IJCKW	18				0	1
2962#Tax1E4D3Z3Y02HEEUN	24				0	1
616#Taj1E4D3Z3Y02HV30D	21				2	0
870#Taj1E4D3Z3Y02FZIDO	24				2	0
1121#Taj1E4D3Z3Y02FXYEX	27				1	0
4245#Tax1E4D3Z3Y02JEXEW	28				0	1
896#Taj1E4D3Z3Y02I0JNI	17				1	0
3530#Tax1E4D3Z3Y02GF22K	14				0	1
2903#Tax1E4D3Z3Y02IY06A	15				0	1
3672#Tax1E4D3Z3Y02H2HTF	24				0	1
2165#Tax1E4D3Z3Y02I7VJ3	15				0	2
2347#Tax1E4D3Z3Y02JUSA1	15				0	1
4310#Tax1E4D3Z3Y02HAQRE	14				0	1
777#Taj1E4D3Z3Y02FVGQE	29				1	0
3609#Tax1E4D3Z3Y02I3LGL	13				0	4
2786#>Tax1E4D3Z3Y02HE8K8	25				0	1
1672#Tax1E4D3Z3Y02INJ9P	18				0	2
3968#Tax1E4D3Z3Y02HLFZV	23				0	1
1685#Tax1E4D3Z3Y02FZZ0V	22				0	1
2325#Tax1E4D3Z3Y02I5VRG	24				0	1
1891#Tax1E4D3Z3Y02HZ5JL	13				0	1
2768#Tax1E4D3Z3Y02IHL99	23				0	1
3941#Tax1E4D3Z3Y02IOL3H	22				0	1
562#Taj1E4D3Z3Y02F0XXH	25				5	0
2269#Tax1E4D3Z3Y02H5D2J	22				0	1
183#Taj1E4D3Z3Y02GY4R6	19				29	0
1102#Taj1E4D3Z3Y02IATE0	24				1	0
1478#Tax1E4D3Z3Y02F9531	19				0	1
2544#Tax1E4D3Z3Y02G49BS	13				0	3
2541#>Tax1E4D3Z3Y02HG63J	27				0	1
362#Taj1E4D3Z3Y02IIIKE	16				1	0
439#Taj1E4D3Z3Y02GT3NJ	16				3	0
1379#Tax1E4D3Z3Y02I823H	16				0	1
2607#Tax1E4D3Z3Y02GORZI	20				0	1
3345#Tax1E4D3Z3Y02IZAGU	20				0	1
4598#Tax1E4D3Z3Y02I43B0	16				0	2
4839#Tax1E4D3Z3Y02J6Z2I	20				0	1
3798#Tax1E4D3Z3Y02HC3IL	28				0	1
2496#Tax1E4D3Z3Y02JTFU0	17				0	2
407#Taj1E4D3Z3Y02HKK0V	20				1	0
3686#Tax1E4D3Z3Y02GD8SB	18				0	1
4374#Tax1E4D3Z3Y02JRFQV	27				0	1
18#Taj1E4D3Z3Y02IAZOT	16				1	0
376#Taj1E4D3Z3Y02G5FUR	20				1	0
4511#Tax1E4D3Z3Y02GT8VI	22				0	1
1393#Tax1E4D3Z3Y02H9JQF	18				0	1
609#Taj1E4D3Z3Y02I5DRT	29				1	0
1167#Taj1E4D3Z3Y02HZ2L9	20				1	0
4790#Tax1E4D3Z3Y02JOH3W	14				0	1
3373#Tax1E4D3Z3Y02FP90G	30				0	1
3652#Tax1E4D3Z3Y02JSL5E	19				0	1
148#Taj1E4D3Z3Y02HDQQM	21				16	0
1343#Tax1E4D3Z3Y02HPGDE	27				0	1
2489#Tax1E4D3Z3Y02G3ZYJ	24				0	1
2655#Tax1E4D3Z3Y02JDO56	24				0	1
726#Taj1E4D3Z3Y02H40UT	13				1	0
2509#Tax1E4D3Z3Y02GDJ1C	13				0	1
2703#Tax1E4D3Z3Y02I7OAF	22				0	1
2955#Tax1E4D3Z3Y02ITFZ9	20				0	1
4110#Tax1E4D3Z3Y02GSXKG	24				0	1
4210#Tax1E4D3Z3Y02JBKA8	28				0	1
964#Taj1E4D3Z3Y02HMUP9	13				2	0
157#Taj1E4D3Z3Y02I2WJS	22				1	0
2009#Tax1E4D3Z3Y02GHWJM	14				0	1
1909#Tax1E4D3Z3Y02HGMAD	23				0	1
4192#Tax1E4D3Z3Y02ITTTM	18				0	1
935#Taj1E4D3Z3Y02G53IF	30				2	0
2627#Tax1E4D3Z3Y02J5H7U	24				0	1
1213#Tax1E4D3Z3Y02HBI1F	21				0	8
3576#Tax1E4D3Z3Y02JC3X0	27				0	1
1093#Taj1E4D3Z3Y02IMWUC	15				1	0
81#Taj1E4D3Z3Y02HC1L9	25				1	0
1300#Tax1E4D3Z3Y02IU0RU	20				0	1
624#Taj1E4D3Z3Y02GX9QE	15				1	0
2598#Tax1E4D3Z3Y02F163M	24				0	1
371#Taj1E4D3Z3Y02INXWX	15				1	0
204#Taj1E4D3Z3Y02JUXRT	26				1	0
1041#Taj1E4D3Z3Y02G0FWW	27				1	0
1990#Tax1E4D3Z3Y02IOFFR	17				0	1
3254#Tax1E4D3Z3Y02IYTZ9	26				0	1
4611#Tax1E4D3Z3Y02JIXGF	24				0	1
814#Taj1E4D3Z3Y02HL1J7	24				1	0
2492#Tax1E4D3Z3Y02JO57J	14				0	4
2109#Tax1E4D3Z3Y02I4K9J	13				0	1
884#Taj1E4D3Z3Y02IJLU2	15				1	0
3539#Tax1E4D3Z3Y02GJ1D1	21				0	1
749#Taj1E4D3Z3Y02H40N5	30				1	0
345#Taj1E4D3Z3Y02HOTGS	16				1	0
3323#Tax1E4D3Z3Y02JGU6G	25				0	1
4408#Tax1E4D3Z3Y02J2QQ8	21				0	1
4846#Tax1E4D3Z3Y02IIJ3N	21				0	1
613#Taj1E4D3Z3Y02INBZ2	18				1	0
952#Taj1E4D3Z3Y02HUIRJ	21				17	0
2691#Tax1E4D3Z3Y02HK55B	19				0	1
4498#Tax1E4D3Z3Y02JT28N	15				0	1
4804#Tax1E4D3Z3Y02G9HVP	25				0	1
1071#Taj1E4D3Z3Y02INYS1	20				1	0
3058#Tax1E4D3Z3Y02HT9OK	30				0	1
4331#Tax1E4D3Z3Y02JQVG5	18				0	1
253#Taj1E4D3Z3Y02GOVRH	17				2	0
4158#Tax1E4D3Z3Y02JAKN2	26				0	1
3278#Tax1E4D3Z3Y02G9C3S	13				0	1
2427#Tax1E4D3Z3Y02F3SEH	14				0	1
63#Taj1E4D3Z3Y02HEANV	21				1	0
1637#Tax1E4D3Z3Y02IUAFM	13				0	1
179#Taj1E4D3Z3Y02G9MDV	18				1	0
1105#Taj1E4D3Z3Y02IPTUB	14				1	0
3705#Tax1E4D3Z3Y02GIIZK	18				0	2
1334#Tax1E4D3Z3Y02INW6J	29				0	1
3948#Tax1E4D3Z3Y02GCKTN	25				0	1
2499#Tax1E4D3Z3Y02JFCN5	24				0	1
2096#Tax1E4D3Z3Y02GIMSE	14				0	1
2805#Tax1E4D3Z3Y02H721V	24				0	1
3776#Tax1E4D3Z3Y02JX881	27				0	1
1784#Tax1E4D3Z3Y02IHR3M	13				0	1
938#Taj1E4D3Z3Y02IR8W7	16				1	0
2149#Tax1E4D3Z3Y02G5W0U	21				0	1
3882#Tax1E4D3Z3Y02HDSPV	14				0	1
4016#Tax1E4D3Z3Y02IJ1PH	13				0	1
1830#Tax1E4D3Z3Y02HQZF1	21				0	1
1620#Tax1E4D3Z3Y02FYW8V	24				0	1
2241#Tax1E4D3Z3Y02H3IYZ	22				0	1
3060#Tax1E4D3Z3Y02IFDC6	18				0	1
3917#Tax1E4D3Z3Y02I60AZ	14				0	1
3167#Tax1E4D3Z3Y02JS3GE	20				0	1
4203#Tax1E4D3Z3Y02IJ8HA	21				0	1
2370#Tax1E4D3Z3Y02GDBYF	26				0	1
929#Taj1E4D3Z3Y02IVLWB	16				1	0
2554#Tax1E4D3Z3Y02ISXH0	16				0	1
1538#Tax1E4D3Z3Y02HK7BC	14				0	1
1583#Tax1E4D3Z3Y02H6DFP	23				0	1
258#Taj1E4D3Z3Y02GMC99	21				60	0
2620#Tax1E4D3Z3Y02JZD6P	21				0	1
4022#Tax1E4D3Z3Y02I0C3Z	24				0	1
2138#Tax1E4D3Z3Y02IEAGU	15				0	1
1055#Taj1E4D3Z3Y02JB8MC	19				1	0
3610#Tax1E4D3Z3Y02IS0KL	17				0	1
4050#Tax1E4D3Z3Y02JB6ZF	22				0	1
2447#Tax1E4D3Z3Y02IVR0U	24				0	1
3140#Tax1E4D3Z3Y02H0U2Z	13				0	1
141#Taj1E4D3Z3Y02JH0ZL	16				3	0
3043#Tax1E4D3Z3Y02GI8FH	20				0	1
4228#Tax1E4D3Z3Y02GOIC6	14				0	1
1230#Tax1E4D3Z3Y02GRVA7	24				0	1
4520#Tax1E4D3Z3Y02JMLLH	15				0	1
2793#Tax1E4D3Z3Y02JPQ7N	21				0	1
1917#Tax1E4D3Z3Y02GSA6U	17				0	1
2993#Tax1E4D3Z3Y02GNKOO	16				0	1
1713#Tax1E4D3Z3Y02H1TEH	29				0	1
3590#Tax1E4D3Z3Y02H0YOG	20				0	1
1060#Taj1E4D3Z3Y02G2HN1	23				1	0
2420#Tax1E4D3Z3Y02GRDUV	16				0	1
3722#Tax1E4D3Z3Y02JOGKV	20				0	1
3759#Tax1E4D3Z3Y02HZ97Q	14				0	2
2104#Tax1E4D3Z3Y02G7VPW	13				0	1
2126#Tax1E4D3Z3Y02H04KD	28				0	2
2894#Tax1E4D3Z3Y02HCOIF	17				0	1
2858#Tax1E4D3Z3Y02FXMUS	21				0	1
4450#Tax1E4D3Z3Y02JAW86	25				0	1
900#Taj1E4D3Z3Y02GR2T9	15				2	0
4221#Tax1E4D3Z3Y02IVXZ4	18				0	1
318#Taj1E4D3Z3Y02JT5O6	22				2	0
2526#Tax1E4D3Z3Y02F3MNB	17				0	1
972#Taj1E4D3Z3Y02F8LVH	25				1	0
473#Taj1E4D3Z3Y02FQSRP	13				1	0
2572#Tax1E4D3Z3Y02JUWRQ	19				0	1
1774#Tax1E4D3Z3Y02JA5CR	15				0	1
3#Taj1E4D3Z3Y02HB7BH	23				1	0
248#Taj1E4D3Z3Y02JPKAX	25				1	0
3888#Tax1E4D3Z3Y02IWO9F	17				0	1
802#Taj1E4D3Z3Y02HCWBV	23				1	0
4782#Tax1E4D3Z3Y02H24G5	15				0	1
3924#Tax1E4D3Z3Y02GF3BT	24				0	1
2063#Tax1E4D3Z3Y02JS92J	24				0	1
3420#Tax1E4D3Z3Y02JHOLF	24				0	1
3723#Tax1E4D3Z3Y02HD5MM	16				0	1
3269#Tax1E4D3Z3Y02IM1ED	16				0	1
2632#Tax1E4D3Z3Y02JC75X	17				0	1
1049#Taj1E4D3Z3Y02JP2QW	22				1	0
4544#Tax1E4D3Z3Y02HN34U	15				0	1
2812#Tax1E4D3Z3Y02GJOZ7	18				0	2
1488#Tax1E4D3Z3Y02GN3HW	14				0	1
560#Taj1E4D3Z3Y02FKQV4	29				1	0
2830#Tax1E4D3Z3Y02HOE53	15				0	1
798#Taj1E4D3Z3Y02GHZG7	16				3	0
898#Taj1E4D3Z3Y02GYXY7	26				1	0
2725#Tax1E4D3Z3Y02GS547	15				0	1
3892#Tax1E4D3Z3Y02JZWRE	16				0	1
3670#Tax1E4D3Z3Y02FMS0A	18				0	3
4316#Tax1E4D3Z3Y02JMH4M	14				0	1
1273#Tax1E4D3Z3Y02JVVF5	24				0	1
2516#Tax1E4D3Z3Y02IW283	13				0	1
451#Taj1E4D3Z3Y02GMM3N	14				5	0
2616#Tax1E4D3Z3Y02JOH8N	15				0	1
3362#Tax1E4D3Z3Y02IK8OR	28				0	1
1408#Tax1E4D3Z3Y02G7OAU	22				0	1
2448#Tax1E4D3Z3Y02IXF95	24				0	1
2969#Tax1E4D3Z3Y02FNRTS	13				0	1
4224#Tax1E4D3Z3Y02JF6HE	15				0	2
4249#Tax1E4D3Z3Y02HYVB6	17				0	1
2721#Tax1E4D3Z3Y02IQJ4A	24				0	1
4557#Tax1E4D3Z3Y02H4P98	29				0	1
3595#Tax1E4D3Z3Y02IZAN5	20				0	1
578#Taj1E4D3Z3Y02GRV4R	23				1	0
4788#Tax1E4D3Z3Y02ICQXN	18				0	1
4384#Tax1E4D3Z3Y02G17OO	19				0	1
4418#Tax1E4D3Z3Y02GS6G0	23				0	1
695#Taj1E4D3Z3Y02GRUFA	25				1	0
3331#Tax1E4D3Z3Y02HTI76	17				0	1
540#Taj1E4D3Z3Y02GLC60	24				1	0
1615#Tax1E4D3Z3Y02IZVL0	18				0	1
3137#Tax1E4D3Z3Y02J2COV	21				0	1
3065#Tax1E4D3Z3Y02ISYO8	24				0	1
1732#Tax1E4D3Z3Y02HL8T1	20				0	1
2073#Tax1E4D3Z3Y02G0NNO	24				0	1
861#Taj1E4D3Z3Y02GL4XU	17				1	0
3706#Tax1E4D3Z3Y02F3VCG	24				0	1
337#Taj1E4D3Z3Y02IK197	21				1	0
2406#Tax1E4D3Z3Y02J1CLK	26				0	1
3172#Tax1E4D3Z3Y02G7T9L	17				0	2
76#Taj1E4D3Z3Y02G33YA	22				1	0
2718#Tax1E4D3Z3Y02JNVQR	18				0	1
982#Taj1E4D3Z3Y02JUF7M	14				5	0
571#Taj1E4D3Z3Y02IP4F5	18				1	0
1190#Taj1E4D3Z3Y02I0SNQ	15				1	0
2592#Tax1E4D3Z3Y02GJUGZ	22				0	1
1345#Tax1E4D3Z3Y02FK9BK	23				0	1
1171#Taj1E4D3Z3Y02JW60E	20				1	0
2290#Tax1E4D3Z3Y02IDV17	19				0	1
4431#Tax1E4D3Z3Y02H4NDA	24				0	1
4153#Tax1E4D3Z3Y02IK5HA	30				0	1
1123#Taj1E4D3Z3Y02JTJ0M	21				1	0
236#Taj1E4D3Z3Y02GIX2H	21				1	0
758#Taj1E4D3Z3Y02IUHW1	14				1	0
706#Taj1E4D3Z3Y02I1X5I	18				1	0
14#Taj1E4D3Z3Y02F3X4P	21				1	0
4550#Tax1E4D3Z3Y02JJH5Q	24				0	1
4761#Tax1E4D3Z3Y02IOQMG	24				0	1
2587#Tax1E4D3Z3Y02GEUEX	24				0	1
1608#Tax1E4D3Z3Y02JKLSO	23				0	1
2328#Tax1E4D3Z3Y02F79Z7	13				0	3
2474#Tax1E4D3Z3Y02JBECR	18				0	1
3232#Tax1E4D3Z3Y02G7RSY	20				0	1
2889#Tax1E4D3Z3Y02HBAZT	16				0	1
3786#Tax1E4D3Z3Y02JQ69G	20				0	1
234#Taj1E4D3Z3Y02GXMXB	14				1	0
594#Taj1E4D3Z3Y02GV2BE	22				1	0
1438#Tax1E4D3Z3Y02HO65V	26				0	1
2924#Tax1E4D3Z3Y02G4VZO	13				0	1
1903#Tax1E4D3Z3Y02HCZD0	21				0	2
4766#Tax1E4D3Z3Y02JIOEX	14				0	1
4580#Tax1E4D3Z3Y02HU44X	19				0	1
4302#Tax1E4D3Z3Y02GB0VW	25				0	1
3554#Tax1E4D3Z3Y02IE554	17				0	1
3116#Tax1E4D3Z3Y02J2NSH	18				0	1
2776#Tax1E4D3Z3Y02HFIAI	18				0	1
4443#Tax1E4D3Z3Y02HNHFP	16				0	1
4759#Tax1E4D3Z3Y02JHM6N	24				0	1
1000#Taj1E4D3Z3Y02FU8CR	23				2	0
43#Taj1E4D3Z3Y02I9TXZ	22				3	0
2582#Tax1E4D3Z3Y02JG655	15				0	2
3502#Tax1E4D3Z3Y02IX18D	23				0	1
1728#Tax1E4D3Z3Y02ILFFP	22				0	1
3955#Tax1E4D3Z3Y02GM0SX	15				0	1
3763#Tax1E4D3Z3Y02JE6GP	19				0	1
193#Taj1E4D3Z3Y02GIS1R	23				1	0
288#Taj1E4D3Z3Y02FVO7M	16				1	0
119#Taj1E4D3Z3Y02GZRC5	22				1	0
3925#Tax1E4D3Z3Y02HM54E	19				0	2
3374#Tax1E4D3Z3Y02HS0XX	17				0	1
1180#Taj1E4D3Z3Y02HRAYE	16				1	0
4730#Tax1E4D3Z3Y02GCAUM	13				0	1
430#Taj1E4D3Z3Y02GDH53	21				2	0
3602#Tax1E4D3Z3Y02GF8J9	13				0	2
447#Taj1E4D3Z3Y02JUSYA	17				1	0
1446#Tax1E4D3Z3Y02GMCPM	20				0	1
3258#Tax1E4D3Z3Y02HEE9P	14				0	1
4438#Tax1E4D3Z3Y02JSQMG	24				0	1
2118#Tax1E4D3Z3Y02FWBGS	19				0	2
415#Taj1E4D3Z3Y02G112E	13				127	0
4196#Tax1E4D3Z3Y02G0B19	17				0	1
1292#Tax1E4D3Z3Y02HYYVG	22				0	1
2597#Tax1E4D3Z3Y02IMH81	20				0	1
3987#Tax1E4D3Z3Y02HYGCY	14				0	1
1356#Tax1E4D3Z3Y02JU80O	17				0	1
1871#Tax1E4D3Z3Y02GXY09	21				0	1
438#Taj1E4D3Z3Y02F0QAO	15				1	0
1153#Taj1E4D3Z3Y02HWMY4	13				1	0
4569#Tax1E4D3Z3Y02JN5MO	18				0	1
1022#Taj1E4D3Z3Y02GCX3Q	24				1	0
4463#Tax1E4D3Z3Y02JE3TS	15				0	1
4395#Tax1E4D3Z3Y02HAWXB	14				0	1
2795#Tax1E4D3Z3Y02J3FDI	17				0	1
953#Taj1E4D3Z3Y02I2FHN	18				1	0
4830#Tax1E4D3Z3Y02JITE5	14				0	1
1560#Tax1E4D3Z3Y02ICMYW	13				0	1
3912#Tax1E4D3Z3Y02HX43U	21				0	1
4820#Tax1E4D3Z3Y02JY12M	17				0	1
1762#Tax1E4D3Z3Y02GVCST	22				0	2
784#Taj1E4D3Z3Y02JV4P0	22				1	0
260#Taj1E4D3Z3Y02GJK4J	15				1	0
2061#Tax1E4D3Z3Y02JJFHB	13				0	3
3080#Tax1E4D3Z3Y02GU7YF	21				0	1
1844#Tax1E4D3Z3Y02INAGE	23				0	1
762#Taj1E4D3Z3Y02JK63A	17				1	0
1144#Taj1E4D3Z3Y02GQDOU	15				1	0
1723#Tax1E4D3Z3Y02G4L6L	20				0	1
2047#Tax1E4D3Z3Y02H78LK	22				0	1
144#Taj1E4D3Z3Y02GFCY3	23				1	0
4619#Tax1E4D3Z3Y02F0N51	24				0	1
3696#Tax1E4D3Z3Y02HXBBP	23				0	1
906#Taj1E4D3Z3Y02JFSV2	14				1	0
1349#Tax1E4D3Z3Y02JTX7Z	19				0	1
2205#Tax1E4D3Z3Y02IWCOI	15				0	2
177#Taj1E4D3Z3Y02F9BM4	22				2	0
2213#Tax1E4D3Z3Y02I23WK	21				0	1
3346#Tax1E4D3Z3Y02JNBL2	22				0	1
2940#Tax1E4D3Z3Y02HJKQ9	20				0	1
22#Taj1E4D3Z3Y02GRJ8Q	14				99	0
205#Taj1E4D3Z3Y02F7VZU	30				1	0
3072#Tax1E4D3Z3Y02IM0RK	21				0	2
4345#Tax1E4D3Z3Y02JD4ZG	19				0	1
3213#Tax1E4D3Z3Y02FSB5T	22				0	1
3296#Tax1E4D3Z3Y02ISMIH	17				0	1
2681#Tax1E4D3Z3Y02IF4N9	24				0	1
1260#Tax1E4D3Z3Y02G00PG	14				0	2
874#Taj1E4D3Z3Y02J2AQL	15				1	0
1708#Tax1E4D3Z3Y02F7VAD	19				0	1
4795#Tax1E4D3Z3Y02FPXBO	20				0	1
493#Taj1E4D3Z3Y02F8R9Z	16				1	0
1436#Tax1E4D3Z3Y02I5O16	18				0	1
2220#Tax1E4D3Z3Y02HBQV2	16				0	1
3719#Tax1E4D3Z3Y02I7DLR	17				0	1
1591#Tax1E4D3Z3Y02I91PT	19				0	1
2528#Tax1E4D3Z3Y02I61D8	18				0	1
1677#Tax1E4D3Z3Y02FZXT6	15				0	1
2174#Tax1E4D3Z3Y02JW5SD	22				0	1
4699#Tax1E4D3Z3Y02JNLCL	20				0	1
1320#Tax1E4D3Z3Y02IQP1U	14				0	1
1026#Taj1E4D3Z3Y02GUD9K	22				1	0
4493#Tax1E4D3Z3Y02H8Q1R	21				0	1
2752#Tax1E4D3Z3Y02H2GT4	18				0	1
1390#Tax1E4D3Z3Y02HZ98E	13				0	1
1993#Tax1E4D3Z3Y02HL0BK	13				0	1
1499#Tax1E4D3Z3Y02GME0G	24				0	1
1469#Tax1E4D3Z3Y02JWEW2	19				0	1
3544#Tax1E4D3Z3Y02H3U0K	18				0	1
4674#Tax1E4D3Z3Y02GUOHT	16				0	1
400#Taj1E4D3Z3Y02FZ4CG	22				1	0
919#Taj1E4D3Z3Y02ITXFB	26				1	0
1268#Tax1E4D3Z3Y02GQ3Y9	23				0	1
633#Taj1E4D3Z3Y02IZI6Q	26				1	0
1372#Tax1E4D3Z3Y02I9A0Q	21				0	2
2023#Tax1E4D3Z3Y02IDMYJ	20				0	1
1977#Tax1E4D3Z3Y02H49OT	23				0	1
4387#Tax1E4D3Z3Y02IIA1Y	16				0	1
1825#Tax1E4D3Z3Y02GTOHO	13				0	1
1669#Tax1E4D3Z3Y02HV7HU	18				0	1
3445#Tax1E4D3Z3Y02JWHMW	21				0	1
1285#Tax1E4D3Z3Y02GCDS3	26				0	1
3309#Tax1E4D3Z3Y02HG1UR	16				0	1
3594#Tax1E4D3Z3Y02HLR92	19				0	1
3757#Tax1E4D3Z3Y02H260C	24				0	1
1959#Tax1E4D3Z3Y02GQAFV	16				0	1
1549#Tax1E4D3Z3Y02G2DNS	29				0	1
1242#Tax1E4D3Z3Y02HSJ79	15				0	1
1208#Tax1E4D3Z3Y02I657O	14				0	1
1874#Tax1E4D3Z3Y02G3XFR	28				0	3
1803#Tax1E4D3Z3Y02JOD4Z	16				0	3
3542#Tax1E4D3Z3Y02JS6DM	26				0	1
1201#Taj1E4D3Z3Y02F5JGS	15				3	1
519#Taj1E4D3Z3Y02JPLIB	18				1	0
3300#Tax1E4D3Z3Y02IYB1R	14				0	1
17#Taj1E4D3Z3Y02JT9Z7	15				1	0
2451#Tax1E4D3Z3Y02IX7TA	22				0	1
4092#Tax1E4D3Z3Y02HAEUD	21				0	1
3337#Tax1E4D3Z3Y02GM2K6	24				0	1
1274#Tax1E4D3Z3Y02IQKW3	20				0	1
110#Taj1E4D3Z3Y02GSN15	19				2	0
2356#Tax1E4D3Z3Y02JH830	16				0	1
4721#Tax1E4D3Z3Y02IKV2J	22				0	1
2210#Tax1E4D3Z3Y02GPQEN	17				0	1
2658#Tax1E4D3Z3Y02F5UD2	24				0	1
3700#Tax1E4D3Z3Y02G0APE	17				0	1
646#Taj1E4D3Z3Y02I733U	17				1	0
1220#Tax1E4D3Z3Y02F8S1X	19				0	1
4005#Tax1E4D3Z3Y02HM09V	13				0	1
3663#Tax1E4D3Z3Y02I7M9E	24				0	1
2652#Tax1E4D3Z3Y02JVQY6	23				0	2
2337#Tax1E4D3Z3Y02F9E3W	23				0	1
4263#Tax1E4D3Z3Y02F4H36	23				0	1
4626#Tax1E4D3Z3Y02HAVM8	23				0	1
2243#Tax1E4D3Z3Y02GV6NF	20				0	1
1288#Tax1E4D3Z3Y02H8LNK	25				0	1
1087#Taj1E4D3Z3Y02GK9S3	28				1	0
810#Taj1E4D3Z3Y02G2H8Q	26				1	0
1587#Tax1E4D3Z3Y02IPOU0	16				0	1
4166#Tax1E4D3Z3Y02GTRXP	30				0	1
4351#Tax1E4D3Z3Y02JT7DG	21				0	1
33#Taj1E4D3Z3Y02JY80P	24				1	0
4256#Tax1E4D3Z3Y02J1J26	19				0	1
227#Taj1E4D3Z3Y02I4QSD	15				1	0
1860#Tax1E4D3Z3Y02JJ524	28				0	2
4829#Tax1E4D3Z3Y02GRN25	15				0	1
4577#Tax1E4D3Z3Y02I8WJZ	23				0	1
2013#Tax1E4D3Z3Y02G0SG7	16				0	1
264#Taj1E4D3Z3Y02G1KUT	24				1	0
806#Taj1E4D3Z3Y02JJONZ	25				1	0
4477#Tax1E4D3Z3Y02HXB51	14				0	1
1885#Tax1E4D3Z3Y02HWLEA	26				0	1
1817#Tax1E4D3Z3Y02GYVD1	14				0	1
2905#Tax1E4D3Z3Y02HSPGK	24				0	1
2707#Tax1E4D3Z3Y02IBXMW	24				0	1
556#Taj1E4D3Z3Y02HCKEG	18				1	0
3998#Tax1E4D3Z3Y02HI6RY	13				0	1
717#Taj1E4D3Z3Y02GU01D	30				1	0
2817#Tax1E4D3Z3Y02IU2Z9	14				0	1
671#Taj1E4D3Z3Y02IJKG4	20				10	0
1511#Tax1E4D3Z3Y02G165D	24				0	3
2249#Tax1E4D3Z3Y02HOO02	24				0	5
3353#Tax1E4D3Z3Y02JJUVK	19				0	1
2423#Tax1E4D3Z3Y02G42YB	15				0	1
1605#Tax1E4D3Z3Y02J3BJO	22				0	1
663#Taj1E4D3Z3Y02I8D8A	26				1	0
4301#Tax1E4D3Z3Y02JDAI7	17				0	1
2431#Tax1E4D3Z3Y02FVF63	24				0	3
1945#Tax1E4D3Z3Y02FPD75	19				0	1
4326#Tax1E4D3Z3Y02JL1BX	20				0	1
969#Taj1E4D3Z3Y02F7JMQ	22				1	0
4295#Tax1E4D3Z3Y02IDLK9	27				0	1
1946#Tax1E4D3Z3Y02JDIHX	13				0	1
2276#Tax1E4D3Z3Y02HZDA7	24				0	1
4089#Tax1E4D3Z3Y02JWX67	14				0	1
4207#Tax1E4D3Z3Y02I40KH	30				0	1
1501#Tax1E4D3Z3Y02IG7Z1	13				0	1
4808#Tax1E4D3Z3Y02I7E2J	15				0	1
549#Taj1E4D3Z3Y02HWRBO	24				1	0
3465#Tax1E4D3Z3Y02ITG2O	15				0	1
3629#Tax1E4D3Z3Y02IKBX2	22				0	1
3930#Tax1E4D3Z3Y02HSL6E	13				0	1
946#Taj1E4D3Z3Y02FTBXZ	14				1	0
2644#Tax1E4D3Z3Y02IYP0I	16				0	1
1361#Tax1E4D3Z3Y02GYXON	24				0	1
3864#Tax1E4D3Z3Y02HQCJ1	22				0	1
3155#Tax1E4D3Z3Y02JJOI0	15				0	1
3773#Tax1E4D3Z3Y02FVGBP	14				0	1
3280#Tax1E4D3Z3Y02I3XNU	22				0	1
1465#Tax1E4D3Z3Y02F2MH2	20				0	1
2990#Tax1E4D3Z3Y02JGUUO	24				0	1
1397#Tax1E4D3Z3Y02HU6QZ	13				0	1
3678#Tax1E4D3Z3Y02IIVOY	24				0	1
941#Taj1E4D3Z3Y02JUZNY	15				1	0
583#Taj1E4D3Z3Y02G54PT	19				1	0
3436#Tax1E4D3Z3Y02JMPFS	13				0	1
4848#Tax1E4D3Z3Y02JLQPM	19				0	1
1869#Tax1E4D3Z3Y02J1TSY	23				0	1
3190#Tax1E4D3Z3Y02GUV9Y	25				0	1
591#Taj1E4D3Z3Y02GYTFI	14				1	0
2304#Tax1E4D3Z3Y02JMI53	13				0	1
3846#Tax1E4D3Z3Y02JC2W7	18				0	1
3481#Tax1E4D3Z3Y02IJ04K	20				0	1
2341#Tax1E4D3Z3Y02JBSJO	21				0	1
2804#Tax1E4D3Z3Y02GHRS7	16				0	1
3583#Tax1E4D3Z3Y02IOBBA	24				0	1
4078#Tax1E4D3Z3Y02HCCZL	24				0	1
4149#Tax1E4D3Z3Y02HQV5G	17				0	1
1920#Tax1E4D3Z3Y02GKR55	19				0	1
102#Taj1E4D3Z3Y02F49A8	19				2	0
3827#Tax1E4D3Z3Y02FJE8D	14				0	1
4589#Tax1E4D3Z3Y02I0KDQ	21				0	1
2992#Tax1E4D3Z3Y02JCTQ4	15				0	1
2639#Tax1E4D3Z3Y02IT5TO	14				0	3
1218#Tax1E4D3Z3Y02I8VIJ	13				0	9
3483#Tax1E4D3Z3Y02JHHBI	24				0	1
4227#Tax1E4D3Z3Y02JIPG0	27				0	1
2398#Tax1E4D3Z3Y02F0RIQ	13				0	1
4409#Tax1E4D3Z3Y02JCVUJ	18				0	1
259#Taj1E4D3Z3Y02G4EAF	27				2	0
1625#Tax1E4D3Z3Y02I212I	16				0	1
163#Taj1E4D3Z3Y02H5TS6	23				1	0
3898#Tax1E4D3Z3Y02GVU5H	22				0	1
4070#Tax1E4D3Z3Y02H3LK2	21				0	1
1106#Taj1E4D3Z3Y02IR1DI	16				1	0
1836#Tax1E4D3Z3Y02GM33V	22				0	1
1531#Tax1E4D3Z3Y02JFDKR	29				0	1
2731#Tax1E4D3Z3Y02HBQFE	21				0	1
3976#Tax1E4D3Z3Y02GQ02G	20				0	1
2929#Tax1E4D3Z3Y02H3ESL	19				0	1
1333#Tax1E4D3Z3Y02JQ71N	16				0	1
2738#Tax1E4D3Z3Y02GERPA	14				0	1
2770#Tax1E4D3Z3Y02JD19N	21				0	1
3859#Tax1E4D3Z3Y02INTOO	13				0	2
3087#Tax1E4D3Z3Y02JFD06	14				0	1
442#Taj1E4D3Z3Y02F3YCK	22				1	0
4044#Tax1E4D3Z3Y02H7ABA	17				0	1
1577#Tax1E4D3Z3Y02HWPGM	14				0	1
2156#Tax1E4D3Z3Y02IH7LP	15				0	1
4492#Tax1E4D3Z3Y02H9XPI	13				0	1
1572#Tax1E4D3Z3Y02HNRXY	24				0	1
2851#Tax1E4D3Z3Y02J45AP	15				0	2
886#Taj1E4D3Z3Y02IXMEU	24				1	0
4733#Tax1E4D3Z3Y02JRQNF	17				0	1
1329#Tax1E4D3Z3Y02JI55N	22				0	1
2835#Tax1E4D3Z3Y02HA557	19				0	1
3728#Tax1E4D3Z3Y02G9PPA	21				0	1
4186#Tax1E4D3Z3Y02JMCT5	24				0	1
3568#Tax1E4D3Z3Y02JLALP	29				0	1
3243#Tax1E4D3Z3Y02HH7TE	24				0	1
3777#Tax1E4D3Z3Y02IMDGI	22				0	1
320#Taj1E4D3Z3Y02F1RED	23				1	0
3528#Tax1E4D3Z3Y02F33J4	20				0	1
3756#Tax1E4D3Z3Y02IPSMX	24				0	1
811#Taj1E4D3Z3Y02H9MD6	15				2	0
249#Taj1E4D3Z3Y02J3C81	28				1	0
465#Taj1E4D3Z3Y02JPRUO	14				1	0
1612#Tax1E4D3Z3Y02G5OAN	15				0	1
819#Taj1E4D3Z3Y02H38DR	24				1	0
1189#Taj1E4D3Z3Y02JWPCI	26				3	0
1177#Taj1E4D3Z3Y02HLU43	24				1	0
3680#Tax1E4D3Z3Y02IHW0Z	14				0	1
1748#Tax1E4D3Z3Y02GS8WA	22				0	1
2127#Tax1E4D3Z3Y02I49QW	13				0	1
858#Taj1E4D3Z3Y02GUU3C	18				1	0
3768#Tax1E4D3Z3Y02GC8NT	24				0	1
385#Taj1E4D3Z3Y02HVJG6	21				22	0
1479#Tax1E4D3Z3Y02JAPNH	17				0	1
1359#Tax1E4D3Z3Y02GFKJ2	20				0	2
2578#Tax1E4D3Z3Y02IQ1ZA	16				0	1
971#Taj1E4D3Z3Y02GWKBH	24				1	0
4781#Tax1E4D3Z3Y02JGFTX	13				0	1
4716#Tax1E4D3Z3Y02I3HL9	26				0	1
847#>Taj1E4D3Z3Y02GBWQM	13				1	0
479#Taj1E4D3Z3Y02GF6RN	21				1	0
1166#Taj1E4D3Z3Y02JZHN0	24				1	0
2166#Tax1E4D3Z3Y02IN6P4	22				0	1
3091#Tax1E4D3Z3Y02JEXRX	28				0	1
1378#Tax1E4D3Z3Y02HUMRY	18				0	1
1054#Taj1E4D3Z3Y02GI7JI	24				1	0
2821#Tax1E4D3Z3Y02JA890	14				0	1
2101#Tax1E4D3Z3Y02HOMJT	21				0	1
619#Taj1E4D3Z3Y02FIJ8H	18				2	0
3616#Tax1E4D3Z3Y02FRN1D	19				0	1
3797#Tax1E4D3Z3Y02GYYSG	24				0	1
621#Taj1E4D3Z3Y02II7TQ	24				1	0
2310#Tax1E4D3Z3Y02F78SC	16				0	1
2495#Tax1E4D3Z3Y02GQIHH	23				0	1
3052#Tax1E4D3Z3Y02ITXG9	17				0	1
3395#Tax1E4D3Z3Y02F7J3G	14				0	1
2322#Tax1E4D3Z3Y02HRB09	21				0	1
2438#Tax1E4D3Z3Y02JIF2O	18				0	1
3334#Tax1E4D3Z3Y02IOXOV	24				0	1
3246#Tax1E4D3Z3Y02FLMKX	21				0	1
4179#Tax1E4D3Z3Y02HJ1O4	15				0	1
4778#Tax1E4D3Z3Y02IQTAD	25				0	1
377#Taj1E4D3Z3Y02GLYTO	24				1	0
2050#Tax1E4D3Z3Y02HM9AC	22				0	1
602#Taj1E4D3Z3Y02IIB4M	14				1	0
1311#Tax1E4D3Z3Y02IQTF6	21				0	1
3815#Tax1E4D3Z3Y02G93T3	21				0	1
1787#Tax1E4D3Z3Y02HBOA0	23				0	1
612#Taj1E4D3Z3Y02IA3SF	19				1	0
1391#Tax1E4D3Z3Y02HJEG0	22				0	1
936#Taj1E4D3Z3Y02GYFJE	24				1	0
3579#Tax1E4D3Z3Y02ITZ0N	25				0	1
4510#Tax1E4D3Z3Y02JASOM	13				0	1
2794#Tax1E4D3Z3Y02ILO3A	22				0	1
701#Taj1E4D3Z3Y02GHAH6	23				1	0
3710#Tax1E4D3Z3Y02G8B53	15				0	2
214#Taj1E4D3Z3Y02F2VQ5	14				5	0
3630#Tax1E4D3Z3Y02HGIDW	24				0	1
2708#Tax1E4D3Z3Y02GV4HK	26				0	1
1650#Tax1E4D3Z3Y02H7W95	17				0	1
2789#Tax1E4D3Z3Y02H45LK	24				0	1
2074#Tax1E4D3Z3Y02GFZMG	24				0	1
2539#Tax1E4D3Z3Y02IO69Q	18				0	1
2547#Tax1E4D3Z3Y02G5DJ7	14				0	1
731#Taj1E4D3Z3Y02HMT5Z	23				2	0
3639#Tax1E4D3Z3Y02HH37H	13				0	1
2779#Tax1E4D3Z3Y02HMI07	18				0	2
2139#Tax1E4D3Z3Y02HIYZ6	21				0	1
4281#Tax1E4D3Z3Y02GS749	21				0	1
768#Taj1E4D3Z3Y02HVSU4	14				1	0
1928#Tax1E4D3Z3Y02H2UM7	22				0	1
1092#Taj1E4D3Z3Y02FU299	22				1	0
1756#Tax1E4D3Z3Y02HOQXC	22				0	1
2255#Tax1E4D3Z3Y02HHYY3	30				0	1
3877#Tax1E4D3Z3Y02IDYMM	24				0	1
1636#Tax1E4D3Z3Y02HV6CW	24				0	1
2491#Tax1E4D3Z3Y02JOFIZ	19				0	1
338#Taj1E4D3Z3Y02GM77T	25				1	0
3105#Tax1E4D3Z3Y02G4YOL	27				0	1
761#Taj1E4D3Z3Y02ICWZZ	24				1	0
576#Taj1E4D3Z3Y02IRWG1	14				1	0
4748#Tax1E4D3Z3Y02J2TOM	15				0	1
1775#Tax1E4D3Z3Y02GZ2R0	21				0	1
738#Taj1E4D3Z3Y02GFPWB	20				3	0
1415#Tax1E4D3Z3Y02GSCAY	22				0	1
484#Taj1E4D3Z3Y02GOKY0	14				99	0
1243#Tax1E4D3Z3Y02IBV7I	24				0	1
2334#Tax1E4D3Z3Y02G2RDX	13				0	1
3408#Tax1E4D3Z3Y02J2QQN	24				0	1
1078#Taj1E4D3Z3Y02GLRBJ	21				1	0
2530#Tax1E4D3Z3Y02HEOLJ	22				0	1
4833#Tax1E4D3Z3Y02G4V0N	26				0	1
623#Taj1E4D3Z3Y02I9PFJ	19				1	0
3885#Tax1E4D3Z3Y02JW08D	23				0	1
4091#Tax1E4D3Z3Y02HBT0K	24				0	1
1512#Tax1E4D3Z3Y02GMZP1	24				0	1
2956#Tax1E4D3Z3Y02G351E	25				0	1
2382#Tax1E4D3Z3Y02IGOB6	24				0	1
2564#Tax1E4D3Z3Y02F7VTQ	16				0	2
2946#Tax1E4D3Z3Y02I64SH	22				0	2
4502#Tax1E4D3Z3Y02GCJKR	17				0	1
328#Taj1E4D3Z3Y02JS97K	21				1	0
4462#Tax1E4D3Z3Y02JN9MK	16				0	1
1223#Tax1E4D3Z3Y02HYIVT	18				0	1
628#Taj1E4D3Z3Y02GTOK5	17				1	0
4014#Tax1E4D3Z3Y02JYXGZ	22				0	1
4803#Tax1E4D3Z3Y02JXJ7S	25				0	1
3538#Tax1E4D3Z3Y02JLPNK	21				0	1
4271#Tax1E4D3Z3Y02GJO7O	17				0	1
733#Taj1E4D3Z3Y02JIITU	18				2	0
3745#Tax1E4D3Z3Y02G7B1J	30				0	1
997#Taj1E4D3Z3Y02HB60L	14				1	0
630#Taj1E4D3Z3Y02F4HQZ	14				2	0
3394#Tax1E4D3Z3Y02IO6ID	16				0	1
608#Taj1E4D3Z3Y02G9YG4	15				2	0
3263#Tax1E4D3Z3Y02GJZZ5	22				0	1
1649#Tax1E4D3Z3Y02HIOOP	20				0	1
1234#Tax1E4D3Z3Y02I9HVH	17				0	1
2226#Tax1E4D3Z3Y02IR7I7	21				0	2
2878#Tax1E4D3Z3Y02IMM4B	15				0	1
4108#Tax1E4D3Z3Y02HXA5E	23				0	1
4535#Tax1E4D3Z3Y02GSH19	14				0	1
1474#Tax1E4D3Z3Y02I9XWO	22				0	1
125#Taj1E4D3Z3Y02I5PNU	17				1	0
44#Taj1E4D3Z3Y02FZUR5	21				1	0
1687#Tax1E4D3Z3Y02G64YV	28				0	1
2152#Tax1E4D3Z3Y02IL2VC	14				0	1
1188#Taj1E4D3Z3Y02GJ741	23				1	0
3142#Tax1E4D3Z3Y02IDGK0	22				0	1
2008#Tax1E4D3Z3Y02JG9ST	18				0	1
2862#Tax1E4D3Z3Y02JKSE7	24				0	1
1564#Tax1E4D3Z3Y02IZNEW	23				0	1
714#Taj1E4D3Z3Y02HW0K3	13				1	0
4364#Tax1E4D3Z3Y02IG02P	20				0	1
2663#Tax1E4D3Z3Y02IKXAN	24				0	1
4690#Tax1E4D3Z3Y02JS6YB	24				0	1
4631#Tax1E4D3Z3Y02G91OW	30				0	1
397#Taj1E4D3Z3Y02GNMUA	23				1	0
1096#Taj1E4D3Z3Y02HAAAM	24				1	0
3285#Tax1E4D3Z3Y02HIZ8F	20				0	1
2934#Tax1E4D3Z3Y02JCQSZ	14				0	1
1657#Tax1E4D3Z3Y02JN308	24				0	1
3009#Tax1E4D3Z3Y02ICJFN	15				0	1
2185#Tax1E4D3Z3Y02I395M	24				0	1
4432#Tax1E4D3Z3Y02JCM3G	16				0	1
2717#Tax1E4D3Z3Y02J3NEP	18				0	2
1191#Taj1E4D3Z3Y02IK35O	14				1	0
823#Taj1E4D3Z3Y02JQOYS	26				2	0
4659#Tax1E4D3Z3Y02ICLQG	14				0	1
4666#Tax1E4D3Z3Y02HIW0D	13				0	1
771#Taj1E4D3Z3Y02H7GSM	13				1	0
401#Taj1E4D3Z3Y02F1M8Q	29				1	0
186#Taj1E4D3Z3Y02G05E5	15				4	0
1797#Tax1E4D3Z3Y02HOL5A	13				0	2
1119#Taj1E4D3Z3Y02HR9MN	13				1	0
1914#Tax1E4D3Z3Y02I4MBA	16				0	2
3039#Tax1E4D3Z3Y02G9JUV	16				0	1
1705#Tax1E4D3Z3Y02H8XG6	14				0	1
3000#Tax1E4D3Z3Y02JKI9W	23				0	1
915#Taj1E4D3Z3Y02F7VUI	14				3	0
2978#Tax1E4D3Z3Y02II2BA	19				0	1
1586#Tax1E4D3Z3Y02IM1LE	24				0	1
1986#Tax1E4D3Z3Y02GKNQC	24				0	1
4037#Tax1E4D3Z3Y02FVSNP	16				0	1
1456#Tax1E4D3Z3Y02GFWJ1	24				0	1
2606#Tax1E4D3Z3Y02HA23I	15				0	1
2060#Tax1E4D3Z3Y02I8LI7	24				0	1
1551#Tax1E4D3Z3Y02G8CEL	30				0	1
3561#Tax1E4D3Z3Y02H2DLE	16				0	3
3981#Tax1E4D3Z3Y02IDAUR	21				0	1
4607#Tax1E4D3Z3Y02F7XHE	28				0	1
2904#Tax1E4D3Z3Y02IWQWC	15				0	4
3643#Tax1E4D3Z3Y02JDLW9	23				0	1
2346#Tax1E4D3Z3Y02J3D65	14				0	1
2195#Tax1E4D3Z3Y02H6JUQ	15				0	1
561#Taj1E4D3Z3Y02GA663	20				9	0
2112#Tax1E4D3Z3Y02IXL8E	22				0	1
2221#Tax1E4D3Z3Y02GVZ9F	21				0	5
2555#Tax1E4D3Z3Y02H20I1	25				0	1
2982#Tax1E4D3Z3Y02JGR1E	23				0	1
3718#Tax1E4D3Z3Y02ICQ93	24				0	1
1307#Tax1E4D3Z3Y02INOWE	13				0	1
1812#Tax1E4D3Z3Y02JP6DB	17				0	1
1769#Tax1E4D3Z3Y02HIF0V	13				0	2
2475#Tax1E4D3Z3Y02INGVT	18				0	2
1875#Tax1E4D3Z3Y02JLBIW	13				0	1
3834#Tax1E4D3Z3Y02H36QV	13				0	1
1673#Tax1E4D3Z3Y02HVTD1	21				0	11
4084#Tax1E4D3Z3Y02GI41W	26				0	1
4027#Tax1E4D3Z3Y02HFUOU	24				0	1
963#Taj1E4D3Z3Y02GRFF6	19				1	0
297#Taj1E4D3Z3Y02GJGAG	17				1	0
2031#Tax1E4D3Z3Y02JM6TA	19				0	1
1596#Tax1E4D3Z3Y02HAW10	16				0	1
980#Taj1E4D3Z3Y02GA6Q7	19				1	0
2097#Tax1E4D3Z3Y02H8L56	17				0	1
2697#Tax1E4D3Z3Y02IOBQ0	16				0	1
1651#Tax1E4D3Z3Y02HT1R3	21				0	1
1569#Tax1E4D3Z3Y02H6RST	24				0	1
2542#Tax1E4D3Z3Y02JNK2R	21				0	1
2123#Tax1E4D3Z3Y02JMV08	21				0	1
530#Taj1E4D3Z3Y02FYCK3	24				1	0
3701#Tax1E4D3Z3Y02GATZN	15				0	1
3805#Tax1E4D3Z3Y02HFI6M	17				0	1
3067#Tax1E4D3Z3Y02HFHYI	24				0	1
2675#Tax1E4D3Z3Y02JTZ02	15				0	1
470#Taj1E4D3Z3Y02F3LA1	29				3	0
1524#Tax1E4D3Z3Y02I1XS8	17				0	1
4142#Tax1E4D3Z3Y02H2ZV4	15				0	1
2360#Tax1E4D3Z3Y02IBLA3	25				0	1
1287#Tax1E4D3Z3Y02H8YPB	20				0	1
4650#Tax1E4D3Z3Y02IP3E3	17				0	1
2403#Tax1E4D3Z3Y02G6IZZ	23				0	1
654#Taj1E4D3Z3Y02GY7P8	27				3	0
2261#Tax1E4D3Z3Y02IMFP7	14				0	1
156#Taj1E4D3Z3Y02G1NYH	21				1	0
283#Taj1E4D3Z3Y02JZZV4	24				1	0
3993#Tax1E4D3Z3Y02IM6WM	15				0	1
3414#Tax1E4D3Z3Y02IALYB	20				0	1
4178#Tax1E4D3Z3Y02HD6J7	14				0	1
4278#Tax1E4D3Z3Y02HT9Y9	16				0	1
1744#Tax1E4D3Z3Y02FRZDS	13				0	1
864#Taj1E4D3Z3Y02H8WFZ	18				1	0
2913#Tax1E4D3Z3Y02F3VBF	16				0	1
1170#Taj1E4D3Z3Y02JUC1R	13				1	0
3382#Tax1E4D3Z3Y02FVSVD	14				0	1
1896#Tax1E4D3Z3Y02HP1LX	27				0	1
2895#Tax1E4D3Z3Y02I2X0R	21				0	1
1686#Tax1E4D3Z3Y02JD2U0	22				0	1
1042#Taj1E4D3Z3Y02IX1PF	14				1	0
3874#Tax1E4D3Z3Y02H26YI	22				0	1
38#Taj1E4D3Z3Y02J19JB	22				1	0
196#Taj1E4D3Z3Y02FXGCM	22				12	0
4745#Tax1E4D3Z3Y02ITMSJ	27				0	1
4817#Tax1E4D3Z3Y02IL398	13				0	1
4143#Tax1E4D3Z3Y02IOGVJ	24				0	1
1169#Taj1E4D3Z3Y02FVZVW	24				1	0
3816#Tax1E4D3Z3Y02JPJRE	27				0	1
118#Taj1E4D3Z3Y02GQ9YM	14				1	0
1674#Tax1E4D3Z3Y02IO0SB	18				0	2
1065#Taj1E4D3Z3Y02G01JN	24				1	0
1659#Tax1E4D3Z3Y02HMCAK	15				0	1
767#Taj1E4D3Z3Y02J5EYV	15				1	0
2173#Tax1E4D3Z3Y02H5LF5	18				0	1
4396#Tax1E4D3Z3Y02H97EA	15				0	1
84#Taj1E4D3Z3Y02ISORP	24				1	0
805#Taj1E4D3Z3Y02GMZN4	22				1	0
1020#Taj1E4D3Z3Y02F2ZNH	24				1	0
4068#Tax1E4D3Z3Y02HIU5B	16				0	1
437#Taj1E4D3Z3Y02JHADX	15				1	0
194#Taj1E4D3Z3Y02IO8UX	22				1	0
1768#Tax1E4D3Z3Y02GEMGL	16				0	1
2749#Tax1E4D3Z3Y02GG66X	18				0	1
3503#Tax1E4D3Z3Y02INRC7	14				0	1
2395#Tax1E4D3Z3Y02G579K	16				0	2
4129#Tax1E4D3Z3Y02G1SDH	18				0	1
1021#Taj1E4D3Z3Y02IOVHT	18				1	0
4212#Tax1E4D3Z3Y02JZZN0	13				0	1
934#Taj1E4D3Z3Y02GWG1M	21				2	0
1989#Tax1E4D3Z3Y02GXC01	17				0	1
4035#Tax1E4D3Z3Y02JT4EG	14				0	1
3537#Tax1E4D3Z3Y02JSP5R	23				0	1
4821#Tax1E4D3Z3Y02JSDEO	16				0	1
948#Taj1E4D3Z3Y02J5TJT	14				1	0
4120#Tax1E4D3Z3Y02JYA8D	18				0	1
2160#Tax1E4D3Z3Y02HKBJU	24				0	2
3785#Tax1E4D3Z3Y02IPQRV	18				0	1
2450#Tax1E4D3Z3Y02IC849	16				0	1
1398#Tax1E4D3Z3Y02ITKH1	15				0	1
3986#Tax1E4D3Z3Y02H7URY	14				0	1
226#Taj1E4D3Z3Y02IW9Y2	26				1	0
4296#Tax1E4D3Z3Y02HYR80	15				0	1
1430#Tax1E4D3Z3Y02GBIJK	24				0	2
527#Taj1E4D3Z3Y02HYLYX	25				1	0
1145#Taj1E4D3Z3Y02FXY7A	15				1	0
1870#Tax1E4D3Z3Y02HQ09C	24				0	1
2466#Tax1E4D3Z3Y02I77ZH	20				0	1
3229#Tax1E4D3Z3Y02GSXDA	25				0	1
62#Taj1E4D3Z3Y02JG2WK	17				1	0
833#Taj1E4D3Z3Y02F2AZC	14				25	0
4513#Tax1E4D3Z3Y02JQE9G	16				0	1
4794#Tax1E4D3Z3Y02HW9LS	14				0	1
2743#Tax1E4D3Z3Y02G3JDR	14				0	1
4588#Tax1E4D3Z3Y02JKL57	30				0	1
3276#Tax1E4D3Z3Y02IKLW8	17				0	1
3649#Tax1E4D3Z3Y02HZ4O3	16				0	1
548#Taj1E4D3Z3Y02I3LZ7	22				3	0
2575#Tax1E4D3Z3Y02GG0R4	17				0	1
3450#Tax1E4D3Z3Y02JZT4E	23				0	1
3697#Tax1E4D3Z3Y02I2WA0	18				0	1
4641#Tax1E4D3Z3Y02JK9ZD	20				0	1
1110#Taj1E4D3Z3Y02G4QGQ	24				1	0
1999#Tax1E4D3Z3Y02FLJQO	14				0	1
2204#Tax1E4D3Z3Y02FP676	15				0	1
3466#Tax1E4D3Z3Y02JS41E	16				0	1
3632#Tax1E4D3Z3Y02GO2A5	24				0	1
783#Taj1E4D3Z3Y02HIU8R	23				1	0
1357#Tax1E4D3Z3Y02GN6P6	24				0	1
1152#Taj1E4D3Z3Y02JS0C5	24				1	0
4684#Tax1E4D3Z3Y02IND3T	20				0	1
49#Taj1E4D3Z3Y02HHG5W	13				101	0
789#Taj1E4D3Z3Y02F9Q1M	26				1	0
2046#Tax1E4D3Z3Y02HL8W8	30				0	1
2967#Tax1E4D3Z3Y02IXFLA	26				0	1
2117#Tax1E4D3Z3Y02JZXZQ	16				0	2
4398#Tax1E4D3Z3Y02JI8QB	15				0	1
1934#Tax1E4D3Z3Y02F215M	14				0	2
715#Taj1E4D3Z3Y02HHNPH	22				1	0
1916#Tax1E4D3Z3Y02I4EKD	24				0	1
2201#Tax1E4D3Z3Y02HHLIN	17				0	1
3615#Tax1E4D3Z3Y02JWMN1	16				0	1
4232#Tax1E4D3Z3Y02HQKIZ	18				0	1
1722#Tax1E4D3Z3Y02ISU5Z	15				0	1
23#Taj1E4D3Z3Y02GWAFV	21				1	0
364#Taj1E4D3Z3Y02GHKG2	16				1	0
3069#Tax1E4D3Z3Y02JX4RT	17				0	1
3931#Tax1E4D3Z3Y02GTH2L	13				0	1
4568#Tax1E4D3Z3Y02GOTE1	19				0	1
950#Taj1E4D3Z3Y02JK1XP	15				1	0
2680#Tax1E4D3Z3Y02GNDTM	13				0	1
2957#Tax1E4D3Z3Y02JXGV1	18				0	3
1845#Tax1E4D3Z3Y02J5MXP	18				0	1
1678#Tax1E4D3Z3Y02FZ9SD	27				0	1
1445#Tax1E4D3Z3Y02GI9ME	15				0	1
1025#Taj1E4D3Z3Y02GRMTW	24				1	0
4692#Tax1E4D3Z3Y02GRHGW	23				0	1
3429#Tax1E4D3Z3Y02JRTRC	16				0	1
3580#Tax1E4D3Z3Y02GKDP2	26				0	1
1992#Tax1E4D3Z3Y02I87PV	20				0	1
3073#Tax1E4D3Z3Y02H2YSU	16				0	1
4375#Tax1E4D3Z3Y02H3AS4	21				0	1
2478#Tax1E4D3Z3Y02GG6MA	14				0	1
1466#Tax1E4D3Z3Y02FQEL9	24				0	1
2340#Tax1E4D3Z3Y02IX7W9	23				0	1
4248#Tax1E4D3Z3Y02G71LR	16				0	1
4534#Tax1E4D3Z3Y02I41DQ	25				0	1
778#Taj1E4D3Z3Y02H0QN2	22				4	0
3555#Tax1E4D3Z3Y02IULB9	21				0	1
720#Taj1E4D3Z3Y02GCGND	18				12	0
4430#Tax1E4D3Z3Y02HMTV7	14				0	1
2449#Tax1E4D3Z3Y02IYI1E	22				0	1
460#Taj1E4D3Z3Y02F3HLR	25				2	0
4627#Tax1E4D3Z3Y02JFB6Z	24				0	1
244#Taj1E4D3Z3Y02F9XGJ	15				1	0
4107#Tax1E4D3Z3Y02IFKU9	21				0	1
4168#Tax1E4D3Z3Y02HHS7P	24				0	1
3220#Tax1E4D3Z3Y02ICI5L	27				0	1
3744#Tax1E4D3Z3Y02GTETG	19				0	1
4838#Tax1E4D3Z3Y02HIP7T	29				0	1
2811#Tax1E4D3Z3Y02GBNG6	16				0	2
3854#Tax1E4D3Z3Y02I8JHU	15				0	1
1607#Tax1E4D3Z3Y02JK7VT	18				0	1
1386#Tax1E4D3Z3Y02HS3J8	23				0	1
1536#Tax1E4D3Z3Y02GP2ZJ	13				0	1
2617#Tax1E4D3Z3Y02HZVKN	14				0	1
3893#Tax1E4D3Z3Y02JDS68	14				0	1
4187#Tax1E4D3Z3Y02HDPBN	20				0	1
452#Taj1E4D3Z3Y02H6NVH	24				1	0
295#Taj1E4D3Z3Y02FW3AB	13				1	0
579#Taj1E4D3Z3Y02G9KXB	22				1	0
3956#Tax1E4D3Z3Y02HUUYF	15				0	1
1618#Tax1E4D3Z3Y02HRIHE	18				0	1
3136#Tax1E4D3Z3Y02II0U9	23				0	1
3301#Tax1E4D3Z3Y02H3327	15				0	2
4701#Tax1E4D3Z3Y02G3IEN	16				0	1
77#Taj1E4D3Z3Y02F0SYN	18				2	0
541#Taj1E4D3Z3Y02HCU27	16				1	0
3890#Tax1E4D3Z3Y02JJ7GB	15				0	1
4317#Tax1E4D3Z3Y02GEEXK	20				0	1
1628#Tax1E4D3Z3Y02GZEJX	23				0	1
897#Taj1E4D3Z3Y02HPSI6	14				1	0
3219#Tax1E4D3Z3Y02IJIQW	17				0	1
3671#Tax1E4D3Z3Y02H4BX6	17				0	1
3871#Tax1E4D3Z3Y02ITVTI	26				0	1
3911#Tax1E4D3Z3Y02GKAUA	16				0	5
237#Taj1E4D3Z3Y02GR5WI	16				1	0
2584#Tax1E4D3Z3Y02IKB8J	22				0	1
2722#Tax1E4D3Z3Y02H5SOO	20				0	1
2371#Tax1E4D3Z3Y02HPB2S	22				0	1
2519#Tax1E4D3Z3Y02GS87J	15				0	1
2923#Tax1E4D3Z3Y02HYFKJ	17				0	1
2610#Tax1E4D3Z3Y02IZGYU	29				0	1
416#Taj1E4D3Z3Y02JRUD5	24				2	0
2950#Tax1E4D3Z3Y02GE6S6	24				0	3
3212#Tax1E4D3Z3Y02GD03U	20				0	1
4154#Tax1E4D3Z3Y02HBKO0	17				0	1
4407#Tax1E4D3Z3Y02G34YS	30				0	1
100#Taj1E4D3Z3Y02GZJZ8	28				1	0
914#Taj1E4D3Z3Y02F9U7T	24				1	0
4756#Tax1E4D3Z3Y02JT1UE	24				0	1
300#Taj1E4D3Z3Y02G2E0C	18				6	0
1439#Tax1E4D3Z3Y02HL9TT	14				0	2
4419#Tax1E4D3Z3Y02HTK94	17				0	1
2405#Tax1E4D3Z3Y02GI3QU	19				0	1
3654#Tax1E4D3Z3Y02G1BTD	15				0	1
4710#Tax1E4D3Z3Y02G18ZZ	21				0	1
2232#Tax1E4D3Z3Y02IM3XU	19				0	1
3642#Tax1E4D3Z3Y02HVK7X	15				0	1
4646#Tax1E4D3Z3Y02I7L7K	24				0	1
1407#Tax1E4D3Z3Y02GDPES	17				0	2
2432#Tax1E4D3Z3Y02G5AN3	25				0	1
3946#Tax1E4D3Z3Y02IBHP4	26				0	1
496#Taj1E4D3Z3Y02H7W3M	21				1	0
2829#Tax1E4D3Z3Y02G01L0	21				0	1
605#>Taj1E4D3Z3Y02G0S5P	16				1	0
2987#Tax1E4D3Z3Y02IDUYR	13				0	1
2581#Tax1E4D3Z3Y02IN8BS	14				0	1
4760#Tax1E4D3Z3Y02JB1TT	24				0	1
1699#Tax1E4D3Z3Y02GUJI4	24				0	1
42#Taj1E4D3Z3Y02FVTAA	26				1	0
759#Taj1E4D3Z3Y02GSZF4	19				1	0
1228#Tax1E4D3Z3Y02JVWJN	24				0	1
235#Taj1E4D3Z3Y02GETTY	23				1	0
2291#Tax1E4D3Z3Y02GFCSS	24				0	1
1931#Tax1E4D3Z3Y02GVQEA	25				0	1
2591#Tax1E4D3Z3Y02HHU9J	24				0	1
694#Taj1E4D3Z3Y02GCAIK	13				2	0
1103#Taj1E4D3Z3Y02GYVF6	20				2	0
4444#Tax1E4D3Z3Y02JVB9C	15				0	1
2244#Tax1E4D3Z3Y02FXL92	25				0	1
3148#Tax1E4D3Z3Y02IX8AF	26				0	1
3788#Tax1E4D3Z3Y02I2R4P	14				0	1
4268#Tax1E4D3Z3Y02JBAW7	14				0	1
265#Taj1E4D3Z3Y02GOYOH	14				1	0
296#Taj1E4D3Z3Y02F6QLK	22				3	0
171#Taj1E4D3Z3Y02J38UT	14				1	0
3999#Tax1E4D3Z3Y02I5TMD	15				0	1
4206#Tax1E4D3Z3Y02HR0UE	13				0	1
4327#Tax1E4D3Z3Y02GIB73	26				0	1
2687#Tax1E4D3Z3Y02GU7YS	13				0	4
2012#Tax1E4D3Z3Y02JAAWF	24				0	1
3201#Tax1E4D3Z3Y02HZLES	22				0	1
582#Taj1E4D3Z3Y02IEUE3	20				1	0
3257#Tax1E4D3Z3Y02JOZ1G	14				0	1
1884#Tax1E4D3Z3Y02F5TUH	14				0	1
4167#Tax1E4D3Z3Y02JWLQ3	15				0	1
557#Taj1E4D3Z3Y02FXNPR	22				2	0
3621#Tax1E4D3Z3Y02GBG3X	13				0	1
2726#Tax1E4D3Z3Y02IVKWO	29				0	1
441#Taj1E4D3Z3Y02F8S5Q	22				1	0
3325#Tax1E4D3Z3Y02JWTT5	18				0	1
4041#Tax1E4D3Z3Y02JTCXF	23				0	1
672#Taj1E4D3Z3Y02IHNAM	17				2	0
983#Taj1E4D3Z3Y02FV8GF	14				2	0
4257#Tax1E4D3Z3Y02IIGT7	23				0	1
3689#Tax1E4D3Z3Y02HK7PI	18				0	1
3806#Tax1E4D3Z3Y02G6AQ7	15				0	1
4482#Tax1E4D3Z3Y02JIMW5	16				0	1
3496#Tax1E4D3Z3Y02GYAB5	14				0	1
751#Taj1E4D3Z3Y02F0DJQ	13				1	0
1746#Tax1E4D3Z3Y02IFB87	26				0	1
3356#Tax1E4D3Z3Y02IZ6SN	20				0	1
4300#Tax1E4D3Z3Y02GN4XR	22				0	1
4551#Tax1E4D3Z3Y02HKGCF	25				0	1
2167#Tax1E4D3Z3Y02GRNZJ	14				0	1
1980#Tax1E4D3Z3Y02IDO3V	19				0	2
2275#Tax1E4D3Z3Y02HXCON	30				0	1
4004#Tax1E4D3Z3Y02HZ6AG	24				0	1
677#Taj1E4D3Z3Y02HV8HO	15				1	0
907#Taj1E4D3Z3Y02GOUIR	21				1	0
1868#Tax1E4D3Z3Y02GGEW4	26				0	1
3480#Tax1E4D3Z3Y02JJ7GX	22				0	1
1210#Tax1E4D3Z3Y02GKROT	21				0	1
3154#Tax1E4D3Z3Y02JS6LE	24				0	1
590#Taj1E4D3Z3Y02IAG32	24				1	0
4201#Tax1E4D3Z3Y02JETTG	24				0	1
664#Taj1E4D3Z3Y02G4A12	15				2	0
1790#Tax1E4D3Z3Y02IJQL1	30				0	1
4363#Tax1E4D3Z3Y02H0A83	24				0	1
2264#Tax1E4D3Z3Y02H6GIN	22				0	1
79#Taj1E4D3Z3Y02JNBKB	15				1	0
1420#Tax1E4D3Z3Y02IQ4WX	15				0	1
3845#Tax1E4D3Z3Y02JUVKQ	26				0	2
3295#Tax1E4D3Z3Y02G4BNP	26				0	1
3437#Tax1E4D3Z3Y02H215P	30				0	1
352#Taj1E4D3Z3Y02HNVB3	18				1	0
2502#Tax1E4D3Z3Y02I8V0J	27				0	1
3865#Tax1E4D3Z3Y02HLFSR	21				0	1
126#Taj1E4D3Z3Y02GDOI1	26				1	0
1034#Taj1E4D3Z3Y02JQT33	21				1	0
2803#Tax1E4D3Z3Y02J2UY6	14				0	1
2875#Tax1E4D3Z3Y02F7KV9	24				0	1
1533#Tax1E4D3Z3Y02HQL6R	18				0	1
3679#Tax1E4D3Z3Y02GADY6	20				0	1
651#Taj1E4D3Z3Y02GN71O	21				1	0
176#Taj1E4D3Z3Y02GBK0Z	20				1	0
4660#Tax1E4D3Z3Y02JIHBP	18				0	1
3145#Tax1E4D3Z3Y02GPQBL	17				0	1
947#Taj1E4D3Z3Y02H45MB	25				1	0
256#Taj1E4D3Z3Y02H93RT	23				1	0
2810#Tax1E4D3Z3Y02GU93L	20				0	1
920#Taj1E4D3Z3Y02FRIKM	24				1	0
428#Taj1E4D3Z3Y02JSD3G	27				1	0
2305#Tax1E4D3Z3Y02GSK1L	19				0	1
4840#Tax1E4D3Z3Y02HSH9D	21				0	1
4545#Tax1E4D3Z3Y02J3LX5	16				0	1
3545#Tax1E4D3Z3Y02IZ2DZ	24				0	1
3758#Tax1E4D3Z3Y02H7KXO	24				0	1
4344#Tax1E4D3Z3Y02F8L8S	24				0	1
500#Taj1E4D3Z3Y02FW6CE	14				1	0
1221#Tax1E4D3Z3Y02I3H7I	24				0	1
1757#Tax1E4D3Z3Y02HAD33	27				0	1
1200#Taj1E4D3Z3Y02HFISY	25				1	0
4193#Tax1E4D3Z3Y02HLNGF	14				0	2
918#Taj1E4D3Z3Y02JLBU8	24				1	0
1413#Tax1E4D3Z3Y02FUZUS	29				0	1
4386#Tax1E4D3Z3Y02HWTOT	21				0	1
1275#Tax1E4D3Z3Y02G8QI0	16				0	2
2107#Tax1E4D3Z3Y02JHUU4	16				0	1
1598#Tax1E4D3Z3Y02IYQW9	18				0	1
2211#Tax1E4D3Z3Y02G0VWD	19				0	2
3453#Tax1E4D3Z3Y02I6XZA	19				0	1
1856#Tax1E4D3Z3Y02FVGW9	15				0	1
1491#Tax1E4D3Z3Y02JB9QU	15				0	1
1362#Tax1E4D3Z3Y02JEKDY	24				0	2
4155#Tax1E4D3Z3Y02I496C	24				0	1
1804#Tax1E4D3Z3Y02GCH83	20				0	1
632#Taj1E4D3Z3Y02HG3OT	13				12	0
1371#Tax1E4D3Z3Y02GPK9H	21				0	1
2357#Tax1E4D3Z3Y02J5BKI	28				0	1
394#Taj1E4D3Z3Y02IR0SS	22				1	0
2484#Tax1E4D3Z3Y02GJ4QY	21				0	1
2659#Tax1E4D3Z3Y02G96I6	24				0	1
513#Taj1E4D3Z3Y02HQRIA	17				2	0
3938#Tax1E4D3Z3Y02FW6ZF	21				0	1
50#Taj1E4D3Z3Y02IEEMH	15				8	0
2645#Tax1E4D3Z3Y02G96RR	18				0	1
1519#Tax1E4D3Z3Y02H3Q2L	30				0	1
2633#Tax1E4D3Z3Y02GAUNF	24				0	1
3173#Tax1E4D3Z3Y02JDCC9	16				0	1
797#Taj1E4D3Z3Y02H6YIV	18				1	0
2197#Tax1E4D3Z3Y02IUOE7	15				0	1
2459#Tax1E4D3Z3Y02I1BBJ	17				0	1
3543#Tax1E4D3Z3Y02H2YNA	20				0	2
4318#Tax1E4D3Z3Y02FSNGE	19				0	1
1236#Tax1E4D3Z3Y02G8G01	24				0	1
2413#Tax1E4D3Z3Y02ISX4F	15				0	1
645#Taj1E4D3Z3Y02GSYMJ	24				1	0
2566#Tax1E4D3Z3Y02HOUXZ	18				0	1
4400#Tax1E4D3Z3Y02JRH48	22				0	1
1176#Taj1E4D3Z3Y02IGLCK	24				1	0
1815#Tax1E4D3Z3Y02IW1HY	24				0	1
2881#Tax1E4D3Z3Y02JCABV	14				0	1
1039#Taj1E4D3Z3Y02IJ6PL	25				1	0
3662#Tax1E4D3Z3Y02H4Z2U	23				0	1
1005#Taj1E4D3Z3Y02GI53E	21				1	0
4280#Tax1E4D3Z3Y02I9WQ2	19				0	1
4723#Tax1E4D3Z3Y02IDNB6	13				0	1
28#Taj1E4D3Z3Y02GFF4K	18				1	0
2089#Tax1E4D3Z3Y02J2BZV	18				0	1
4130#Tax1E4D3Z3Y02GVSDO	27				0	1
2087#Tax1E4D3Z3Y02FNDN5	24				0	1
3474#Tax1E4D3Z3Y02JXKD9	13				0	1
4575#Tax1E4D3Z3Y02GASTW	13				0	1
215#Taj1E4D3Z3Y02H9BLE	20				1	0
3320#Tax1E4D3Z3Y02JVCB1	15				0	6
4410#Tax1E4D3Z3Y02GVEU2	16				0	1
687#Taj1E4D3Z3Y02FSG7L	22				2	0
2184#Tax1E4D3Z3Y02HKD1Z	25				0	1
2298#Tax1E4D3Z3Y02JCHVK	19				0	1
3161#Tax1E4D3Z3Y02GORWH	15				0	1
2336#Tax1E4D3Z3Y02HGVJO	15				0	1
4424#Tax1E4D3Z3Y02IJEWH	17				0	1
2190#Tax1E4D3Z3Y02GX6SS	15				0	1
826#Taj1E4D3Z3Y02HMLB0	24				1	0
1344#Tax1E4D3Z3Y02J3LIP	19				0	1
2494#Tax1E4D3Z3Y02F68WL	23				0	1
3990#Tax1E4D3Z3Y02HCH2B	24				0	1
3840#Tax1E4D3Z3Y02JUVKZ	26				0	1
2329#Tax1E4D3Z3Y02IDK37	15				0	1
3338#Tax1E4D3Z3Y02GCN44	24				0	1
4437#Tax1E4D3Z3Y02IPL7J	15				0	1
2980#Tax1E4D3Z3Y02JCB0G	24				0	1
2653#Tax1E4D3Z3Y02IGU3O	18				0	1
2548#Tax1E4D3Z3Y02HENG6	23				0	3
620#Taj1E4D3Z3Y02HMN5D	24				1	0
4194#Tax1E4D3Z3Y02FP517	30				0	1
2625#Tax1E4D3Z3Y02I8F2M	15				0	1
3400#Tax1E4D3Z3Y02G7YBM	15				0	1
4090#Tax1E4D3Z3Y02H5L27	15				0	1
937#Taj1E4D3Z3Y02FP3KF	19				1	0
3266#Tax1E4D3Z3Y02JJE8O	24				0	1
16#Taj1E4D3Z3Y02GVAFH	16				3	0
730#Taj1E4D3Z3Y02FZKJQ	15				1	0
921#Taj1E4D3Z3Y02FRU4I	13				1	0
3833#Tax1E4D3Z3Y02JF707	14				0	1
2880#Tax1E4D3Z3Y02IIK37	29				0	1
2311#Tax1E4D3Z3Y02FI5SO	26				0	1
3631#Tax1E4D3Z3Y02HEHO7	13				0	1
2556#Tax1E4D3Z3Y02F69YO	20				0	1
994#Taj1E4D3Z3Y02FLCUW	13				2	0
1786#Tax1E4D3Z3Y02IQE3X	22				0	1
2320#Tax1E4D3Z3Y02HFT32	17				0	1
2140#Tax1E4D3Z3Y02GNE7Q	24				0	1
2440#Tax1E4D3Z3Y02HTIOI	22				0	4
2788#Tax1E4D3Z3Y02JDFQV	18				0	1
1523#Tax1E4D3Z3Y02JKKIF	17				0	1
3578#Tax1E4D3Z3Y02I5FQM	25				0	2
4667#Tax1E4D3Z3Y02HZ9P8	15				0	1
93#Taj1E4D3Z3Y02JY1TD	13				14	0
3055#Tax1E4D3Z3Y02HZPVR	16				0	1
2429#Tax1E4D3Z3Y02JEYMR	13				0	1
3040#Tax1E4D3Z3Y02FVYTY	22				0	1
374#Taj1E4D3Z3Y02FUKEI	24				4	0
2790#Tax1E4D3Z3Y02INVUZ	24				0	1
1306#Tax1E4D3Z3Y02JBOAP	24				0	1
3876#Tax1E4D3Z3Y02G082D	15				0	1
429#Taj1E4D3Z3Y02G6KQL	23				1	0
3688#Tax1E4D3Z3Y02G35GG	16				0	1
4576#Tax1E4D3Z3Y02GJ49Z	23				0	1
1328#Tax1E4D3Z3Y02IMJO6	21				0	3
3097#Tax1E4D3Z3Y02G1Y1M	27				0	1
3767#Tax1E4D3Z3Y02I96CS	29				0	1
4049#Tax1E4D3Z3Y02H8HBT	21				0	1
1091#Taj1E4D3Z3Y02F97H8	22				3	0
409#Taj1E4D3Z3Y02G0C7H	16				1	0
1962#Tax1E4D3Z3Y02HY96A	24				0	1
1958#Tax1E4D3Z3Y02GOSA8	21				0	1
4594#Tax1E4D3Z3Y02J1LQF	17				0	1
812#Taj1E4D3Z3Y02GUHXF	20				1	0
489#Taj1E4D3Z3Y02GWPQL	24				1	0
585#Taj1E4D3Z3Y02F3ZH1	17				1	0
3711#Tax1E4D3Z3Y02JBHZA	23				0	1
1392#Tax1E4D3Z3Y02G61QJ	24				0	1
4633#Tax1E4D3Z3Y02F9C24	22				0	1
1080#Taj1E4D3Z3Y02HOJBO	21				1	0
2819#Tax1E4D3Z3Y02FZNH4	25				0	1
4724#Tax1E4D3Z3Y02IVC9D	22				0	1
732#Taj1E4D3Z3Y02JVFKP	16				1	0
2233#Tax1E4D3Z3Y02JHNMK	24				0	3
4653#Tax1E4D3Z3Y02JXM9Y	15				0	1
622#Taj1E4D3Z3Y02HBYAL	16				1	0
970#Taj1E4D3Z3Y02IO06K	24				1	0
2381#Tax1E4D3Z3Y02F3BGZ	13				0	1
1416#Tax1E4D3Z3Y02IH9S8	20				0	2
2771#Tax1E4D3Z3Y02IV7XJ	15				0	2
2256#Tax1E4D3Z3Y02FMH16	14				0	1
1658#Tax1E4D3Z3Y02G0URY	24				0	1
2057#Tax1E4D3Z3Y02FPUGU	13				0	1
1635#Tax1E4D3Z3Y02H0MT5	14				0	1
1237#Tax1E4D3Z3Y02IG0N4	24				0	1
2361#Tax1E4D3Z3Y02GMPRO	14				0	1
2490#Tax1E4D3Z3Y02JIAGJ	17				0	1
2563#Tax1E4D3Z3Y02IRIT4	22				0	3
3086#Tax1E4D3Z3Y02I8YWZ	24				0	1
4749#Tax1E4D3Z3Y02HD65V	22				0	1
4333#Tax1E4D3Z3Y02INU3Z	28				0	1
3991#Tax1E4D3Z3Y02HOU2N	22				0	1
4461#Tax1E4D3Z3Y02JOEXF	17				0	1
270#Taj1E4D3Z3Y02IGMBK	13				1	0
2840#Tax1E4D3Z3Y02FX5V4	13				0	1
1602#Tax1E4D3Z3Y02GY653	17				0	2
2007#Tax1E4D3Z3Y02I38G8	21				0	1
4226#Tax1E4D3Z3Y02HXF6U	16				0	1
1332#Tax1E4D3Z3Y02GVLH2	22				0	1
1399#Tax1E4D3Z3Y02FS8F6	18				0	1
1117#Taj1E4D3Z3Y02HGQ3R	13				1	0
740#Taj1E4D3Z3Y02G9L9B	19				2	0
103#Taj1E4D3Z3Y02GLSPZ	17				2	0
3434#Tax1E4D3Z3Y02FYLRO	23				0	1
871#Taj1E4D3Z3Y02HDO1E	21				1	0
3393#Tax1E4D3Z3Y02JDCQI	21				0	1
2039#Tax1E4D3Z3Y02GSCPT	16				0	2
4528#Tax1E4D3Z3Y02GWBHG	17				0	1
3826#Tax1E4D3Z3Y02JO92I	16				0	1
4042#Tax1E4D3Z3Y02HXC6H	14				0	1
3363#Tax1E4D3Z3Y02GSF43	19				0	1
1219#Tax1E4D3Z3Y02F6S5Y	22				0	1
2534#Tax1E4D3Z3Y02IGEMM	16				0	1
3774#Tax1E4D3Z3Y02IQX5I	14				0	1
1704#Tax1E4D3Z3Y02IWOPE	24				0	1
1749#Tax1E4D3Z3Y02JGHBD	15				0	1
688#Taj1E4D3Z3Y02FNGX4	19				1	0
750#Taj1E4D3Z3Y02GYLUW	21				3	0
1126#Taj1E4D3Z3Y02IEERE	17				1	0
2128#Tax1E4D3Z3Y02I4XG0	20				0	1
3926#Tax1E4D3Z3Y02JKT5G	13				0	1
1534#Tax1E4D3Z3Y02J1MTO	23				0	1
2570#Tax1E4D3Z3Y02HGLS3	16				0	1
1915#Tax1E4D3Z3Y02IGIIC	16				0	1
3729#Tax1E4D3Z3Y02GT6RH	29				0	1
4523#Tax1E4D3Z3Y02G4CSI	13				0	1
2737#Tax1E4D3Z3Y02HIE5D	22				0	1
83#Taj1E4D3Z3Y02FYJJG	20				23	0
804#Taj1E4D3Z3Y02HYN2J	17				1	0
3375#Tax1E4D3Z3Y02JFG5I	24				0	1
4503#Tax1E4D3Z3Y02H7CAI	16				0	1
1385#Tax1E4D3Z3Y02IWWP3	15				0	1
2672#Tax1E4D3Z3Y02IX4ZK	14				0	1
4156#Tax1E4D3Z3Y02JIUOR	22				0	1
1818#Tax1E4D3Z3Y02GX8PU	17				0	1
2094#Tax1E4D3Z3Y02GI7A7	24				0	1
962#Taj1E4D3Z3Y02H11J9	19				1	0
1837#Tax1E4D3Z3Y02HIJKV	25				0	1
3778#Tax1E4D3Z3Y02H8FBF	24				0	1
143#Taj1E4D3Z3Y02F81EY	19				2	0
3090#Tax1E4D3Z3Y02JLNFZ	24				0	1
4020#Tax1E4D3Z3Y02ILB5R	18				0	1
2323#Tax1E4D3Z3Y02H4V8Z	19				0	1
2822#Tax1E4D3Z3Y02JC8AG	20				0	1
3049#Tax1E4D3Z3Y02ID56F	24				0	1
1051#Taj1E4D3Z3Y02HJW5G	26				1	0
3033#Tax1E4D3Z3Y02IN4AD	14				0	1
518#Taj1E4D3Z3Y02HL1E2	13				1	0
4802#Tax1E4D3Z3Y02I3YXB	15				0	1
2914#Tax1E4D3Z3Y02F46YD	20				0	1
1211#Tax1E4D3Z3Y02J4LEC	16				0	1
2906#Tax1E4D3Z3Y02FNSX8	21				0	1
2732#Tax1E4D3Z3Y02I85NX	22				0	1
2852#Tax1E4D3Z3Y02GX41N	23				0	1
3221#Tax1E4D3Z3Y02ILH33	20				0	1
2155#Tax1E4D3Z3Y02HOVXP	13				0	1
1711#Tax1E4D3Z3Y02JUJRF	14				0	1
1542#Tax1E4D3Z3Y02HYFZ5	13				0	1
2399#Tax1E4D3Z3Y02JY2JP	13				0	1
2991#Tax1E4D3Z3Y02JMUQL	23				0	1
2102#Tax1E4D3Z3Y02HZ2TC	20				0	1
2836#Tax1E4D3Z3Y02JMTP2	19				0	1
4780#Tax1E4D3Z3Y02GKQY5	24				0	1
3720#Tax1E4D3Z3Y02GPQM0	14				0	1
478#Taj1E4D3Z3Y02I4QT9	21				2	0
3242#Tax1E4D3Z3Y02GUIR4	17				0	2
384#Taj1E4D3Z3Y02GBZG6	22				15	0
4052#Tax1E4D3Z3Y02HF6AC	14				0	1
836#Taj1E4D3Z3Y02GIT8I	21				7	0
4028#Tax1E4D3Z3Y02JHQN5	14				0	1
3068#Tax1E4D3Z3Y02I84YC	17				0	1
1735#Tax1E4D3Z3Y02ICP4U	24				0	1
3989#Tax1E4D3Z3Y02IRAJ3	19				0	1
3512#Tax1E4D3Z3Y02I0S1T	14				0	2
2030#Tax1E4D3Z3Y02GCPW0	22				0	1
2286#Tax1E4D3Z3Y02JMS44	23				0	1
1595#Tax1E4D3Z3Y02GTLNV	24				0	1
1750#Tax1E4D3Z3Y02G51YP	14				0	1
1610#Tax1E4D3Z3Y02F8SAU	18				0	1
4715#Tax1E4D3Z3Y02ICPCP	30				0	1
779#Taj1E4D3Z3Y02H2NCZ	24				1	0
343#Taj1E4D3Z3Y02GDZQ0	14				1	0
3910#Tax1E4D3Z3Y02JJW7T	21				0	1
697#Taj1E4D3Z3Y02HZ64T	21				3	0
981#Taj1E4D3Z3Y02G3C8V	24				9	0
3001#Tax1E4D3Z3Y02G8VH7	14				0	1
857#Taj1E4D3Z3Y02J2NGU	18				1	0
707#Taj1E4D3Z3Y02F7JQA	21				11	0
1010#Taj1E4D3Z3Y02GM7V5	22				2	0
3310#Tax1E4D3Z3Y02IGHS8	24				0	1
4077#Tax1E4D3Z3Y02IRVFP	19				0	1
4279#Tax1E4D3Z3Y02GOB97	26				0	1
261#Taj1E4D3Z3Y02F8LNG	13				3	0
4083#Tax1E4D3Z3Y02HJW5W	18				0	1
4685#Tax1E4D3Z3Y02IADY1	25				0	1
2439#Tax1E4D3Z3Y02H3W1A	30				0	1
3739#Tax1E4D3Z3Y02I8UVL	17				0	1
321#Taj1E4D3Z3Y02GK5Q2	13				1	0
3209#Tax1E4D3Z3Y02IAVOK	28				0	1
2896#Tax1E4D3Z3Y02IHLKV	26				0	1
1079#Taj1E4D3Z3Y02IWV7E	14				2	0
2422#Tax1E4D3Z3Y02IKCYD	15				0	1
3407#Tax1E4D3Z3Y02IRTXH	27				0	1
1590#Tax1E4D3Z3Y02HMA7W	16				0	3
1652#Tax1E4D3Z3Y02HJK06	29				0	1
4816#Tax1E4D3Z3Y02J4L7B	24				0	1
3980#Tax1E4D3Z3Y02H6KFH	16				0	1
2933#Tax1E4D3Z3Y02F6L4D	19				0	1
760#Taj1E4D3Z3Y02IRZ20	20				1	0
863#Taj1E4D3Z3Y02HZ5T7	13				2	0
531#Taj1E4D3Z3Y02FXPIW	20				1	0
2469#Tax1E4D3Z3Y02IRZ8A	28				0	1
3317#Tax1E4D3Z3Y02JKPD6	13				0	1
1745#Tax1E4D3Z3Y02JPIUJ	19				0	1
2594#Tax1E4D3Z3Y02I6LWB	20				0	1
3966#Tax1E4D3Z3Y02IMGAS	24				0	1
2111#Tax1E4D3Z3Y02JE3KL	22				0	1
3702#Tax1E4D3Z3Y02JJI7L	21				0	1
1897#Tax1E4D3Z3Y02G9X2G	21				0	1
2124#Tax1E4D3Z3Y02IYQXL	18				0	1
721#>Taj1E4D3Z3Y02G8O3K	16				3	0
3482#Tax1E4D3Z3Y02HCPI6	14				0	1
282#Taj1E4D3Z3Y02GC8M7	17				1	0
669#Taj1E4D3Z3Y02H4ORB	22				6	0
420#Taj1E4D3Z3Y02GPMRI	26				1	0
3622#Tax1E4D3Z3Y02JJ03L	23				0	1
989#Taj1E4D3Z3Y02FTLOW	21				1	0
1348#Tax1E4D3Z3Y02H88IR	15				0	1
2372#Tax1E4D3Z3Y02GWTN0	16				0	1
4630#Tax1E4D3Z3Y02H8QG8	13				0	1
2945#Tax1E4D3Z3Y02J4AF2	15				0	1
4673#Tax1E4D3Z3Y02J7DB2	25				0	1
1137#Taj1E4D3Z3Y02GAHBO	24				1	0
577#Taj1E4D3Z3Y02H94CQ	17				1	0
3511#Tax1E4D3Z3Y02GL4TM	14				0	1
3504#Tax1E4D3Z3Y02I5GW5	29				0	2
4843#Tax1E4D3Z3Y02HI2DJ	14				0	1
3381#Tax1E4D3Z3Y02IQ47J	17				0	1
852#Taj1E4D3Z3Y02GLV93	14				1	0
643#Taj1E4D3Z3Y02JG2WZ	22				3	0
4341#Tax1E4D3Z3Y02F6TD2	13				0	1
1120#Taj1E4D3Z3Y02IZMCC	20				1	0
1475#Tax1E4D3Z3Y02JRLBF	21				0	1
1187#Taj1E4D3Z3Y02I5DIL	23				1	0
2092#Tax1E4D3Z3Y02G7TJJ	21				0	1
2968#Tax1E4D3Z3Y02JDB54	30				0	1
1251#Tax1E4D3Z3Y02JZ18H	20				0	8
2456#Tax1E4D3Z3Y02H2GP7	23				0	1
3904#Tax1E4D3Z3Y02IL00X	28				0	1
1192#Taj1E4D3Z3Y02JIU2Y	20				1	0
879#Taj1E4D3Z3Y02F05X1	18				1	0
3899#Tax1E4D3Z3Y02HNZQ2	21				0	1
3017#Tax1E4D3Z3Y02GBQ1T	17				0	1
1095#Taj1E4D3Z3Y02HA0WZ	22				1	0
3104#Tax1E4D3Z3Y02HJ3ZT	13				0	1
3961#Tax1E4D3Z3Y02GFB24	24				0	1
2975#Tax1E4D3Z3Y02F82SH	24				0	1
1444#Tax1E4D3Z3Y02JJXN9	23				0	1
1883#Tax1E4D3Z3Y02HZ5EV	22				0	1
4691#Tax1E4D3Z3Y02H8Z5V	17				0	1
1846#Tax1E4D3Z3Y02G7FIJ	22				0	1
4832#Tax1E4D3Z3Y02G9899	23				0	1
133#Taj1E4D3Z3Y02GE2MZ	15				12	0
2515#Tax1E4D3Z3Y02H4D3H	21				0	4
2600#Tax1E4D3Z3Y02GPA3B	20				0	1
4616#Tax1E4D3Z3Y02HR2TF	18				0	1
1828#Tax1E4D3Z3Y02JDF44	21				0	1
2605#Tax1E4D3Z3Y02HJROU	23				0	1
56#Taj1E4D3Z3Y02HIGD5	25				1	0
3977#Tax1E4D3Z3Y02H30O9	24				0	1
3006#Tax1E4D3Z3Y02IYKOC	14				0	1
4282#Tax1E4D3Z3Y02GRQM8	19				0	3
306#Taj1E4D3Z3Y02GCWAL	28				1	0
70#Taj1E4D3Z3Y02ISPUK	25				1	0
4038#Tax1E4D3Z3Y02IMBNA	21				0	2
166#Taj1E4D3Z3Y02GRYFN	18				8	0
1578#Tax1E4D3Z3Y02F39RK	19				0	1
2225#Tax1E4D3Z3Y02HU9EC	14				0	1
4352#Tax1E4D3Z3Y02IJLKZ	19				0	1
30#Taj1E4D3Z3Y02F3L7C	17				1	0
466#>Taj1E4D3Z3Y02JWCQ2	23				2	0
134#Taj1E4D3Z3Y02JQI4B	28				1	0
2151#Tax1E4D3Z3Y02I3GK3	24				0	1
3038#Tax1E4D3Z3Y02JIJNS	15				0	1
618#Taj1E4D3Z3Y02IVL5T	23				1	0
3290#Tax1E4D3Z3Y02G8IJJ	16				0	1
4732#Tax1E4D3Z3Y02I0R58	20				0	1
848#Taj1E4D3Z3Y02IYYST	20				1	0
3717#Tax1E4D3Z3Y02HY2SP	30				0	1
1904#Tax1E4D3Z3Y02GDF7F	24				0	2
1761#Tax1E4D3Z3Y02IMRG9	27				0	1
2196#Tax1E4D3Z3Y02I330A	23				0	1
1323#Tax1E4D3Z3Y02GW7S0	15				0	1
1455#Tax1E4D3Z3Y02F8YL5	25				0	1
1492#Tax1E4D3Z3Y02G6DH5	19				0	1
2662#Tax1E4D3Z3Y02IM58O	17				0	1
4658#Tax1E4D3Z3Y02GSJLB	24				0	1
3560#Tax1E4D3Z3Y02IZF2F	21				0	1
1134#Taj1E4D3Z3Y02HZUD7	15				1	0
3853#Tax1E4D3Z3Y02IWB46	16				0	1
4131#Tax1E4D3Z3Y02H2FGT	25				0	1
4455#Tax1E4D3Z3Y02GOEGN	27				0	1
1100#Taj1E4D3Z3Y02G385D	14				1	0
1377#Tax1E4D3Z3Y02F1B9A	20				0	1
2861#Tax1E4D3Z3Y02JPKR7	22				0	1
4663#Tax1E4D3Z3Y02G9CD4	23				0	1
185#Taj1E4D3Z3Y02GGCH5	28				1	0
1719#Tax1E4D3Z3Y02HJZJU	16				0	3
2716#Tax1E4D3Z3Y02FPT0D	23				0	1
4#Taj1E4D3Z3Y02GNKAS	24				1	0
127#>Taj1E4D3Z3Y02F5JE9	21				2	0
71#Taj1E4D3Z3Y02I8MDV	16				2	0
1648#Tax1E4D3Z3Y02GQC52	25				0	1
1481#Tax1E4D3Z3Y02J0S8C	22				0	1
3596#Tax1E4D3Z3Y02JK0B0	20				0	1
2927#Tax1E4D3Z3Y02I88JE	24				0	1
2266#Tax1E4D3Z3Y02H5L3A	14				0	1
2915#Tax1E4D3Z3Y02FVPJ8	21				0	1
4564#Tax1E4D3Z3Y02H8GVJ	23				0	1
512#Taj1E4D3Z3Y02JTAES	24				1	0
463#Taj1E4D3Z3Y02H7FVE	19				3	0
517#Taj1E4D3Z3Y02JFUDJ	19				2	0
722#Taj1E4D3Z3Y02GMT8G	20				1	0
1363#Tax1E4D3Z3Y02HU182	21				0	1
3588#Tax1E4D3Z3Y02I4R48	13				0	1
1109#Taj1E4D3Z3Y02GWP42	13				1	0
3051#Tax1E4D3Z3Y02HXECU	23				0	1
2067#Tax1E4D3Z3Y02HSLXZ	20				0	2
1597#Tax1E4D3Z3Y02J4TBN	15				0	1
4060#Tax1E4D3Z3Y02HJWW4	15				0	1
2154#Tax1E4D3Z3Y02J2S36	21				0	1
4171#Tax1E4D3Z3Y02HSN7I	13				0	1
742#Taj1E4D3Z3Y02F23IE	16				1	0
58#Taj1E4D3Z3Y02HSIUL	23				1	0
153#Taj1E4D3Z3Y02GP6VX	21				4	0
2932#Tax1E4D3Z3Y02H90AS	22				0	1
2387#Tax1E4D3Z3Y02F8BQF	18				0	8
4086#Tax1E4D3Z3Y02F2BAS	21				0	1
101#Taj1E4D3Z3Y02GLKX1	13				1	0
340#Taj1E4D3Z3Y02F2M84	29				1	0
4362#Tax1E4D3Z3Y02HXQ78	23				0	1
3906#Tax1E4D3Z3Y02FSX2I	15				0	1
3655#Tax1E4D3Z3Y02HHOHY	14				0	1
4012#Tax1E4D3Z3Y02F3YNJ	25				0	1
2425#Tax1E4D3Z3Y02I8W1J	18				0	2
3536#Tax1E4D3Z3Y02G0KRT	20				0	1
1703#Tax1E4D3Z3Y02F56K5	25				0	1
4671#Tax1E4D3Z3Y02F6L86	15				0	1
4519#Tax1E4D3Z3Y02JBIBQ	15				0	1
4018#Tax1E4D3Z3Y02HOFWM	17				0	1
3571#Tax1E4D3Z3Y02JNYI5	14				0	1
1172#Taj1E4D3Z3Y02G7O0N	16				2	0
2510#Tax1E4D3Z3Y02IA9R1	17				0	1
2458#Tax1E4D3Z3Y02GEPJS	13				0	1
834#Taj1E4D3Z3Y02JOSY4	27				2	0
285#Taj1E4D3Z3Y02F3MJ6	23				3	0
4397#Tax1E4D3Z3Y02HY2DM	18				0	1
2441#Tax1E4D3Z3Y02JXVZB	15				0	2
2414#Tax1E4D3Z3Y02IYB0A	24				0	1
1216#Tax1E4D3Z3Y02G86M7	16				0	1
4657#Tax1E4D3Z3Y02GG6AM	15				0	1
3879#Tax1E4D3Z3Y02GS5UJ	23				0	1
4423#Tax1E4D3Z3Y02G6D73	18				0	1
2194#Tax1E4D3Z3Y02GI5C1	15				0	2
2285#Tax1E4D3Z3Y02HRCRP	15				0	1
3092#Tax1E4D3Z3Y02JX7RD	26				0	2
1135#Taj1E4D3Z3Y02ICB2O	16				1	0
4198#Tax1E4D3Z3Y02H64GW	16				0	1
2864#Tax1E4D3Z3Y02G616H	24				0	1
96#Taj1E4D3Z3Y02G4QOB	16				2	0
1667#Tax1E4D3Z3Y02F5Y2P	16				0	1
3836#Tax1E4D3Z3Y02JRBGV	16				0	1
2114#Tax1E4D3Z3Y02IEA8H	24				0	1
569#Taj1E4D3Z3Y02IZHLN	15				1	0
4269#Tax1E4D3Z3Y02IC67J	14				0	1
3111#Tax1E4D3Z3Y02F4U1U	30				0	1
1396#Tax1E4D3Z3Y02IWZ5Q	17				0	1
1760#Tax1E4D3Z3Y02HV05D	13				0	1
391#Taj1E4D3Z3Y02J3Y3N	18				1	0
2033#Tax1E4D3Z3Y02IKY56	17				0	1
4335#Tax1E4D3Z3Y02IETWG	16				0	1
2676#Tax1E4D3Z3Y02F9ZBQ	16				0	1
180#Taj1E4D3Z3Y02JN7U1	21				6	0
1375#Tax1E4D3Z3Y02IW019	20				0	1
2907#Tax1E4D3Z3Y02J0015	17				0	1
4353#Tax1E4D3Z3Y02H6KY1	18				0	1
4097#Tax1E4D3Z3Y02J1A7X	17				0	1
1877#Tax1E4D3Z3Y02HHH89	21				0	1
2939#Tax1E4D3Z3Y02FSW23	16				0	1
246#Taj1E4D3Z3Y02FZDIR	30				1	0
2227#Tax1E4D3Z3Y02F5MCC	19				0	1
4001#Tax1E4D3Z3Y02GF5Z4	13				0	1
1168#Taj1E4D3Z3Y02JPG14	23				1	0
3241#Tax1E4D3Z3Y02IV27A	18				0	1
4102#Tax1E4D3Z3Y02H46VH	27				0	1
4323#Tax1E4D3Z3Y02JDVAN	18				0	1
536#Taj1E4D3Z3Y02H6NEX	15				1	0
4661#Tax1E4D3Z3Y02HHLJJ	20				0	1
1767#Tax1E4D3Z3Y02IE3CG	13				0	1
1653#Tax1E4D3Z3Y02I8AM9	20				0	1
2237#Tax1E4D3Z3Y02HVVD2	13				0	1
1688#Tax1E4D3Z3Y02HYPPG	24				0	1
3311#Tax1E4D3Z3Y02HDZZO	16				0	3
1458#Tax1E4D3Z3Y02H547Q	16				0	1
2958#Tax1E4D3Z3Y02JQ7R0	22				0	1
444#Taj1E4D3Z3Y02H94NS	18				1	0
508#Taj1E4D3Z3Y02F42S4	21				3	0
1336#Tax1E4D3Z3Y02H7PHB	14				0	7
4025#Tax1E4D3Z3Y02J2JMV	18				0	1
3260#Tax1E4D3Z3Y02JD9BG	22				0	1
1089#>Taj1E4D3Z3Y02G3YT1	13				4	0
12#Taj1E4D3Z3Y02GTE8U	18				1	0
3036#Tax1E4D3Z3Y02GVSH8	16				0	1
1554#Tax1E4D3Z3Y02I6TAP	21				0	2
2168#Tax1E4D3Z3Y02HDTMY	16				0	1
4137#Tax1E4D3Z3Y02F8AT3	21				0	1
3518#Tax1E4D3Z3Y02JAPUE	19				0	1
3707#Tax1E4D3Z3Y02I2FOB	16				0	1
4806#Tax1E4D3Z3Y02IJBNU	18				0	1
3343#Tax1E4D3Z3Y02F6UPH	16				0	1
3413#Tax1E4D3Z3Y02G28LJ	17				0	1
4036#Tax1E4D3Z3Y02IF1KR	15				0	1
875#Taj1E4D3Z3Y02G1V57	16				1	0
1522#Tax1E4D3Z3Y02FXPIB	22				0	1
3467#Tax1E4D3Z3Y02FPTLP	25				0	1
116#Taj1E4D3Z3Y02JK2GM	25				1	0
136#Taj1E4D3Z3Y02IXQIV	18				2	0
1197#Taj1E4D3Z3Y02HQWDD	13				4	0
4390#Tax1E4D3Z3Y02HAHJE	21				0	1
1580#Tax1E4D3Z3Y02J5H1L	13				0	1
3274#Tax1E4D3Z3Y02IR6GU	14				0	2
2146#Tax1E4D3Z3Y02GSVTF	25				0	2
2419#Tax1E4D3Z3Y02G33PO	16				0	1
308#Taj1E4D3Z3Y02J2E4O	20				1	0
4604#Tax1E4D3Z3Y02H4S61	22				0	1
3485#Tax1E4D3Z3Y02GSS7U	14				0	1
3802#Tax1E4D3Z3Y02IWW1J	20				0	1
4811#Tax1E4D3Z3Y02JX5DF	15				0	1
3004#Tax1E4D3Z3Y02GWBPI	18				0	1
3676#Tax1E4D3Z3Y02HL184	15				0	1
3939#Tax1E4D3Z3Y02JJB1U	15				0	1
3027#Tax1E4D3Z3Y02IVYUL	19				0	1
301#Taj1E4D3Z3Y02HVJRT	18				1	0
4686#Tax1E4D3Z3Y02I0AKI	22				0	1
4272#Tax1E4D3Z3Y02GSTF4	19				0	1
51#Taj1E4D3Z3Y02JNCN0	18				9	0
1758#Tax1E4D3Z3Y02GZ5Z6	24				0	1
456#Taj1E4D3Z3Y02GVRWA	28				3	0
1822#Tax1E4D3Z3Y02GID17	16				0	1
3063#Tax1E4D3Z3Y02H4NC4	25				0	1
1033#Taj1E4D3Z3Y02G58K3	19				1	0
4059#Tax1E4D3Z3Y02IEUAP	21				0	1
2736#Tax1E4D3Z3Y02HBEAM	15				0	1
2258#Tax1E4D3Z3Y02I3H0B	24				0	1
1539#Tax1E4D3Z3Y02HIMNL	15				0	2
796#Taj1E4D3Z3Y02GB5IQ	18				1	0
2349#Tax1E4D3Z3Y02GMU5O	18				0	1
366#Taj1E4D3Z3Y02JJS1Q	22				2	0
4506#Tax1E4D3Z3Y02GILF3	17				0	1
1541#Tax1E4D3Z3Y02GA7DT	18				0	1
3727#Tax1E4D3Z3Y02J167N	24				0	1
3527#Tax1E4D3Z3Y02G1R6R	15				0	1
2343#Tax1E4D3Z3Y02HHYA2	26				0	1
4113#Tax1E4D3Z3Y02FWDLW	24				0	1
2108#Tax1E4D3Z3Y02G3QMI	24				0	1
3044#Tax1E4D3Z3Y02FY174	28				0	1
888#Taj1E4D3Z3Y02GNJ44	24				2	0
3771#Tax1E4D3Z3Y02JZC8Y	22				0	1
1011#Taj1E4D3Z3Y02HVVZL	16				2	0
3743#Tax1E4D3Z3Y02G0OK7	16				0	1
4515#Tax1E4D3Z3Y02GRSQI	19				0	1
1754#Tax1E4D3Z3Y02G3X6T	21				0	1
3683#Tax1E4D3Z3Y02IJYT3	20				0	1
1161#Taj1E4D3Z3Y02JFAX0	27				1	0
2093#Tax1E4D3Z3Y02I0VCJ	23				0	1
1927#Tax1E4D3Z3Y02IOQ6B	19				0	1
4779#Tax1E4D3Z3Y02I4UMN	14				0	1
1380#Tax1E4D3Z3Y02GWEZI	16				0	3
2853#Tax1E4D3Z3Y02H9IZH	15				0	1
3406#Tax1E4D3Z3Y02IYYRM	17				0	1
990#Taj1E4D3Z3Y02G6P8D	21				1	0
349#Taj1E4D3Z3Y02GNPB4	23				1	0
1442#Tax1E4D3Z3Y02IY7Z5	18				0	1
1614#Tax1E4D3Z3Y02JXMOV	24				0	1
2218#Tax1E4D3Z3Y02GB3AS	18				0	1
2316#Tax1E4D3Z3Y02JMBW2	15				0	1
4772#Tax1E4D3Z3Y02I9HQR	15				0	1
1743#Tax1E4D3Z3Y02GD1J0	21				0	1
3970#Tax1E4D3Z3Y02IMMN6	15				0	1
4770#Tax1E4D3Z3Y02IAOOR	28				0	1
3364#Tax1E4D3Z3Y02FNDJ7	24				0	1
4109#Tax1E4D3Z3Y02I1644	21				0	1
3251#Tax1E4D3Z3Y02JXO2D	20				0	1
4401#Tax1E4D3Z3Y02I4092	15				0	1
3205#Tax1E4D3Z3Y02J3R2Z	26				0	1
1383#Tax1E4D3Z3Y02I6SB5	21				0	1
137#Taj1E4D3Z3Y02HR981	22				1	0
1414#Tax1E4D3Z3Y02HRBMO	20				0	2
4504#Tax1E4D3Z3Y02I5KVY	13				0	1
666#Taj1E4D3Z3Y02IN8EV	22				13	0
3794#Tax1E4D3Z3Y02JC2HJ	14				0	1
860#Taj1E4D3Z3Y02JDK0P	25				1	0
1074#Taj1E4D3Z3Y02HZXI1	13				1	0
2308#Tax1E4D3Z3Y02JQZO2	19				0	1
3884#Tax1E4D3Z3Y02HYCJN	24				0	1
1063#Taj1E4D3Z3Y02IH6N1	24				1	0
1567#Tax1E4D3Z3Y02JYFH4	15				0	1
1776#Tax1E4D3Z3Y02H2BAH	13				0	3
2565#Tax1E4D3Z3Y02GRU8P	16				0	2
2158#Tax1E4D3Z3Y02GGDH1	24				0	1
3047#Tax1E4D3Z3Y02HHJWQ	29				0	1
2576#Tax1E4D3Z3Y02G8492	14				0	1
2362#Tax1E4D3Z3Y02JTOWD	23				0	1
3287#Tax1E4D3Z3Y02JGH1C	16				0	1
3829#Tax1E4D3Z3Y02HBWLA	24				0	1
2796#Tax1E4D3Z3Y02GJX0M	14				0	2
1601#Tax1E4D3Z3Y02JFZQW	17				0	2
323#Taj1E4D3Z3Y02H8XSW	21				40	0
1834#Tax1E4D3Z3Y02HLIFX	21				0	4
2142#Tax1E4D3Z3Y02HVM4P	18				0	2
545#Taj1E4D3Z3Y02GEV24	22				2	0
2467#Tax1E4D3Z3Y02GCOLK	23				0	1
2733#Tax1E4D3Z3Y02IAOLR	24				0	1
187#Taj1E4D3Z3Y02F9WZV	18				1	0
4625#Tax1E4D3Z3Y02ISONB	17				0	1
2326#Tax1E4D3Z3Y02HVRAW	20				0	1
1283#Tax1E4D3Z3Y02IV125	23				0	10
3089#Tax1E4D3Z3Y02IX4TT	15				0	2
212#Taj1E4D3Z3Y02F7GJA	20				3	0
3384#Tax1E4D3Z3Y02IJF2N	27				0	1
2436#Tax1E4D3Z3Y02F7A2Y	23				0	2
1331#Tax1E4D3Z3Y02GN5I7	19				0	1
4019#Tax1E4D3Z3Y02IRFTA	22				0	1
2383#Tax1E4D3Z3Y02JB6DM	21				0	2
1305#Tax1E4D3Z3Y02ICQGK	19				0	1
961#Taj1E4D3Z3Y02FXPH5	24				1	0
4539#Tax1E4D3Z3Y02J23HW	18				0	1
2686#Tax1E4D3Z3Y02GWMPA	15				0	1
1662#Tax1E4D3Z3Y02G41TV	18				0	1
2882#Tax1E4D3Z3Y02F0UYQ	24				0	1
3234#Tax1E4D3Z3Y02IACC5	18				0	1
574#Taj1E4D3Z3Y02HF5N6	22				1	0
660#Taj1E4D3Z3Y02I5C5B	24				1	0
3397#>Tax1E4D3Z3Y02GN7SA	16				0	1
977#Taj1E4D3Z3Y02I0V18	27				1	0
566#Taj1E4D3Z3Y02JHVKV	18				1	0
3928#Tax1E4D3Z3Y02GP1TD	24				0	1
4067#Tax1E4D3Z3Y02I9S9U	22				0	1
2765#Tax1E4D3Z3Y02IFJPK	13				0	2
2299#Tax1E4D3Z3Y02GOVA9	26				0	3
108#Taj1E4D3Z3Y02IRZZT	19				4	0
2820#Tax1E4D3Z3Y02JXDN9	24				0	1
604#Taj1E4D3Z3Y02G2HKP	21				10	0
477#Taj1E4D3Z3Y02HNNNK	16				1	0
1338#Tax1E4D3Z3Y02JSXI5	17				0	1
2623#Tax1E4D3Z3Y02H8U37	13				0	1
330#Taj1E4D3Z3Y02JWCRH	17				2	0
360#Taj1E4D3Z3Y02G410P	20				1	0
1857#Tax1E4D3Z3Y02JPF1R	26				0	2
3416#Tax1E4D3Z3Y02HHLMO	21				0	1
3160#Tax1E4D3Z3Y02JLHCP	18				0	1
3279#Tax1E4D3Z3Y02I6135	20				0	1
2321#Tax1E4D3Z3Y02JPSVA	18				0	1
3377#Tax1E4D3Z3Y02IQII2	20				0	1
1076#Taj1E4D3Z3Y02HECHQ	24				1	0
3082#Tax1E4D3Z3Y02JIPD5	24				0	1
766#Taj1E4D3Z3Y02J2G89	20				1	0
449#Taj1E4D3Z3Y02JV6IL	14				2	0
4595#Tax1E4D3Z3Y02I3YQ4	19				0	1
1574#Tax1E4D3Z3Y02HZMWJ	19				0	1
1579#Tax1E4D3Z3Y02F2V7V	21				0	2
3506#Tax1E4D3Z3Y02JZMRP	22				0	1
4587#Tax1E4D3Z3Y02JBSMP	15				0	1
682#Taj1E4D3Z3Y02JOOOA	18				1	0
4484#Tax1E4D3Z3Y02J4VO5	16				0	1
353#Taj1E4D3Z3Y02G1K28	20				1	0
2971#Tax1E4D3Z3Y02JUW18	14				0	1
375#Taj1E4D3Z3Y02H0MLS	26				1	0
3633#Tax1E4D3Z3Y02FVGGX	24				0	2
2989#Tax1E4D3Z3Y02FJSDE	15				0	2
2409#Tax1E4D3Z3Y02IFIWC	14				0	2
2833#Tax1E4D3Z3Y02JNDB9	29				0	1
3944#Tax1E4D3Z3Y02JJGQU	24				0	1
4189#Tax1E4D3Z3Y02H3CX7	15				0	1
3914#Tax1E4D3Z3Y02HQLU7	14				0	1
3692#Tax1E4D3Z3Y02H75QG	17				0	1
3726#Tax1E4D3Z3Y02JVKLK	14				0	1
501#Taj1E4D3Z3Y02GYSVI	24				2	0
2944#Tax1E4D3Z3Y02JP195	14				0	1
3144#Tax1E4D3Z3Y02JQFZR	24				0	1
2650#Tax1E4D3Z3Y02G8VRS	24				0	1
155#Taj1E4D3Z3Y02HSMEC	26				2	0
387#Taj1E4D3Z3Y02F2HGW	22				22	0
1913#Tax1E4D3Z3Y02JRQL4	28				0	1
626#Taj1E4D3Z3Y02IOWQ9	21				1	0
257#Taj1E4D3Z3Y02JHI5M	13				79	0
951#Taj1E4D3Z3Y02JBLIJ	22				2	0
85#Taj1E4D3Z3Y02I97OF	22				1	0
4750#Tax1E4D3Z3Y02J4WTA	30				0	1
809#Taj1E4D3Z3Y02HORPX	22				3	0
1156#Taj1E4D3Z3Y02IL6TB	15				1	0
2200#Tax1E4D3Z3Y02H6FRA	18				0	1
3057#Tax1E4D3Z3Y02G9GR4	24				0	2
3614#Tax1E4D3Z3Y02G2YJL	18				0	1
736#Taj1E4D3Z3Y02G0O7I	21				1	0
3812#Tax1E4D3Z3Y02G411O	24				0	1
539#Taj1E4D3Z3Y02HMUAP	13				20	0
2847#Tax1E4D3Z3Y02JEVRQ	16				0	1
3233#Tax1E4D3Z3Y02I351V	21				0	1
3339#Tax1E4D3Z3Y02F5I7S	26				0	1
4369#Tax1E4D3Z3Y02GVQ1X	15				0	1
520#Taj1E4D3Z3Y02I1G7A	22				1	0
1698#Tax1E4D3Z3Y02HHMOK	22				0	1
2865#Tax1E4D3Z3Y02FP9U4	14				0	1
4533#Tax1E4D3Z3Y02H6QNB	16				0	1
3820#Tax1E4D3Z3Y02HQQ8B	24				0	1
4617#Tax1E4D3Z3Y02HABOG	15				0	1
57#Taj1E4D3Z3Y02HEMRU	18				3	0
2642#Tax1E4D3Z3Y02GQEKS	14				0	1
2354#Tax1E4D3Z3Y02I3SB9	20				0	2
4714#Tax1E4D3Z3Y02GK8O3	26				0	1
3479#Tax1E4D3Z3Y02F7BH0	19				0	1
3790#Tax1E4D3Z3Y02GS7PR	24				0	1
3660#Tax1E4D3Z3Y02IHR1J	21				0	1
3435#Tax1E4D3Z3Y02H282Q	23				0	1
175#Taj1E4D3Z3Y02HC7G9	21				1	0
584#Taj1E4D3Z3Y02G9IQW	30				1	0
3307#Tax1E4D3Z3Y02GZN67	13				0	1
35#Taj1E4D3Z3Y02HM34D	23				1	0
2453#Tax1E4D3Z3Y02HVBVE	27				0	1
1882#Tax1E4D3Z3Y02H3UWM	27				0	1
1421#Tax1E4D3Z3Y02ISRWA	18				0	1
4033#Tax1E4D3Z3Y02F1U0C	18				0	1
665#Taj1E4D3Z3Y02HP02O	18				1	0
2827#Tax1E4D3Z3Y02HZSUS	21				0	1
3021#Tax1E4D3Z3Y02F5Q20	23				0	1
1476#Tax1E4D3Z3Y02HRG8K	18				0	1
2758#Tax1E4D3Z3Y02IR4G9	22				0	1
1207#Tax1E4D3Z3Y02HWBGP	22				0	1
2641#Tax1E4D3Z3Y02HJIN3	23				0	1
2670#Tax1E4D3Z3Y02GW36R	22				0	7
3007#Tax1E4D3Z3Y02GRA3Z	17				0	1
904#Taj1E4D3Z3Y02HP9YX	19				1	0
930#Taj1E4D3Z3Y02GQH13	27				2	0
3848#Tax1E4D3Z3Y02I9E48	17				0	1
2972#Tax1E4D3Z3Y02GVCFE	24				0	1
648#Taj1E4D3Z3Y02HNG4M	23				1	0
2006#Tax1E4D3Z3Y02JFIUZ	23				0	1
2245#Tax1E4D3Z3Y02GNDKP	24				0	1
3178#Tax1E4D3Z3Y02HQ3GO	16				0	2
4453#Tax1E4D3Z3Y02IQYB5	23				0	1
2130#Tax1E4D3Z3Y02HXQOV	24				0	1
1028#Taj1E4D3Z3Y02JGB0B	14				1	0
198#Taj1E4D3Z3Y02GW1MR	15				12	0
1589#Tax1E4D3Z3Y02GL1XD	27				0	1
2550#Tax1E4D3Z3Y02HXEOG	13				0	1
1059#Taj1E4D3Z3Y02FY12V	25				1	0
2683#Tax1E4D3Z3Y02GDE2F	15				0	1
3713#Tax1E4D3Z3Y02IQRYB	16				0	1
3349#Tax1E4D3Z3Y02F70FR	24				0	2
913#Taj1E4D3Z3Y02HTV0C	24				7	0
3644#Tax1E4D3Z3Y02GN0NU	14				0	1
2019#Tax1E4D3Z3Y02GDG1C	16				0	1
3983#Tax1E4D3Z3Y02ICICP	13				0	1
361#Taj1E4D3Z3Y02IDTMN	16				12	0
202#Taj1E4D3Z3Y02FQ1X9	20				3	0
4313#Tax1E4D3Z3Y02JEFB4	27				0	1
4436#Tax1E4D3Z3Y02IMJ8C	26				0	1
2468#Tax1E4D3Z3Y02HXQKB	26				0	1
3282#Tax1E4D3Z3Y02F4PFJ	16				0	1
4801#Tax1E4D3Z3Y02JUPD1	26				0	1
1819#Tax1E4D3Z3Y02GKLBV	28				0	1
2183#Tax1E4D3Z3Y02IXDX2	26				0	1
1459#Tax1E4D3Z3Y02G5NNX	21				0	2
1984#Tax1E4D3Z3Y02GNU2K	20				0	1
307#Taj1E4D3Z3Y02HHBJQ	26				1	0
3472#Tax1E4D3Z3Y02JNOLX	21				0	1
154#Taj1E4D3Z3Y02GJ7AW	29				1	0
1463#Tax1E4D3Z3Y02HMXMN	30				0	1
1467#Tax1E4D3Z3Y02GJZZB	17				0	1
2041#Tax1E4D3Z3Y02IBZGH	23				0	1
4548#Tax1E4D3Z3Y02F5ZR7	22				0	1
4324#Tax1E4D3Z3Y02I2JS6	21				0	1
704#Taj1E4D3Z3Y02JVIU1	16				1	0
2801#Tax1E4D3Z3Y02G6AY9	16				0	1
1462#Tax1E4D3Z3Y02IN10G	20				0	1
681#Taj1E4D3Z3Y02HTUGT	24				1	0
4752#Tax1E4D3Z3Y02HT2FF	25				0	1
4478#Tax1E4D3Z3Y02F29HP	13				0	1
1029#Taj1E4D3Z3Y02HB7EN	23				1	0
3062#Tax1E4D3Z3Y02HA0MG	19				0	1
5#Taj1E4D3Z3Y02HV1GN	14				2	0
2715#Tax1E4D3Z3Y02GDFJJ	14				0	1
2105#Tax1E4D3Z3Y02IWKDR	14				0	1
2694#Tax1E4D3Z3Y02I08LE	21				0	1
3292#Tax1E4D3Z3Y02F8OT0	20				0	1
3455#Tax1E4D3Z3Y02HOJBL	21				0	1
554#Taj1E4D3Z3Y02GO7KC	21				16	0
1957#Tax1E4D3Z3Y02G4FPL	14				0	1
552#Taj1E4D3Z3Y02G3LBI	21				1	0
2657#Tax1E4D3Z3Y02HJYPI	19				0	1
4006#>Tax1E4D3Z3Y02JF073	14				0	1
3766#Tax1E4D3Z3Y02H5PRZ	24				0	1
1623#Tax1E4D3Z3Y02HC9WF	21				0	1
74#Taj1E4D3Z3Y02GM9U0	13				23	0
890#Taj1E4D3Z3Y02F3HUJ	30				1	0
3699#Tax1E4D3Z3Y02HYTYN	15				0	2
1926#Tax1E4D3Z3Y02H7I23	18				0	1
299#Taj1E4D3Z3Y02ICJND	14				1	0
2024#Tax1E4D3Z3Y02J49U5	13				0	1
1282#Tax1E4D3Z3Y02IGYOB	13				0	1
1694#Tax1E4D3Z3Y02H5J6Z	24				0	1
1350#Tax1E4D3Z3Y02JC6AH	21				0	4
1240#Tax1E4D3Z3Y02HQTYP	24				0	1
3183#Tax1E4D3Z3Y02HSM6I	20				0	1
2815#Tax1E4D3Z3Y02HEZ8P	20				0	2
3079#Tax1E4D3Z3Y02JFIVL	24				0	1
481#Taj1E4D3Z3Y02IEZB8	22				1	0
867#Taj1E4D3Z3Y02I2HSO	14				1	0
3355#Tax1E4D3Z3Y02GVJXK	24				0	1
1976#Tax1E4D3Z3Y02IYR2G	23				0	1
3669#Tax1E4D3Z3Y02JKQUP	14				0	1
3442#Tax1E4D3Z3Y02IP2DA	17				0	1
817#Taj1E4D3Z3Y02JP1XY	24				1	0
2751#Tax1E4D3Z3Y02H1LTG	13				0	1
3470#Tax1E4D3Z3Y02JJUVQ	15				0	1
229#Taj1E4D3Z3Y02GJ7OZ	24				1	0
673#Taj1E4D3Z3Y02H05XJ	14				1	0
4719#Tax1E4D3Z3Y02H4P3A	21				0	1
3322#Tax1E4D3Z3Y02I6KN6	23				0	1
4204#Tax1E4D3Z3Y02JN1RW	21				0	1
2059#Tax1E4D3Z3Y02FSFBC	27				0	1
315#Taj1E4D3Z3Y02HPNK8	21				541	0
4842#Tax1E4D3Z3Y02GCABV	17				0	1
1827#Tax1E4D3Z3Y02G2NLP	17				0	4
1947#Tax1E4D3Z3Y02HU6U2	16				0	1
2366#Tax1E4D3Z3Y02IKLR4	16				0	1
2501#Tax1E4D3Z3Y02FOO31	24				0	1
1347#Tax1E4D3Z3Y02I2Z6R	21				0	4
25#Taj1E4D3Z3Y02HJHIE	22				4	0
1504#Tax1E4D3Z3Y02GTMLN	15				0	1
3350#Tax1E4D3Z3Y02IRQDG	21				0	4
3971#Tax1E4D3Z3Y02J1F2W	15				0	1
2270#Tax1E4D3Z3Y02JPNAM	25				0	1
1253#Tax1E4D3Z3Y02FVGMA	21				0	1
2648#Tax1E4D3Z3Y02H3S3R	24				0	1
3932#Tax1E4D3Z3Y02GU2V4	27				0	1
1730#Tax1E4D3Z3Y02JJ27P	20				0	1
3784#Tax1E4D3Z3Y02H7QEP	26				0	1
46#Taj1E4D3Z3Y02G4R37	14				1	0
4479#Tax1E4D3Z3Y02JDB29	13				0	3
3623#Tax1E4D3Z3Y02I6R3Y	20				0	1
1316#Tax1E4D3Z3Y02I8RXZ	18				0	1
1851#Tax1E4D3Z3Y02G47O4	15				0	1
4542#Tax1E4D3Z3Y02I4P5B	28				0	1
3327#Tax1E4D3Z3Y02I9RJV	21				0	1
2630#Tax1E4D3Z3Y02HY7SW	17				0	1
2373#Tax1E4D3Z3Y02HHKXU	13				0	1
2263#Tax1E4D3Z3Y02IS1L9	26				0	1
3386#Tax1E4D3Z3Y02HDK3U	26				0	1
4163#Tax1E4D3Z3Y02J0XZW	14				0	1
3505#Tax1E4D3Z3Y02IVGKJ	14				0	1
317#Taj1E4D3Z3Y02FXATJ	22				1	0
1254#Tax1E4D3Z3Y02HKVCY	21				0	1
4555#Tax1E4D3Z3Y02H9WVS	27				0	1
1642#Tax1E4D3Z3Y02F90C9	21				0	1
3712#Tax1E4D3Z3Y02JBUHS	17				0	1
892#Taj1E4D3Z3Y02IQ1GZ	29				1	0
4622#Tax1E4D3Z3Y02JCMKG	29				0	1
3954#Tax1E4D3Z3Y02HGH17	29				0	1
546#Taj1E4D3Z3Y02G7LHJ	21				2	0
2071#Tax1E4D3Z3Y02HXVGI	15				0	1
537#Taj1E4D3Z3Y02HEXEW	16				1	0
1007#Taj1E4D3Z3Y02IASI3	13				1	0
3896#Tax1E4D3Z3Y02GUM81	24				0	1
4072#Tax1E4D3Z3Y02IC1M8	18				0	1
1443#Tax1E4D3Z3Y02G5M30	14				0	7
4441#Tax1E4D3Z3Y02J2AJM	22				0	1
1833#Tax1E4D3Z3Y02G64SZ	14				0	1
3298#Tax1E4D3Z3Y02I6U6N	24				0	1
1186#Taj1E4D3Z3Y02FP3O8	24				2	0
3119#Tax1E4D3Z3Y02H0S43	23				0	3
2240#Tax1E4D3Z3Y02JSS3C	16				0	2
3566#Tax1E4D3Z3Y02GASJI	24				0	1
529#Taj1E4D3Z3Y02HQSRV	24				1	0
3556#Tax1E4D3Z3Y02ITXGO	18				0	1
4309#Tax1E4D3Z3Y02JYIBS	14				0	1
4222#Tax1E4D3Z3Y02I5B8K	14				0	1
2573#Tax1E4D3Z3Y02F11DF	13				0	1
987#Taj1E4D3Z3Y02JX8TE	16				1	0
2984#Tax1E4D3Z3Y02JQPFT	20				0	1
1150#Taj1E4D3Z3Y02IE9MI	15				3	0
3988#Tax1E4D3Z3Y02IC7NK	27				0	1
4122#Tax1E4D3Z3Y02HAPPV	19				0	1
4347#Tax1E4D3Z3Y02JKIFH	24				0	1
4314#Tax1E4D3Z3Y02J0ENU	19				0	1
4239#Tax1E4D3Z3Y02JHDKH	18				0	1
2390#Tax1E4D3Z3Y02FQFI3	14				0	1
908#Taj1E4D3Z3Y02F7S8R	30				1	0
2580#Tax1E4D3Z3Y02GX60F	24				0	1
284#Taj1E4D3Z3Y02HAS68	15				1	0
4151#Tax1E4D3Z3Y02FZQZ8	22				0	1
3127#Tax1E4D3Z3Y02GCQ8J	15				0	1
247#Taj1E4D3Z3Y02G3P7D	13				144	0
903#Taj1E4D3Z3Y02GBIBR	16				1	0
1340#Tax1E4D3Z3Y02IHX86	24				0	1
3870#Tax1E4D3Z3Y02GEHZB	23				0	1
4389#Tax1E4D3Z3Y02IUZ6G	14				0	1
3927#Tax1E4D3Z3Y02JD2EK	14				0	1
289#Taj1E4D3Z3Y02J1YKO	19				2	0
4739#Tax1E4D3Z3Y02H4H57	21				0	1
4411#Tax1E4D3Z3Y02JF5WN	19				0	1
2119#Tax1E4D3Z3Y02JZ3J8	24				0	1
3891#Tax1E4D3Z3Y02IGW31	22				0	1
808#Taj1E4D3Z3Y02I9O69	24				1	0
845#Taj1E4D3Z3Y02GL7EU	30				1	0
1847#Tax1E4D3Z3Y02GZJZP	19				0	1
147#Taj1E4D3Z3Y02HRG84	24				1	0
1249#Tax1E4D3Z3Y02HSXYY	24				0	1
1142#Taj1E4D3Z3Y02HVFWX	16				1	0
4708#Tax1E4D3Z3Y02GX4T9	20				0	1
1291#Tax1E4D3Z3Y02HJYP7	22				0	1
2095#Tax1E4D3Z3Y02HURGP	30				0	1
2599#Tax1E4D3Z3Y02IBSZT	27				0	1
2601#Tax1E4D3Z3Y02FVMNO	26				0	1
3227#Tax1E4D3Z3Y02H67EM	14				0	1
2960#Tax1E4D3Z3Y02FNMUC	21				0	1
1052#Taj1E4D3Z3Y02H1F3T	16				1	0
4522#Tax1E4D3Z3Y02JNZ3T	19				0	1
4188#Tax1E4D3Z3Y02G3I8B	24				0	1
4250#Tax1E4D3Z3Y02H91EQ	15				0	1
1493#Tax1E4D3Z3Y02J03VC	20				0	2
2397#Tax1E4D3Z3Y02HURVE	21				0	1
974#Taj1E4D3Z3Y02IGWEA	24				1	0
4298#Tax1E4D3Z3Y02H3ATG	13				0	1
2629#Tax1E4D3Z3Y02HNA56	14				0	1
1668#Tax1E4D3Z3Y02ITM83	23				0	1
1715#Tax1E4D3Z3Y02HYPD5	30				0	1
1613#Tax1E4D3Z3Y02JCG95	23				0	1
4247#Tax1E4D3Z3Y02GW979	16				0	1
636#Taj1E4D3Z3Y02F5Q1Y	13				3	0
1104#Taj1E4D3Z3Y02J5MQT	15				1	0
1406#Tax1E4D3Z3Y02IHY65	14				0	1
1905#Tax1E4D3Z3Y02JB0PS	16				0	11
3203#Tax1E4D3Z3Y02G0WXG	17				0	1
117#Taj1E4D3Z3Y02H4THP	16				3	0
2207#Tax1E4D3Z3Y02GB4FW	27				0	1
3754#Tax1E4D3Z3Y02H3OIU	23				0	1
2472#Tax1E4D3Z3Y02IDZFK	15				0	1
821#Taj1E4D3Z3Y02HACQ1	24				1	0
696#Taj1E4D3Z3Y02HIZ0J	24				1	0
4586#Tax1E4D3Z3Y02JCGQ9	29				0	1
1721#Tax1E4D3Z3Y02I5DC4	24				0	1
3376#Tax1E4D3Z3Y02G1B0I	21				0	1
2179#Tax1E4D3Z3Y02JTIOM	20				0	2
2172#Tax1E4D3Z3Y02HFV73	14				0	1
1431#Tax1E4D3Z3Y02HYRBQ	24				0	1
1489#Tax1E4D3Z3Y02JI2PV	17				0	1
3050#Tax1E4D3Z3Y02IYLV3	17				0	1
4565#Tax1E4D3Z3Y02HB4B2	14				0	1
1805#Tax1E4D3Z3Y02IE04X	23				0	1
3226#Tax1E4D3Z3Y02G6RAI	28				0	1
1727#Tax1E4D3Z3Y02I13SU	22				0	1
2922#Tax1E4D3Z3Y02F3FV3	27				0	1
2178#Tax1E4D3Z3Y02G02YM	21				0	1
1225#Tax1E4D3Z3Y02GY4D3	13				0	1
290#Taj1E4D3Z3Y02HAFPZ	22				1	0
2909#Tax1E4D3Z3Y02IUWRS	15				0	2
210#Taj1E4D3Z3Y02HDKNU	19				2	0
712#Taj1E4D3Z3Y02HETK6	21				1	0
2560#Tax1E4D3Z3Y02G9UFB	24				0	1
3365#Tax1E4D3Z3Y02JGV7L	26				0	1
2702#Tax1E4D3Z3Y02JKT9A	15				0	1
4529#Tax1E4D3Z3Y02JTIQ3	13				0	1
2593#Tax1E4D3Z3Y02J23VJ	14				0	2
3196#Tax1E4D3Z3Y02HJUZG	25				0	1
1895#Tax1E4D3Z3Y02H1NIM	23				0	1
2920#Tax1E4D3Z3Y02HW6UI	14				0	1
2038#Tax1E4D3Z3Y02IR2PH	21				0	1
4465#Tax1E4D3Z3Y02HJ4PM	17				0	1
4283#Tax1E4D3Z3Y02HYPIP	21				0	1
3799#Tax1E4D3Z3Y02H67N3	13				0	1
1159#Taj1E4D3Z3Y02GM9L5	13				4	0
4399#Tax1E4D3Z3Y02GEJ3X	22				0	1
2048#Tax1E4D3Z3Y02HSJ31	16				0	1
655#Taj1E4D3Z3Y02FVJWQ	24				1	0
4512#Tax1E4D3Z3Y02HD4H3	13				0	1
3110#Tax1E4D3Z3Y02JDHL6	19				0	1
421#Taj1E4D3Z3Y02GZG6C	14				2	0
2332#Tax1E4D3Z3Y02IV88T	23				0	1
4644#Tax1E4D3Z3Y02IGWIA	27				0	1
271#Taj1E4D3Z3Y02IEEXF	19				1	0
3742#Tax1E4D3Z3Y02GMJEW	21				0	1
1024#Taj1E4D3Z3Y02II89L	21				1	0
4822#Tax1E4D3Z3Y02IJXTW	23				0	1
3174#Tax1E4D3Z3Y02HHP6P	24				0	2
2867#Tax1E4D3Z3Y02G4W5X	18				0	2
491#Taj1E4D3Z3Y02IZX7V	15				1	0
2871#Tax1E4D3Z3Y02I0IA9	21				0	1
1863#Tax1E4D3Z3Y02I2FBY	25				0	1
13#Taj1E4D3Z3Y02G4K05	15				1	0
4495#Tax1E4D3Z3Y02I3I6H	15				0	1
3953#Tax1E4D3Z3Y02GMIWV	16				0	1
4672#Tax1E4D3Z3Y02HHHSC	15				0	1
1514#Tax1E4D3Z3Y02GVC5C	20				0	2
4098#Tax1E4D3Z3Y02HW1RB	18				0	1
840#Taj1E4D3Z3Y02HR2U1	14				1	0
1647#Tax1E4D3Z3Y02G7I3C	24				0	2
597#Taj1E4D3Z3Y02J26YN	25				1	0
4693#Tax1E4D3Z3Y02H0FIB	15				0	1
4541#Tax1E4D3Z3Y02HILNR	20				0	1
4372#Tax1E4D3Z3Y02IG86Y	22				0	1
1411#Tax1E4D3Z3Y02F0S1T	18				0	3
1480#Tax1E4D3Z3Y02IGS12	13				0	1
4793#Tax1E4D3Z3Y02H7T2U	13				0	1
3265#Tax1E4D3Z3Y02HYQ7D	20				0	1
3581#Tax1E4D3Z3Y02I3AGN	13				0	1
242#Taj1E4D3Z3Y02F63QJ	25				4	0
32#Taj1E4D3Z3Y02G20PR	17				1	0
1588#Tax1E4D3Z3Y02FVJK7	25				0	2
443#Taj1E4D3Z3Y02IVBAJ	13				1	0
4138#Tax1E4D3Z3Y02HSSDG	18				0	1
2234#Tax1E4D3Z3Y02JIZVY	22				0	1
1795#Tax1E4D3Z3Y02HA17Z	13				0	1
4391#Tax1E4D3Z3Y02GT85Z	23				0	1
3519#Tax1E4D3Z3Y02IHYHX	22				0	1
3273#Tax1E4D3Z3Y02JR4PU	23				0	1
846#Taj1E4D3Z3Y02HU0XN	14				1	0
1689#Tax1E4D3Z3Y02JCFB7	30				0	1
1861#Tax1E4D3Z3Y02GPN89	28				0	2
3484#Tax1E4D3Z3Y02I1NYU	22				0	2
2825#Tax1E4D3Z3Y02IL1X5	22				0	1
1296#Tax1E4D3Z3Y02IBC8E	21				0	1
3312#Tax1E4D3Z3Y02H8C6S	15				0	2
1553#Tax1E4D3Z3Y02HQKKF	21				0	1
3415#Tax1E4D3Z3Y02FVQ05	16				0	1
2161#Tax1E4D3Z3Y02F9SQX	23				0	1
2897#Tax1E4D3Z3Y02G3FEU	24				0	1
4051#Tax1E4D3Z3Y02GA5FB	28				0	1
1303#Tax1E4D3Z3Y02GGDZF	20				0	1
4195#Tax1E4D3Z3Y02HZZM7	15				0	1
4738#Tax1E4D3Z3Y02IVRGJ	18				0	1
1654#Tax1E4D3Z3Y02JY5VL	25				0	1
3494#Tax1E4D3Z3Y02HMM12	14				0	1
3510#Tax1E4D3Z3Y02JM819	21				0	1
4638#Tax1E4D3Z3Y02H92WG	24				0	1
15#Taj1E4D3Z3Y02IF2C0	28				1	0
3268#Tax1E4D3Z3Y02F8PXA	24				0	2
4624#Tax1E4D3Z3Y02HUJQ7	19				0	1
3016#Tax1E4D3Z3Y02JECEQ	14				0	1
2236#Tax1E4D3Z3Y02GKOUF	21				0	1
1506#Tax1E4D3Z3Y02F0UJQ	24				0	1
4026#Tax1E4D3Z3Y02GDDH8	21				0	1
2855#Tax1E4D3Z3Y02G7D78	21				0	1
4810#Tax1E4D3Z3Y02JGXDT	18				0	1
2145#Tax1E4D3Z3Y02ITSFT	15				0	3
859#Taj1E4D3Z3Y02GJHUH	24				1	0
3693#Tax1E4D3Z3Y02JME13	14				0	1
739#Taj1E4D3Z3Y02H5B5Y	25				9	0
4284#Tax1E4D3Z3Y02I2UVN	30				0	1
4507#Tax1E4D3Z3Y02GBWNM	26				0	1
876#Taj1E4D3Z3Y02GR22T	17				2	0
2890#Tax1E4D3Z3Y02I391D	27				0	1
3967#Tax1E4D3Z3Y02IDHC1	22				0	1
135#Taj1E4D3Z3Y02GN4WZ	23				1	0
4751#Tax1E4D3Z3Y02H5V4W	16				0	1
3344#Tax1E4D3Z3Y02I3168	18				0	1
3913#Tax1E4D3Z3Y02GSQBY	19				0	1
4687#Tax1E4D3Z3Y02HRR6V	19				0	1
145#Taj1E4D3Z3Y02HSM63	18				1	0
2674#Tax1E4D3Z3Y02FUDXI	15				0	1
1131#Taj1E4D3Z3Y02GODEM	16				1	0
3624#Tax1E4D3Z3Y02G4EGW	29				0	1
772#Taj1E4D3Z3Y02IMKGA	13				2	0
1876#Tax1E4D3Z3Y02IKDP0	24				0	1
3803#Tax1E4D3Z3Y02JCP9E	18				0	1
1759#Tax1E4D3Z3Y02ICHQ0	26				0	1
4514#Tax1E4D3Z3Y02GTJ37	15				0	1
4651#Tax1E4D3Z3Y02JUBLT	23				0	1
4605#Tax1E4D3Z3Y02HZF1T	13				0	1
2032#Tax1E4D3Z3Y02IWOZE	24				0	1
3026#Tax1E4D3Z3Y02GWK9H	18				0	1
1528#Tax1E4D3Z3Y02G5PDU	23				0	1
653#Taj1E4D3Z3Y02GQFJG	24				1	0
1692#Tax1E4D3Z3Y02IH3A4	24				0	1
2677#Tax1E4D3Z3Y02IML8L	25				0	1
4273#Tax1E4D3Z3Y02JFG4W	14				0	1
3064#Tax1E4D3Z3Y02HU9N6	15				0	1
509#Taj1E4D3Z3Y02F36D6	27				1	0
3708#Tax1E4D3Z3Y02GILQH	24				0	1
1015#Taj1E4D3Z3Y02I8XVP	14				1	0
367#Taj1E4D3Z3Y02J5INJ	23				1	0
976#Taj1E4D3Z3Y02HJQOG	15				3	0
1821#Tax1E4D3Z3Y02H08LJ	21				0	1
743#Taj1E4D3Z3Y02HK63U	24				1	0
3589#Tax1E4D3Z3Y02I5GEU	14				0	1
2265#Tax1E4D3Z3Y02H2T80	24				0	1
2129#Tax1E4D3Z3Y02HXNHN	13				0	1
723#Taj1E4D3Z3Y02GABHJ	29				1	0
3597#Tax1E4D3Z3Y02HI47M	16				0	1
1040#Taj1E4D3Z3Y02JHYN5	22				2	0
1755#Tax1E4D3Z3Y02FTBZ4	18				0	1
1138#Taj1E4D3Z3Y02F9N7Y	15				1	0
488#Taj1E4D3Z3Y02F9BJF	15				1	0
1012#Taj1E4D3Z3Y02F5OGR	14				1	0
2182#Tax1E4D3Z3Y02HTJLV	18				0	1
1032#Taj1E4D3Z3Y02HYDGY	23				1	0
4071#Tax1E4D3Z3Y02GH3SF	13				0	1
152#Taj1E4D3Z3Y02HOH3C	26				1	0
342#Taj1E4D3Z3Y02G1BXG	13				2	0
2931#Tax1E4D3Z3Y02IIZRY	15				0	1
3855#Tax1E4D3Z3Y02JXVWO	16				0	1
862#Taj1E4D3Z3Y02J1VGQ	26				1	0
1419#Tax1E4D3Z3Y02IXS5C	16				0	1
341#Taj1E4D3Z3Y02F4XI1	13				11	0
3586#Tax1E4D3Z3Y02HUEXU	24				0	1
2189#Tax1E4D3Z3Y02GZJRZ	18				0	1
2883#Tax1E4D3Z3Y02GLM21	14				0	1
2287#Tax1E4D3Z3Y02JMBGB	24				0	1
2540#Tax1E4D3Z3Y02HO27Y	24				0	1
2284#Tax1E4D3Z3Y02I366F	20				0	1
3793#Tax1E4D3Z3Y02JHH5Y	20				0	1
64#Taj1E4D3Z3Y02JYO3S	14				5	0
4085#Tax1E4D3Z3Y02HA1XU	15				0	1
45#Taj1E4D3Z3Y02ISSW9	27				1	0
4426#Tax1E4D3Z3Y02HKXB7	14				0	2
4172#Tax1E4D3Z3Y02JGEE6	13				0	1
1173#Taj1E4D3Z3Y02HI9HE	24				1	0
4824#Tax1E4D3Z3Y02HSGP0	21				0	1
309#Taj1E4D3Z3Y02F4AIN	24				1	0
4656#Tax1E4D3Z3Y02GCQE8	21				0	1
1963#Tax1E4D3Z3Y02I5OW0	24				0	1
2085#Tax1E4D3Z3Y02JJ92J	30				0	1
1733#Tax1E4D3Z3Y02JF7ZT	15				0	1
2113#Tax1E4D3Z3Y02HLZAP	17				0	1
2153#Tax1E4D3Z3Y02HWMZS	24				0	1
3383#Tax1E4D3Z3Y02GVLUY	16				0	2
824#Taj1E4D3Z3Y02IR9Q0	13				1	0
120#Taj1E4D3Z3Y02G0JK8	22				1	0
2568#Tax1E4D3Z3Y02IL34X	17				0	1
1148#Taj1E4D3Z3Y02IAI5K	24				1	0
4747#Tax1E4D3Z3Y02I5W5F	13				0	1
254#Taj1E4D3Z3Y02GLF5N	23				1	0
2386#Tax1E4D3Z3Y02ISRFU	14				0	1
2841#Tax1E4D3Z3Y02IL521	21				0	1
1321#Tax1E4D3Z3Y02HWO7O	16				0	1
4670#Tax1E4D3Z3Y02JK8L7	18				0	1
4214#Tax1E4D3Z3Y02GNQR9	29				0	1
2442#Tax1E4D3Z3Y02JFIMY	16				0	1
3945#Tax1E4D3Z3Y02JLX27	21				0	1
1987#Tax1E4D3Z3Y02H7KGB	24				0	2
2602#Tax1E4D3Z3Y02GVPCY	24				0	1
3570#Tax1E4D3Z3Y02JSPL3	28				0	1
851#Taj1E4D3Z3Y02HC8YM	19				1	0
399#Taj1E4D3Z3Y02G7JZU	26				1	0
2296#>Tax1E4D3Z3Y02JKDWF	16				0	1
1811#Tax1E4D3Z3Y02G0KV5	13				0	1
436#Taj1E4D3Z3Y02FNP8M	23				1	0
4412#Tax1E4D3Z3Y02FSA1U	20				0	1
94#Taj1E4D3Z3Y02H3U54	15				1	0
213#Taj1E4D3Z3Y02H2PGP	15				1	0
4818#Tax1E4D3Z3Y02H9G1A	13				0	1
1450#Tax1E4D3Z3Y02IO8K9	15				0	2
3011#Tax1E4D3Z3Y02I2SZ3	13				0	1
568#Taj1E4D3Z3Y02IICG7	24				1	0
2668#Tax1E4D3Z3Y02FW8RH	21				0	1
2863#Tax1E4D3Z3Y02J11SU	18				0	1
3098#Tax1E4D3Z3Y02HTSLB	16				0	1
3250#Tax1E4D3Z3Y02F75BW	18				0	1
2411#Tax1E4D3Z3Y02H9RVY	26				0	1
3905#Tax1E4D3Z3Y02ISIZQ	24				0	1
1129#Taj1E4D3Z3Y02JSG96	25				1	0
4334#Tax1E4D3Z3Y02IYHQ8	16				0	1
1143#Taj1E4D3Z3Y02G3FAD	15				1	0
2848#Tax1E4D3Z3Y02JWTYP	15				0	1
386#Taj1E4D3Z3Y02G6CH7	24				2	0
1961#Tax1E4D3Z3Y02H5EGE	18				0	1
1457#Tax1E4D3Z3Y02JHVI2	13				0	3
200#Taj1E4D3Z3Y02JWPAV	24				1	0
1261#Tax1E4D3Z3Y02GSIOO	14				0	1
1352#Tax1E4D3Z3Y02JTKGW	16				0	1
4467#Tax1E4D3Z3Y02JTN5J	28				0	1
1621#Tax1E4D3Z3Y02JNUIE	14				0	1
2970#Tax1E4D3Z3Y02FQL7H	23				0	1
161#Taj1E4D3Z3Y02GKV0B	23				2	0
109#Taj1E4D3Z3Y02JDHTH	14				1	0
4464#Tax1E4D3Z3Y02F5668	21				0	1
2318#Tax1E4D3Z3Y02JCFPP	26				0	1
2651#Tax1E4D3Z3Y02H1IWS	21				0	1
2764#Tax1E4D3Z3Y02GLS0C	21				0	1
4526#Tax1E4D3Z3Y02JTA3V	25				0	1
2797#Tax1E4D3Z3Y02HEBKG	24				0	1
1556#Tax1E4D3Z3Y02F62F9	24				0	1
4800#Tax1E4D3Z3Y02HW0IW	13				0	1
3682#Tax1E4D3Z3Y02IRTV7	20				0	1
4593#Tax1E4D3Z3Y02JFO05	21				0	1
1766#Tax1E4D3Z3Y02I2DXZ	19				0	1
3378#Tax1E4D3Z3Y02J122F	14				0	1
4034#Tax1E4D3Z3Y02IS16Y	18				0	1
3982#Tax1E4D3Z3Y02HVYH9	19				0	1
4454#Tax1E4D3Z3Y02GN7R1	14				0	2
4787#Tax1E4D3Z3Y02IIC2D	21				0	1
3153#Tax1E4D3Z3Y02G5SBN	28				0	1
911#Taj1E4D3Z3Y02JSALT	16				1	0
2072#Tax1E4D3Z3Y02II5NO	13				0	1
3121#Tax1E4D3Z3Y02GXO4D	24				0	1
3507#Tax1E4D3Z3Y02F9OLY	19				0	1
3427#Tax1E4D3Z3Y02IZS7S	19				0	1
2624#Tax1E4D3Z3Y02IZK3R	19				0	1
4079#Tax1E4D3Z3Y02HZBEF	17				0	1
2965#Tax1E4D3Z3Y02INOEY	24				0	1
1157#Taj1E4D3Z3Y02IL65A	21				1	0
1470#Tax1E4D3Z3Y02G8PXH	21				0	1
4835#Tax1E4D3Z3Y02JFICQ	22				0	1
2100#Tax1E4D3Z3Y02I0TOS	24				0	1
1006#Taj1E4D3Z3Y02IZ2YT	13				1	0
3813#Tax1E4D3Z3Y02HP9WE	20				0	1
996#Taj1E4D3Z3Y02I2CX6	18				2	0
4531#Tax1E4D3Z3Y02GGWM1	17				0	1
3005#Tax1E4D3Z3Y02F6G0J	22				0	1
4596#Tax1E4D3Z3Y02JRKIQ	20				0	1
1840#Tax1E4D3Z3Y02I9F35	13				0	1
3656#Tax1E4D3Z3Y02IIWW6	18				0	1
2069#Tax1E4D3Z3Y02JFF08	15				0	1
956#Taj1E4D3Z3Y02H3636	16				1	0
3933#Tax1E4D3Z3Y02FEYB3	17				0	1
629#Taj1E4D3Z3Y02G3MSB	29				1	0
372#Taj1E4D3Z3Y02GLW5H	21				1	0
4525#Tax1E4D3Z3Y02JBBOD	16				0	1
2951#Tax1E4D3Z3Y02IVBT5	24				0	1
3204#Tax1E4D3Z3Y02H49VB	24				0	1
4771#Tax1E4D3Z3Y02IOUCI	13				0	1
1284#Tax1E4D3Z3Y02GPW6S	13				0	2
1330#Tax1E4D3Z3Y02F9EKQ	17				0	1
1661#Tax1E4D3Z3Y02GUQN2	15				0	1
3041#Tax1E4D3Z3Y02GWYYJ	26				0	1
3526#Tax1E4D3Z3Y02IUH62	13				0	2
3772#Tax1E4D3Z3Y02JYOPC	21				0	1
1160#Taj1E4D3Z3Y02IPS2F	19				2	0
869#Taj1E4D3Z3Y02GLPS0	16				1	0
1592#Tax1E4D3Z3Y02JDK13	13				0	1
4114#Tax1E4D3Z3Y02J4SKB	20				0	1
2997#Tax1E4D3Z3Y02HMBH8	15				0	1
1697#Tax1E4D3Z3Y02GZ6CO	18				0	1
3828#Tax1E4D3Z3Y02GAVPG	28				0	1
1770#Tax1E4D3Z3Y02JTCTZ	18				0	1
4494#Tax1E4D3Z3Y02JN8FI	15				0	1
2735#Tax1E4D3Z3Y02J0P0F	24				0	1
1209#Tax1E4D3Z3Y02H65AR	14				0	1
991#Taj1E4D3Z3Y02JWENB	29				1	0
4773#Tax1E4D3Z3Y02G6B1Y	16				0	2
3535#Tax1E4D3Z3Y02F4R2N	16				0	1
931#Taj1E4D3Z3Y02HJ63W	16				1	0
2348#Tax1E4D3Z3Y02J4QQ2	25				0	1
615#Taj1E4D3Z3Y02HJGT5	22				1	0
2246#Tax1E4D3Z3Y02F8D38	15				0	1
476#Taj1E4D3Z3Y02GBK8K	15				6	0
1198#Taj1E4D3Z3Y02HJ0X8	24				1	0
4505#Tax1E4D3Z3Y02IE2WI	22				0	1
3319#Tax1E4D3Z3Y02G05TO	17				0	1
3755#Tax1E4D3Z3Y02IHPYK	23				0	1
1626#Tax1E4D3Z3Y02HMZQ6	20				0	1
2219#Tax1E4D3Z3Y02GNMH9	17				0	1
2141#Tax1E4D3Z3Y02JP8AB	24				0	1
1077#Taj1E4D3Z3Y02HDQBY	20				1	0
2464#Tax1E4D3Z3Y02G8CXU	22				0	1
2854#Tax1E4D3Z3Y02J5I80	17				0	1
1299#Tax1E4D3Z3Y02JHAK7	18				0	1
1781#Tax1E4D3Z3Y02JC2LI	14				0	1
967#Taj1E4D3Z3Y02GHCB1	20				1	0
1611#Tax1E4D3Z3Y02GBE7H	13				0	1
2157#Tax1E4D3Z3Y02J1HMN	17				0	1
322#Taj1E4D3Z3Y02HASG9	20				3	0
3046#Tax1E4D3Z3Y02HOB14	17				0	1
575#Taj1E4D3Z3Y02F872I	24				1	0
1835#Tax1E4D3Z3Y02J5TGI	17				0	2
4101#Tax1E4D3Z3Y02IMRG3	16				0	1
3850#Tax1E4D3Z3Y02HZTQA	21				0	1
699#Taj1E4D3Z3Y02G1RYU	21				9	0
960#Taj1E4D3Z3Y02IMZFH	22				1	0
818#Taj1E4D3Z3Y02HXHWR	21				1	0
1038#Taj1E4D3Z3Y02IPS3T	21				2	0
2363#Tax1E4D3Z3Y02GFVRY	19				0	1
2908#Tax1E4D3Z3Y02GTI77	24				0	2
3088#Tax1E4D3Z3Y02IQEW3	23				0	1
1777#Tax1E4D3Z3Y02HIO5X	14				0	1
354#Taj1E4D3Z3Y02H38JJ	13				1	0
4483#Tax1E4D3Z3Y02GRZD2	17				0	1
3878#Tax1E4D3Z3Y02JADCT	24				0	1
1064#Taj1E4D3Z3Y02F1QYX	15				1	0
4758#Tax1E4D3Z3Y02JBCVP	23				0	1
4225#Tax1E4D3Z3Y02I3JCC	16				0	1
2734#Tax1E4D3Z3Y02HT7W1	22				0	1
1217#Tax1E4D3Z3Y02GC98F	18				0	1
3240#Tax1E4D3Z3Y02IZ1FN	28				0	1
3288#Tax1E4D3Z3Y02HUF2D	27				0	3
2750#Tax1E4D3Z3Y02H8SRM	24				0	1
4165#Tax1E4D3Z3Y02FRRWE	29				0	1
2527#Tax1E4D3Z3Y02H1F1W	15				0	1
1850#Tax1E4D3Z3Y02HCFOS	24				0	1
1346#Tax1E4D3Z3Y02JSOMF	23				0	1
1964#Tax1E4D3Z3Y02JP8NS	15				0	1
3396#Tax1E4D3Z3Y02HE3W5	14				0	2
4768#Tax1E4D3Z3Y02G6QTN	16				0	1
2818#Tax1E4D3Z3Y02GKKAX	22				0	1
2424#Tax1E4D3Z3Y02INU44	26				0	1
891#Taj1E4D3Z3Y02FS8TS	24				1	0
1004#Taj1E4D3Z3Y02HQ9LJ	13				1	0
3471#Tax1E4D3Z3Y02JDS4S	22				0	1
2106#Tax1E4D3Z3Y02JQ05Z	21				0	1
1013#Taj1E4D3Z3Y02G3B6Z	22				1	0
1693#Tax1E4D3Z3Y02G7U8U	16				0	1
316#Taj1E4D3Z3Y02GY28Y	18				1	0
4549#Tax1E4D3Z3Y02IUJND	14				0	1
1806#Tax1E4D3Z3Y02I67XB	22				0	4
4013#Tax1E4D3Z3Y02JJE7C	15				0	1
1738#Tax1E4D3Z3Y02JWR2Y	19				0	1
2025#Tax1E4D3Z3Y02JN65D	21				0	1
1370#Tax1E4D3Z3Y02HI07S	18				0	1
4251#>Tax1E4D3Z3Y02JC0Z5	17				0	1
3920#Tax1E4D3Z3Y02IDF4V	20				0	1
4809#Tax1E4D3Z3Y02FW9NH	29				0	1
2649#Tax1E4D3Z3Y02F7QC5	14				0	1
3668#Tax1E4D3Z3Y02HXG8S	14				0	1
3804#Tax1E4D3Z3Y02JDL35	27				0	1
511#Taj1E4D3Z3Y02JVWFH	20				10	0
2367#Tax1E4D3Z3Y02JKI9C	21				0	2
899#Taj1E4D3Z3Y02JOWZK	24				1	0
3259#Tax1E4D3Z3Y02GT5CP	15				0	2
3443#Tax1E4D3Z3Y02IUEH4	26				0	1
2437#Tax1E4D3Z3Y02I375J	13				0	4
3573#Tax1E4D3Z3Y02GS6JH	20				0	1
2689#Tax1E4D3Z3Y02G9NTT	16				0	3
3131#Tax1E4D3Z3Y02H8NFA	24				0	1
3765#Tax1E4D3Z3Y02HUZW0	16				0	1
4254#Tax1E4D3Z3Y02JFH6R	15				0	1
1979#Tax1E4D3Z3Y02IJCHW	24				0	1
3066#Tax1E4D3Z3Y02GO4X2	24				0	1
2485#Tax1E4D3Z3Y02J0UOM	26				0	1
1948#Tax1E4D3Z3Y02JXEYN	22				0	1
795#Taj1E4D3Z3Y02I9BXM	26				1	0
4402#Tax1E4D3Z3Y02JJTPI	24				0	1
794#Taj1E4D3Z3Y02J3S2S	30				1	0
1609#Tax1E4D3Z3Y02GCKYF	21				0	1
944#Taj1E4D3Z3Y02H3ZJ0	22				7	0
1780#Tax1E4D3Z3Y02HQ4HU	15				0	1
1113#Taj1E4D3Z3Y02FJU5P	21				5	0
674#Taj1E4D3Z3Y02G9MHB	20				3	0
3405#Tax1E4D3Z3Y02JG58J	13				0	1
4470#Tax1E4D3Z3Y02JVDFX	27				0	1
1317#Tax1E4D3Z3Y02GP5SR	19				0	1
957#Taj1E4D3Z3Y02JUJAE	23				2	0
2430#Tax1E4D3Z3Y02FXW1V	13				0	1
2596#Tax1E4D3Z3Y02JOX2Q	20				0	1
2943#Tax1E4D3Z3Y02IMQM5	17				0	1
3996#Tax1E4D3Z3Y02GFVI5	22				0	1
1503#Tax1E4D3Z3Y02F1LW7	23				0	1
4543#Tax1E4D3Z3Y02HAIKO	22				0	1
2512#Tax1E4D3Z3Y02HYT5Q	22				0	1
502#Taj1E4D3Z3Y02IKO1G	17				3	0
314#Taj1E4D3Z3Y02IH2Y4	17				1	0
1286#Tax1E4D3Z3Y02HIJFM	17				0	2
1796#Tax1E4D3Z3Y02I184K	24				0	1
4744#Tax1E4D3Z3Y02GDT0Z	16				0	1
3385#Tax1E4D3Z3Y02H0V9B	24				0	1
2998#Tax1E4D3Z3Y02HODS5	24				0	1
2638#Tax1E4D3Z3Y02H1Y7X	13				0	1
355#Taj1E4D3Z3Y02HG9TF	23				1	0
553#Taj1E4D3Z3Y02HVVUC	17				3	0
2058#Tax1E4D3Z3Y02JYV9K	26				0	1
3546#Tax1E4D3Z3Y02IQ9XV	15				0	1
1252#Tax1E4D3Z3Y02GZ3Q8	14				0	1
555#Taj1E4D3Z3Y02GG0Q3	17				2	0
2643#Tax1E4D3Z3Y02HY1LS	24				0	1
2877#Tax1E4D3Z3Y02IRZFZ	18				0	1
1037#Taj1E4D3Z3Y02GHXXP	13				3	0
4164#Tax1E4D3Z3Y02JSGVJ	15				0	1
3328#Tax1E4D3Z3Y02HBIQ0	18				0	1
195#Taj1E4D3Z3Y02IJHEB	21				6	0
2005#Tax1E4D3Z3Y02J4FT1	25				0	1
2828#Tax1E4D3Z3Y02J0GFJ	23				0	1
679#Taj1E4D3Z3Y02G4T5G	16				1	0
831#Taj1E4D3Z3Y02I07UZ	14				4	0
1960#Tax1E4D3Z3Y02G1MO3	26				0	1
2355#Tax1E4D3Z3Y02HFGII	17				0	1
1241#Tax1E4D3Z3Y02INNK5	21				0	1
647#Taj1E4D3Z3Y02I09FP	14				1	0
1441#Tax1E4D3Z3Y02GY5M1	16				0	1
1206#Taj1E4D3Z3Y02J2GKY	24				1	0
4753#Tax1E4D3Z3Y02G4NHW	14				0	1
4368#Tax1E4D3Z3Y02IVTUJ	24				0	1
1027#Taj1E4D3Z3Y02G4WK8	21				1	0
423#Taj1E4D3Z3Y02FN09E	30				5	0
1953#Tax1E4D3Z3Y02F9BW1	26				0	1
2757#Tax1E4D3Z3Y02G5GM1	16				0	1
4823#Tax1E4D3Z3Y02JZKB3	23				0	1
1222#Tax1E4D3Z3Y02HQBIU	24				0	1
3473#Tax1E4D3Z3Y02HQSME	15				0	1
174#Taj1E4D3Z3Y02I8D27	13				1	0
1571#>Tax1E4D3Z3Y02I219M	23				0	1
422#Taj1E4D3Z3Y02GQYI4	13				30	0
905#Taj1E4D3Z3Y02F7V7I	15				1	0
3308#Tax1E4D3Z3Y02IIA4L	13				0	1
3681#Tax1E4D3Z3Y02JTG88	21				0	1
52#Taj1E4D3Z3Y02FTNKS	28				1	0
302#Taj1E4D3Z3Y02HJ6TE	21				1	0
1451#Tax1E4D3Z3Y02F78S0	24				0	1
2452#Tax1E4D3Z3Y02JCLR9	30				0	1
3842#Tax1E4D3Z3Y02IX426	28				0	1
593#Taj1E4D3Z3Y02IBLTK	24				1	0
3358#Tax1E4D3Z3Y02JK6LV	16				0	1
188#Taj1E4D3Z3Y02GWLQB	14				2	0
402#Taj1E4D3Z3Y02F7T6I	21				1	0
3152#Tax1E4D3Z3Y02JP4WZ	19				0	1
1940#Tax1E4D3Z3Y02JIO93	24				0	1
3366#Tax1E4D3Z3Y02F8PY4	15				0	3
1641#Tax1E4D3Z3Y02IHTYE	15				0	2
640#Taj1E4D3Z3Y02F9MAR	21				2	0
1384#Tax1E4D3Z3Y02IUH2C	15				0	1
1468#Tax1E4D3Z3Y02HIPMS	24				0	1
3184#Tax1E4D3Z3Y02GNTIN	24				0	1
1726#Tax1E4D3Z3Y02HY3HM	13				0	1
2068#Tax1E4D3Z3Y02H1Y94	14				0	1
1464#Tax1E4D3Z3Y02GP2OU	24				0	1
1494#Tax1E4D3Z3Y02HJDF9	20				0	2
3440#Tax1E4D3Z3Y02GI1WK	16				0	1
4428#Tax1E4D3Z3Y02FQUE8	22				0	1
4354#Tax1E4D3Z3Y02I99R3	17				0	1
2018#Tax1E4D3Z3Y02GUQJ7	22				0	1
3426#Tax1E4D3Z3Y02JUYUH	17				0	1
1906#Tax1E4D3Z3Y02IGHGE	24				0	1
464#Taj1E4D3Z3Y02IZ102	14				1	0
2977#Tax1E4D3Z3Y02HAK9B	28				0	1
3235#Tax1E4D3Z3Y02IM3PU	17				0	1
2011#Tax1E4D3Z3Y02FV79N	16				0	1
6#Taj1E4D3Z3Y02GLZ9O	14				1	0
3452#Tax1E4D3Z3Y02IYNZ3	24				0	1
4435#Tax1E4D3Z3Y02IR6TP	23				0	1
3867#Tax1E4D3Z3Y02GNF16	15				0	1
1304#Tax1E4D3Z3Y02GQWW2	14				0	2
2327#Tax1E4D3Z3Y02GI7ZM	19				0	1
3179#Tax1E4D3Z3Y02HHV4R	24				0	1
3189#Tax1E4D3Z3Y02GI46D	13				0	2
3569#Tax1E4D3Z3Y02HCT1O	21				0	1
1593#Tax1E4D3Z3Y02F5VLC	15				0	1
705#Taj1E4D3Z3Y02H1QR9	27				1	0
4763#Tax1E4D3Z3Y02IYFJ4	16				0	1
4381#Tax1E4D3Z3Y02GVFAQ	14				0	1
1720#Tax1E4D3Z3Y02JWIY0	17				0	1
3053#Tax1E4D3Z3Y02HPOBQ	17				0	1
2206#Tax1E4D3Z3Y02HMWCM	23				0	2
4471#Tax1E4D3Z3Y02GB1DC	19				0	1
2177#Tax1E4D3Z3Y02IHUWW	15				0	1
912#Taj1E4D3Z3Y02GZQNP	29				1	0
785#Taj1E4D3Z3Y02JOOBQ	23				1	0
1432#Tax1E4D3Z3Y02I15VT	24				0	1
599#Taj1E4D3Z3Y02ICWY2	22				2	0
4574#Tax1E4D3Z3Y02GQ6FE	18				0	1
1930#Tax1E4D3Z3Y02JQJDW	23				0	1
587#Taj1E4D3Z3Y02JB9YX	20				1	0
1235#Tax1E4D3Z3Y02FMX2H	23				0	1
3814#Tax1E4D3Z3Y02H4KPD	24				0	1
298#Taj1E4D3Z3Y02G2TO8	24				1	0
95#Taj1E4D3Z3Y02JCUY4	21				5	0
3291#Tax1E4D3Z3Y02GASKO	16				0	1
923#Taj1E4D3Z3Y02JN9MN	18				3	0
243#>Taj1E4D3Z3Y02FXTK5	22				170	0
4731#Tax1E4D3Z3Y02JYYC9	14				0	1
3835#Tax1E4D3Z3Y02J3EI2	15				0	1
2051#Tax1E4D3Z3Y02IWYDN	13				0	1
2682#Tax1E4D3Z3Y02HQBN1	20				0	1
753#Taj1E4D3Z3Y02HBXW7	17				1	0
2404#Tax1E4D3Z3Y02HFZQ0	17				0	1
2171#Tax1E4D3Z3Y02HYGLW	24				0	1
106#Taj1E4D3Z3Y02JR10W	20				1	0
2611#Tax1E4D3Z3Y02GAI3Q	22				0	2
4425#Tax1E4D3Z3Y02JHNBY	23				0	1
65#Taj1E4D3Z3Y02FS0AP	17				1	0
203#Taj1E4D3Z3Y02GAVGW	13				1	0
4373#Tax1E4D3Z3Y02GWRL4	17				0	1
1023#Taj1E4D3Z3Y02I7XPN	21				1	0
2742#Tax1E4D3Z3Y02HRGQR	22				0	1
4702#Tax1E4D3Z3Y02HB233	16				0	1
1199#Taj1E4D3Z3Y02GWJ44	27				2	0
86#Taj1E4D3Z3Y02IMSVM	24				1	0
2084#Tax1E4D3Z3Y02JPCWC	24				0	1
2473#Tax1E4D3Z3Y02FVOQH	17				0	1
1158#Taj1E4D3Z3Y02H6Q3G	14				1	0
656#Taj1E4D3Z3Y02F0VN0	17				1	0
2170#Tax1E4D3Z3Y02HBR5O	14				0	1
2335#Tax1E4D3Z3Y02IW0RX	17				0	1
2921#Tax1E4D3Z3Y02JXUII	16				0	1
4726#Tax1E4D3Z3Y02HILS9	13				0	1
3468#Tax1E4D3Z3Y02JPJSW	16				0	1
435#Taj1E4D3Z3Y02F7GXF	29				1	0
3195#Tax1E4D3Z3Y02IJ2AA	13				0	1
1482#Tax1E4D3Z3Y02HLVH2	23				0	1
885#Taj1E4D3Z3Y02H6IP5	13				1	0
1412#Tax1E4D3Z3Y02IFOFM	18				0	1
1709#Tax1E4D3Z3Y02J4UFC	22				0	1
339#Taj1E4D3Z3Y02F3YF6	24				1	0
228#Taj1E4D3Z3Y02INJ6S	24				1	0
3783#Tax1E4D3Z3Y02JSX8Y	16				0	1
268#Taj1E4D3Z3Y02GVZEU	24				9	0
829#Taj1E4D3Z3Y02G5BHZ	18				1	0
2872#Tax1E4D3Z3Y02I199O	24				0	1
3677#Tax1E4D3Z3Y02JP920	24				0	1
596#Taj1E4D3Z3Y02HGJ1N	20				1	0
1297#Tax1E4D3Z3Y02GIQ9N	24				0	2
2090#Tax1E4D3Z3Y02HRTH6	13				0	1
1521#Tax1E4D3Z3Y02GRHX8	14				0	2
1862#Tax1E4D3Z3Y02FNP7I	15				0	2
2352#Tax1E4D3Z3Y02JFVKB	14				0	1
3495#Tax1E4D3Z3Y02HNJAP	24				0	1
1082#Taj1E4D3Z3Y02HPYCN	14				3	0
1066#Taj1E4D3Z3Y02GDGRP	15				1	0
121#Taj1E4D3Z3Y02IF90Y	27				1	0
494#Taj1E4D3Z3Y02HX47O	13				1	0
487#Taj1E4D3Z3Y02GI7QG	17				1	0
1956#Tax1E4D3Z3Y02H836G	14				0	1
3333#Tax1E4D3Z3Y02IWRT5	26				0	1
238#Taj1E4D3Z3Y02FQV1H	24				1	0
2235#Tax1E4D3Z3Y02JKX8M	17				0	1
2778#Tax1E4D3Z3Y02J4UNL	18				0	1
3175#Tax1E4D3Z3Y02IHM5A	25				0	1
873#Taj1E4D3Z3Y02GV131	25				1	0
4819#Tax1E4D3Z3Y02HXMCM	18				0	1
3604#Tax1E4D3Z3Y02GLAH8	21				0	1
3081#Tax1E4D3Z3Y02JNPDY	19				0	1
4792#Tax1E4D3Z3Y02IAWHJ	17				0	1
3099#Tax1E4D3Z3Y02IODSF	23				0	1
448#Taj1E4D3Z3Y02GFT4Y	15				30	0
3634#Tax1E4D3Z3Y02H2J4S	23				0	1
3760#Tax1E4D3Z3Y02HL6G2	24				0	1
2631#Tax1E4D3Z3Y02JX5PK	15				0	1
2278#Tax1E4D3Z3Y02G2AYP	26				0	2
4152#Tax1E4D3Z3Y02I26VK	21				0	1
4639#Tax1E4D3Z3Y02H27GP	18				0	1
4647#Tax1E4D3Z3Y02GC0WO	21				0	1
3297#Tax1E4D3Z3Y02HY5KZ	24				0	1
1532#Tax1E4D3Z3Y02GYHNP	19				0	1
4246#Tax1E4D3Z3Y02F4EGB	21				0	1
713#Taj1E4D3Z3Y02H83H1	24				1	0
3557#Tax1E4D3Z3Y02JYL3U	17				0	1
4233#Tax1E4D3Z3Y02JAVEX	26				0	1
2839#Tax1E4D3Z3Y02HNXGN	21				0	1
4532#Tax1E4D3Z3Y02HHRP7	16				0	1
1679#Tax1E4D3Z3Y02FS8TP	13				0	1
4238#Tax1E4D3Z3Y02IOAEL	18				0	1
4346#Tax1E4D3Z3Y02GIEOC	16				0	1
4215#Tax1E4D3Z3Y02JSX5W	21				0	1
1262#Tax1E4D3Z3Y02FVLUW	24				0	3
1290#Tax1E4D3Z3Y02IEE79	24				0	1
1527#Tax1E4D3Z3Y02HXTB8	24				0	1
2162#Tax1E4D3Z3Y02JSQHZ	19				0	1
1132#Taj1E4D3Z3Y02IKR40	20				1	0
4308#Tax1E4D3Z3Y02I7P1V	20				0	1
4707#Tax1E4D3Z3Y02GSZEU	14				0	1
1925#Tax1E4D3Z3Y02HKNFB	26				0	1
3847#Tax1E4D3Z3Y02I9J41	14				0	1
2574#Tax1E4D3Z3Y02HT8RG	16				0	1
2916#Tax1E4D3Z3Y02G6AS1	17				0	1
3126#Tax1E4D3Z3Y02JSTF5	23				0	1
547#Taj1E4D3Z3Y02H046C	24				1	0
631#Taj1E4D3Z3Y02F3HLU	28				3	0
1544#Tax1E4D3Z3Y02JR8GQ	21				0	1
1616#Tax1E4D3Z3Y02J0A2J	21				0	1
396#Taj1E4D3Z3Y02HK5RC	17				1	0
4694#Tax1E4D3Z3Y02IC06L	28				0	1
1422#Tax1E4D3Z3Y02H6J9F	14				0	1
482#Taj1E4D3Z3Y02GIHHO	16				76	0
949#Taj1E4D3Z3Y02F5AJN	17				1	0
499#Taj1E4D3Z3Y02FW68B	24				1	0
3432#Tax1E4D3Z3Y02IQ5UZ	18				0	1
4713#Tax1E4D3Z3Y02GRCEV	24				0	1
4556#Tax1E4D3Z3Y02H3LAM	24				0	1
1047#Taj1E4D3Z3Y02G2RMA	22				2	0
3856#Tax1E4D3Z3Y02IGOU7	19				0	1
1276#Tax1E4D3Z3Y02GI1J8	24				0	1
3228#Tax1E4D3Z3Y02GUS7J	25				0	1
909#Taj1E4D3Z3Y02HZQUB	24				1	0
4121#Tax1E4D3Z3Y02JPADH	25				0	1
4315#Tax1E4D3Z3Y02HHXTI	25				0	1
1124#Taj1E4D3Z3Y02JV06V	24				1	0
2618#Tax1E4D3Z3Y02F8T4A	24				0	1
2981#Tax1E4D3Z3Y02JDAHG	29				0	3
75#Taj1E4D3Z3Y02HD9AG	15				2	0
4266#Tax1E4D3Z3Y02I8897	24				0	1
2588#Tax1E4D3Z3Y02JH3ET	24				0	1
1163#Taj1E4D3Z3Y02I6EFE	24				1	0
450#Taj1E4D3Z3Y02IN346	21				13	0
4518#Tax1E4D3Z3Y02GX8UU	20				0	1
1702#Tax1E4D3Z3Y02F8S8O	19				0	1
1405#Tax1E4D3Z3Y02GNGK0	13				0	1
3118#Tax1E4D3Z3Y02FQVPB	14				0	1
4442#Tax1E4D3Z3Y02IXOX6	13				0	1
4141#Tax1E4D3Z3Y02IAM4F	19				0	1
1729#Tax1E4D3Z3Y02F9TJO	18				0	1
146#Taj1E4D3Z3Y02JPLYB	17				1	0
3202#Tax1E4D3Z3Y02HA8FA	14				0	1
1351#Tax1E4D3Z3Y02IOHNU	24				0	1
356#Taj1E4D3Z3Y02G1LTL	21				2	0
2396#Tax1E4D3Z3Y02J0AU4	17				0	2
2720#Tax1E4D3Z3Y02F6SCS	13				0	1
528#Taj1E4D3Z3Y02FS5CC	24				1	0
164#Taj1E4D3Z3Y02IA8BV	17				1	0
807#Taj1E4D3Z3Y02GAS7K	20				1	0
4325#Tax1E4D3Z3Y02GI8JS	29				0	1
3897#Tax1E4D3Z3Y02I5ESP	16				0	1
2040#Tax1E4D3Z3Y02F0HT3	26				0	1
2678#Tax1E4D3Z3Y02JTZII	14				0	1
2898#Tax1E4D3Z3Y02I8DSM	20				0	1
882#Taj1E4D3Z3Y02HKGX5	13				1	0
4379#Tax1E4D3Z3Y02F3JD7	14				0	1
1050#Taj1E4D3Z3Y02ICJUP	17				1	0
4054#Tax1E4D3Z3Y02G1Z3M	24				0	1
1031#Taj1E4D3Z3Y02JSGU9	26				1	0
4585#Tax1E4D3Z3Y02IIKH6	17				0	1
2942#Tax1E4D3Z3Y02H2TQD	14				0	1
3401#Tax1E4D3Z3Y02IQFOI	17				0	1
454#Taj1E4D3Z3Y02GBB2Q	25				1	0
3139#Tax1E4D3Z3Y02HMU3P	19				0	1
1364#Tax1E4D3Z3Y02JSBUX	20				0	4
2538#Tax1E4D3Z3Y02H8N0K	21				0	1
4845#Tax1E4D3Z3Y02HCGYJ	22				0	1
634#Taj1E4D3Z3Y02INDHS	15				1	0
2551#Tax1E4D3Z3Y02JCRQE	19				0	1
978#Taj1E4D3Z3Y02I78LK	15				1	0
4774#Tax1E4D3Z3Y02IZH7N	14				0	1
3324#Tax1E4D3Z3Y02GK41F	21				0	1
3741#Tax1E4D3Z3Y02G5FJE	22				0	1
4813#Tax1E4D3Z3Y02IJPI9	13				0	1
3752#Tax1E4D3Z3Y02HJGV6	17				0	1
2144#Tax1E4D3Z3Y02H6FQ3	14				0	1
325#Taj1E4D3Z3Y02GUK30	13				3	0
378#Taj1E4D3Z3Y02GRKP0	14				1	0
889#Taj1E4D3Z3Y02F9C3Q	24				1	0
1233#Tax1E4D3Z3Y02FVVN2	23				0	1
3390#Tax1E4D3Z3Y02IIVKF	14				0	1
1162#Taj1E4D3Z3Y02IHTO1	26				1	0
3972#Tax1E4D3Z3Y02HL1CO	25				0	1
211#Taj1E4D3Z3Y02HT947	23				18	0
684#Taj1E4D3Z3Y02GPYXE	21				1	0
2831#Tax1E4D3Z3Y02JC81Y	19				0	1
3315#Tax1E4D3Z3Y02GWRGX	19				0	1
1924#Tax1E4D3Z3Y02HLLRI	14				0	1
3042#Tax1E4D3Z3Y02HRTO7	16				0	1
1214#Tax1E4D3Z3Y02ITU9K	25				0	1
389#Taj1E4D3Z3Y02J3SXY	21				1	0
1660#Tax1E4D3Z3Y02IP0YE	24				0	1
3525#Tax1E4D3Z3Y02J58NT	15				0	1
3207#Tax1E4D3Z3Y02H7CRF	22				0	1
3887#Tax1E4D3Z3Y02JBN4L	21				0	1
966#Taj1E4D3Z3Y02IPTKG	15				2	0
2216#Tax1E4D3Z3Y02IH2OJ	25				0	1
2314#Tax1E4D3Z3Y02FXI3M	22				0	1
992#Taj1E4D3Z3Y02JZKTH	20				1	0
1954#Tax1E4D3Z3Y02JCWRP	16				0	1
218#Taj1E4D3Z3Y02GX3V6	14				5	0
2843#Tax1E4D3Z3Y02IHFLW	24				0	1
2345#Tax1E4D3Z3Y02J1PJY	25				0	1
3124#Tax1E4D3Z3Y02JWU7N	14				0	1
3391#Tax1E4D3Z3Y02JIT02	15				0	1
2973#Tax1E4D3Z3Y02HGN8X	29				0	1
4602#Tax1E4D3Z3Y02JU8R4	24				0	1
2567#Tax1E4D3Z3Y02HQ0FK	14				0	1
2999#Tax1E4D3Z3Y02JJNLO	18				0	1
4321#Tax1E4D3Z3Y02IU2F6	24				0	3
3289#Tax1E4D3Z3Y02G5AFN	24				0	1
3158#Tax1E4D3Z3Y02F43JC	13				0	1
2188#Tax1E4D3Z3Y02I6MGG	13				0	2
2767#Tax1E4D3Z3Y02IZ34X	23				0	1
1778#Tax1E4D3Z3Y02IBCOD	24				0	1
3667#Tax1E4D3Z3Y02HW0NP	28				0	1
1859#Tax1E4D3Z3Y02HRJ0D	15				0	1
2339#Tax1E4D3Z3Y02IIOW0	24				0	1
160#Taj1E4D3Z3Y02HC6E5	14				3	0
3782#Tax1E4D3Z3Y02GKPQ3	18				0	1
98#Taj1E4D3Z3Y02GFKLU	14				5	0
1048#Taj1E4D3Z3Y02F6O02	16				1	0
1278#Tax1E4D3Z3Y02IYSH1	24				0	1
2901#Tax1E4D3Z3Y02FISZ3	22				0	1
2434#Tax1E4D3Z3Y02HFOEH	26				0	1
1381#Tax1E4D3Z3Y02FXEE0	24				0	1
1061#Taj1E4D3Z3Y02JETZY	24				1	0
2054#Tax1E4D3Z3Y02H9E39	29				0	1
3792#Tax1E4D3Z3Y02J0JM4	24				0	1
3735#Tax1E4D3Z3Y02I88CE	24				0	1
2785#Tax1E4D3Z3Y02GPCS4	13				0	1
3224#Tax1E4D3Z3Y02IZTU6	30				0	1
3635#Tax1E4D3Z3Y02HWHNN	24				0	1
3732#Tax1E4D3Z3Y02H52XJ	23				0	1
1555#Tax1E4D3Z3Y02GDD5R	19				0	1
586#Taj1E4D3Z3Y02FNBY5	16				1	0
2870#Tax1E4D3Z3Y02ICCL1	16				0	1
4337#Tax1E4D3Z3Y02ILLAU	14				0	1
410#Taj1E4D3Z3Y02FQY5A	21				1	0
2859#Tax1E4D3Z3Y02J31OH	14				0	1
999#Taj1E4D3Z3Y02I1OGN	24				1	0
3193#Tax1E4D3Z3Y02JSOLD	19				0	1
3019#Tax1E4D3Z3Y02ISJSQ	14				0	1
1185#Taj1E4D3Z3Y02I42W0	27				1	0
2169#Tax1E4D3Z3Y02IZCBV	24				0	1
4637#Tax1E4D3Z3Y02IU6RZ	29				0	1
1741#Tax1E4D3Z3Y02FR3Y3	17				0	1
4211#Tax1E4D3Z3Y02HKUD1	18				0	1
1130#Taj1E4D3Z3Y02I3R2E	15				1	0
1315#Tax1E4D3Z3Y02GHQHI	16				0	1
4599#Tax1E4D3Z3Y02IUKKA	27				0	1
189#Taj1E4D3Z3Y02HB4RS	26				1	0
2330#Tax1E4D3Z3Y02I2X4V	24				0	1
2849#Tax1E4D3Z3Y02HUE95	22				0	1
480#Taj1E4D3Z3Y02JHR18	26				1	0
107#Taj1E4D3Z3Y02HAQ5E	21				20	0
3810#Tax1E4D3Z3Y02I3GDP	22				0	1
87#Taj1E4D3Z3Y02GBA42	14				2	0
2385#Tax1E4D3Z3Y02HKPEA	26				0	1
4099#Tax1E4D3Z3Y02IL583	21				0	1
4339#Tax1E4D3Z3Y02F9DOM	13				0	1
1832#Tax1E4D3Z3Y02HCTOL	23				0	1
2704#Tax1E4D3Z3Y02HTXKD	24				0	1
3796#Tax1E4D3Z3Y02JS3FS	23				0	1
221#Taj1E4D3Z3Y02GEM6G	17				1	0
3147#Tax1E4D3Z3Y02HV0R3	26				0	1
4486#Tax1E4D3Z3Y02GTQCI	15				0	1
1424#Tax1E4D3Z3Y02J5DPZ	16				0	2
3176#Tax1E4D3Z3Y02HMQET	20				0	2
417#Taj1E4D3Z3Y02I60NW	24				1	0
4623#Tax1E4D3Z3Y02HN10F	14				0	1
4547#Tax1E4D3Z3Y02JX9MA	28				0	1
1530#Tax1E4D3Z3Y02JD9HU	13				0	2
4388#Tax1E4D3Z3Y02IBFBQ	24				0	1
2504#Tax1E4D3Z3Y02IZ6W7	13				0	1
3819#Tax1E4D3Z3Y02IUMFE	13				0	1
734#Taj1E4D3Z3Y02HUF77	18				1	0
2798#Tax1E4D3Z3Y02GW8N0	17				0	1
2952#Tax1E4D3Z3Y02JN508	17				0	1
2621#Tax1E4D3Z3Y02FXU0W	22				0	1
3724#Tax1E4D3Z3Y02GOCBY	15				0	1
1440#Tax1E4D3Z3Y02J0Y12	24				0	1
2524#Tax1E4D3Z3Y02JRD0L	19				0	1
381#Taj1E4D3Z3Y02HOH12	15				2	0
1471#Tax1E4D3Z3Y02GJ3KC	27				0	1
1814#Tax1E4D3Z3Y02H6HJI	16				0	1
2966#Tax1E4D3Z3Y02IAKUT	20				0	2
4330#Tax1E4D3Z3Y02JMJFX	14				0	1
373#Taj1E4D3Z3Y02GU64X	23				1	0
3379#Tax1E4D3Z3Y02G5NI1	18				0	2
2078#Tax1E4D3Z3Y02HEOGB	20				0	2
773#Taj1E4D3Z3Y02H1IBU	22				1	0
1247#Tax1E4D3Z3Y02GNYTY	24				0	1
1752#Tax1E4D3Z3Y02HFN36	21				0	1
1309#Tax1E4D3Z3Y02IDSPF	23				0	1
1576#Tax1E4D3Z3Y02HQBIO	24				0	1
3448#Tax1E4D3Z3Y02GIP6J	26				0	1
4508#Tax1E4D3Z3Y02I75TA	24				0	1
2874#Tax1E4D3Z3Y02JCP4I	19				0	1
1622#Tax1E4D3Z3Y02F4CUP	13				0	1
3685#Tax1E4D3Z3Y02GVTNL	28				0	1
4457#Tax1E4D3Z3Y02J2M9M	17				0	1
975#Taj1E4D3Z3Y02G7XH6	13				2	0
3605#Tax1E4D3Z3Y02HFA6S	19				0	1
1911#Tax1E4D3Z3Y02FWTE9	15				0	2
2856#Tax1E4D3Z3Y02FYBDE	24				0	1
2199#Tax1E4D3Z3Y02ISJOR	19				0	1
3709#Tax1E4D3Z3Y02HLBBB	24				0	1
3002#Tax1E4D3Z3Y02J243N	16				0	1
4173#Tax1E4D3Z3Y02G0O9I	15				0	1
3113#Tax1E4D3Z3Y02I341S	15				0	1
1893#Tax1E4D3Z3Y02FZX1S	20				0	1
1646#Tax1E4D3Z3Y02ILJBT	25				0	1
3010#Tax1E4D3Z3Y02G5DD0	21				0	1
534#Taj1E4D3Z3Y02FUCVC	29				7	0
746#Taj1E4D3Z3Y02JG4X1	15				15	0
3572#Tax1E4D3Z3Y02HRMZV	13				0	1
4286#Tax1E4D3Z3Y02IJ0BI	15				0	1
3690#Tax1E4D3Z3Y02JGO7F	24				0	1
744#Taj1E4D3Z3Y02HSM1Q	20				3	0
151#Taj1E4D3Z3Y02HWK80	13				5	0
3822#Tax1E4D3Z3Y02HKKT4	20				0	1
1952#Tax1E4D3Z3Y02H553N	18				0	1
4562#Tax1E4D3Z3Y02H8ZJD	15				0	1
287#Taj1E4D3Z3Y02GC0MC	23				1	0
475#Taj1E4D3Z3Y02IMQ0I	17				1	0
932#Taj1E4D3Z3Y02G2DJX	14				2	0
2595#Tax1E4D3Z3Y02GFJ2S	30				0	1
3908#Tax1E4D3Z3Y02J1Q6T	15				0	1
3858#Tax1E4D3Z3Y02FQCWK	16				0	1
515#Taj1E4D3Z3Y02FL5N3	16				2	0
1525#Tax1E4D3Z3Y02IY3UK	15				0	1
4047#Tax1E4D3Z3Y02JGO89	18				0	1
2545#Tax1E4D3Z3Y02HR64I	17				0	1
2761#Tax1E4D3Z3Y02J04PY	20				0	1
138#Taj1E4D3Z3Y02JS4FB	19				1	0
1107#Taj1E4D3Z3Y02G29T0	21				2	0
2996#Tax1E4D3Z3Y02HD7CA	24				0	1
3499#Tax1E4D3Z3Y02HMK62	22				0	2
3838#Tax1E4D3Z3Y02I9N1C	19				0	1
724#Taj1E4D3Z3Y02J0RNQ	17				1	0
4104#Tax1E4D3Z3Y02HDB2J	19				0	1
3598#Tax1E4D3Z3Y02JRDHS	16				0	1
3534#Tax1E4D3Z3Y02H6A26	29				0	1
3958#Tax1E4D3Z3Y02I1CKP	24				0	1
1195#Taj1E4D3Z3Y02J242X	24				1	0
3831#Tax1E4D3Z3Y02IW7J7	16				0	1
1327#Tax1E4D3Z3Y02GZWVY	15				0	3
2192#Tax1E4D3Z3Y02HDHI0	22				0	1
4655#Tax1E4D3Z3Y02HTBA4	17				0	2
2667#Tax1E4D3Z3Y02GS7M9	21				0	1
333#Taj1E4D3Z3Y02HMDJ6	21				36	0
1995#Tax1E4D3Z3Y02F4XNY	17				0	1
4080#Tax1E4D3Z3Y02F14ZJ	13				0	1
4040#Tax1E4D3Z3Y02HD739	24				0	1
4427#Tax1E4D3Z3Y02GXAOR	16				0	1
4451#Tax1E4D3Z3Y02ILS7I	16				0	1
3985#Tax1E4D3Z3Y02FPKWS	24				0	1
2780#Tax1E4D3Z3Y02GEDAS	21				0	1
446#Taj1E4D3Z3Y02HL2FJ	24				2	0
3901#Tax1E4D3Z3Y02I08AY	14				0	1
2181#Tax1E4D3Z3Y02GPDCQ	17				0	1
2229#Tax1E4D3Z3Y02HVMCY	14				0	1
1582#Tax1E4D3Z3Y02IUS6F	21				0	1
2842#Tax1E4D3Z3Y02HZNQ2	21				0	1
1599#Tax1E4D3Z3Y02JJ6G0	26				0	1
2306#Tax1E4D3Z3Y02GLIMD	14				0	1
3013#Tax1E4D3Z3Y02GIIWT	24				0	1
1149#Taj1E4D3Z3Y02I0E8E	24				1	0
2900#Tax1E4D3Z3Y02G6K2D	24				0	1
2283#Tax1E4D3Z3Y02JMMDK	18				0	1
2603#Tax1E4D3Z3Y02GHS9X	24				0	1
2407#Tax1E4D3Z3Y02I3C80	13				0	2
2695#Tax1E4D3Z3Y02GPS6K	14				0	1
1238#Tax1E4D3Z3Y02I0IB7	28				0	1
1559#Tax1E4D3Z3Y02HCN1D	15				0	1
2866#Tax1E4D3Z3Y02HJ3FG	27				0	1
7#Taj1E4D3Z3Y02HMWDW	21				1	0
1793#Tax1E4D3Z3Y02GSYS0	19				0	1
1701#Tax1E4D3Z3Y02I9U16	24				0	1
2443#Tax1E4D3Z3Y02I1782	21				0	1
1937#Tax1E4D3Z3Y02G720C	22				0	1
255#Taj1E4D3Z3Y02GRI93	21				13	0
4688#Tax1E4D3Z3Y02GGJ61	13				0	1
2230#Tax1E4D3Z3Y02GAJ9D	15				0	1
4274#Tax1E4D3Z3Y02JLHIJ	28				0	1
182#Taj1E4D3Z3Y02IR2TK	14				44	0
4740#Tax1E4D3Z3Y02JZ7B0	22				0	1
3422#Tax1E4D3Z3Y02IXSCP	15				0	1
4146#Tax1E4D3Z3Y02HD9O4	19				0	1
3809#Tax1E4D3Z3Y02H82KB	15				0	1
815#Taj1E4D3Z3Y02GBXGY	17				6	0
3486#Tax1E4D3Z3Y02GISFX	20				0	1
167#Taj1E4D3Z3Y02HUAQC	21				1	0
692#Taj1E4D3Z3Y02IKU3C	19				1	0
3564#Tax1E4D3Z3Y02HOK9E	20				0	1
1907#Tax1E4D3Z3Y02JJRFA	24				0	1
854#Taj1E4D3Z3Y02JCZ01	18				2	0
3120#Tax1E4D3Z3Y02INB0N	27				0	1
3769#Tax1E4D3Z3Y02F4OQ8	14				0	1
1174#Taj1E4D3Z3Y02GS5XV	23				1	0
4023#Tax1E4D3Z3Y02IL1O4	24				0	1
510#Taj1E4D3Z3Y02GG9PL	29				1	0
3020#Tax1E4D3Z3Y02JHIHZ	25				0	1
393#Taj1E4D3Z3Y02GRJVF	22				1	0
3262#Tax1E4D3Z3Y02GBXUP	16				0	1
658#Taj1E4D3Z3Y02I58D2	17				1	0
274#Taj1E4D3Z3Y02GJVNF	24				1	0
3550#Tax1E4D3Z3Y02G1LFY	23				0	2
4392#Tax1E4D3Z3Y02G64VA	14				0	1
4786#Tax1E4D3Z3Y02JFDQG	20				0	1
877#Taj1E4D3Z3Y02HDMII	16				2	0
1508#Tax1E4D3Z3Y02HSJRT	19				0	1
3034#Tax1E4D3Z3Y02HUOOU	14				0	1
1771#Tax1E4D3Z3Y02GXOQT	24				0	2
1128#Taj1E4D3Z3Y02IFZ96	17				1	0
2891#Tax1E4D3Z3Y02I0ALG	18				0	1
4737#Tax1E4D3Z3Y02G277S	16				0	1
4074#Tax1E4D3Z3Y02HQX6H	17				0	1
3515#Tax1E4D3Z3Y02HI6VI	16				0	1
1724#Tax1E4D3Z3Y02I6P7O	15				0	1
1520#Tax1E4D3Z3Y02GHI0J	13				0	1
4056#Tax1E4D3Z3Y02FVXRJ	29				0	1
3965#Tax1E4D3Z3Y02H6H7J	15				0	1
2148#Tax1E4D3Z3Y02HF386	24				0	1
250#Taj1E4D3Z3Y02I9N6I	24				1	0
303#Taj1E4D3Z3Y02F0TED	29				11	0
614#Taj1E4D3Z3Y02IZ552	20				1	0
2963#Tax1E4D3Z3Y02GPXKF	21				0	1
1765#Tax1E4D3Z3Y02JXVPZ	20				0	1
2959#Tax1E4D3Z3Y02FR9T9	16				0	1
130#Taj1E4D3Z3Y02IB7HW	18				1	0
1373#Tax1E4D3Z3Y02F3IW1	21				0	1
53#Taj1E4D3Z3Y02H0CDS	24				6	0
2925#Tax1E4D3Z3Y02GCELW	19				0	1
1302#Tax1E4D3Z3Y02FXCDN	17				0	3
2239#Tax1E4D3Z3Y02J26L2	15				0	1
4517#Tax1E4D3Z3Y02H5JAT	15				0	1
3341#Tax1E4D3Z3Y02F7P8Z	20				0	1
3029#Tax1E4D3Z3Y02JWDJN	21				0	1
2392#Tax1E4D3Z3Y02FRTWR	17				0	1
3587#Tax1E4D3Z3Y02HOF0X	27				0	1
4255#Tax1E4D3Z3Y02JJ0WD	13				0	1
1879#Tax1E4D3Z3Y02HTLZK	17				0	2
3313#Tax1E4D3Z3Y02IJOO0	14				0	1
1824#Tax1E4D3Z3Y02IL4WQ	21				0	1
2917#Tax1E4D3Z3Y02IPCF0	15				0	1
4135#Tax1E4D3Z3Y02HEU0O	24				0	1
2342#Tax1E4D3Z3Y02H65IY	13				0	1
3516#Tax1E4D3Z3Y02GDVNE	24				0	1
832#Taj1E4D3Z3Y02F1DAP	13				10	0
2135#Tax1E4D3Z3Y02HA4S1	14				0	1
3916#Tax1E4D3Z3Y02IE5VF	18				0	1
828#Taj1E4D3Z3Y02JWD3Y	24				1	0
276#Taj1E4D3Z3Y02JM1N1	22				1	0
2465#Tax1E4D3Z3Y02HX0L5	27				0	1
1831#Tax1E4D3Z3Y02IS56X	21				0	1
3949#Tax1E4D3Z3Y02G2TJ4	23				0	1
3523#Tax1E4D3Z3Y02I4FBD	29				0	1
3868#Tax1E4D3Z3Y02JKNI6	17				0	1
4614#Tax1E4D3Z3Y02G157U	16				0	1
1404#Tax1E4D3Z3Y02F8LO8	24				0	1
1543#Tax1E4D3Z3Y02IGXU8	24				0	1
424#Taj1E4D3Z3Y02IVUDY	15				1	0
4124#Tax1E4D3Z3Y02HT72B	14				0	1
1402#Tax1E4D3Z3Y02HB0NQ	24				0	1
2986#Tax1E4D3Z3Y02JWM64	21				0	1
2402#Tax1E4D3Z3Y02G38AH	15				0	1
1841#Tax1E4D3Z3Y02HNC1E	22				0	2
347#Taj1E4D3Z3Y02JV55C	14				1	0
3558#Tax1E4D3Z3Y02HC08J	16				0	1
3294#Tax1E4D3Z3Y02I1WS7	14				0	1
4307#Tax1E4D3Z3Y02GAT5Q	24				0	1
2586#Tax1E4D3Z3Y02JEE65	16				0	1
434#Taj1E4D3Z3Y02GTNRV	23				1	0
865#Taj1E4D3Z3Y02HWQ6F	29				1	0
1184#Taj1E4D3Z3Y02IX5F9	24				1	0
3165#Tax1E4D3Z3Y02GV66A	17				0	1
4216#Tax1E4D3Z3Y02JMSMC	17				0	1
4134#Tax1E4D3Z3Y02JAWP8	15				0	1
4654#Tax1E4D3Z3Y02I275U	17				0	1
3929#Tax1E4D3Z3Y02GT6PG	15				0	1
3129#Tax1E4D3Z3Y02FRQ3S	16				0	1
689#Taj1E4D3Z3Y02I1L7D	20				7	0
3462#Tax1E4D3Z3Y02HWKR8	28				0	1
1116#Taj1E4D3Z3Y02HISZI	13				1	0
4413#Tax1E4D3Z3Y02G7WR1	26				0	1
2869#Tax1E4D3Z3Y02G6631	17				0	1
1725#Tax1E4D3Z3Y02HJ8BI	15				0	1
2379#Tax1E4D3Z3Y02HR967	19				0	1
727#Taj1E4D3Z3Y02H2XUX	17				1	0
4220#Tax1E4D3Z3Y02H3MCX	17				0	1
939#Taj1E4D3Z3Y02G448J	20				1	0
4600#Tax1E4D3Z3Y02IKC8P	28				0	1
4095#Tax1E4D3Z3Y02IX7LD	16				0	1
2619#Tax1E4D3Z3Y02IWKW3	18				0	2
1670#Tax1E4D3Z3Y02GTLD1	22				0	1
2010#Tax1E4D3Z3Y02IV8UP	25				0	1
2834#Tax1E4D3Z3Y02JUNGJ	21				0	1
3342#Tax1E4D3Z3Y02J58D7	23				0	1
1537#Tax1E4D3Z3Y02F8ZSP	21				0	1
4237#Tax1E4D3Z3Y02HZ18J	25				0	1
1127#Taj1E4D3Z3Y02HT1NT	24				1	0
4415#Tax1E4D3Z3Y02JF4LS	17				0	1
894#Taj1E4D3Z3Y02GLN8Z	18				1	0
3425#Tax1E4D3Z3Y02HMT1G	22				0	1
1298#Tax1E4D3Z3Y02F7UQV	28				0	1
140#Taj1E4D3Z3Y02H3R7I	24				1	0
2222#Tax1E4D3Z3Y02HDUSA	13				0	1
1900#Tax1E4D3Z3Y02JT6Y6	22				0	1
3460#Tax1E4D3Z3Y02HWKSE	25				0	1
954#Taj1E4D3Z3Y02HVGGF	24				2	0
4524#Tax1E4D3Z3Y02JB2XS	13				0	1
801#Taj1E4D3Z3Y02HNZCU	20				1	0
985#Taj1E4D3Z3Y02HX2T6	16				1	0
754#Taj1E4D3Z3Y02F1FHN	18				1	0
3151#Tax1E4D3Z3Y02I65E2	14				0	1
3061#Tax1E4D3Z3Y02ID447	26				0	1
1563#Tax1E4D3Z3Y02J5UN1	16				0	1
1003#Taj1E4D3Z3Y02GIY15	21				1	0
4147#Tax1E4D3Z3Y02J2JUE	19				0	1
4355#Tax1E4D3Z3Y02JFX3O	13				0	1
1800#Tax1E4D3Z3Y02JTVM1	19				0	1
4230#Tax1E4D3Z3Y02HH7EQ	29				0	1
1717#Tax1E4D3Z3Y02INHRJ	25				0	1
4349#Tax1E4D3Z3Y02JQ6O2	23				0	1
2557#Tax1E4D3Z3Y02F424R	22				0	1
698#Taj1E4D3Z3Y02HJLHH	15				1	0
1634#Tax1E4D3Z3Y02HTHBV	13				0	1
524#Taj1E4D3Z3Y02JSOBP	24				1	0
2176#Tax1E4D3Z3Y02GTOCB	19				0	1
1848#Tax1E4D3Z3Y02IEGZR	21				0	4
2714#Tax1E4D3Z3Y02H6S8V	27				0	1
4380#Tax1E4D3Z3Y02JF4HD	21				0	1
3418#Tax1E4D3Z3Y02JLUGV	20				0	1
4706#Tax1E4D3Z3Y02HMEDX	22				0	1
598#Taj1E4D3Z3Y02I7G6A	15				1	0
2486#Tax1E4D3Z3Y02GPPHA	23				0	1
780#Taj1E4D3Z3Y02HT8LQ	16				1	0
3547#Tax1E4D3Z3Y02IINUX	14				0	1
3277#Tax1E4D3Z3Y02HWWNW	15				0	1
2317#Tax1E4D3Z3Y02I879X	24				0	2
3490#Tax1E4D3Z3Y02F1VH6	15				0	1
1433#Tax1E4D3Z3Y02G73YS	21				0	2
240#Taj1E4D3Z3Y02IC0YD	24				1	0
1666#Tax1E4D3Z3Y02GA2H1	23				0	1
2209#Tax1E4D3Z3Y02H2DTQ	21				0	1
230#Taj1E4D3Z3Y02GG4OJ	21				4	0
115#Taj1E4D3Z3Y02JF58K	24				2	0
2374#Tax1E4D3Z3Y02HZM7B	18				0	1
922#Taj1E4D3Z3Y02FMN5H	24				1	0
2319#Tax1E4D3Z3Y02I4OP6	24				0	1
3740#Tax1E4D3Z3Y02GBK3G	22				0	1
2741#Tax1E4D3Z3Y02F6YO9	24				0	1
2628#Tax1E4D3Z3Y02IZQ4Q	24				0	1
1072#Taj1E4D3Z3Y02F4MV4	22				1	0
2470#Tax1E4D3Z3Y02GKU2K	15				0	1
1394#Tax1E4D3Z3Y02JQPNA	17				0	2
2772#Tax1E4D3Z3Y02FWYFA	16				0	1
3456#Tax1E4D3Z3Y02JTCNQ	24				0	1
2251#Tax1E4D3Z3Y02IPRL1	14				0	1
1277#Tax1E4D3Z3Y02ICX1K	24				0	1
1086#Taj1E4D3Z3Y02J0YBX	22				1	0
564#Taj1E4D3Z3Y02G3CGW	22				1	0
3070#Tax1E4D3Z3Y02GEDOH	21				0	1
4488#Tax1E4D3Z3Y02INW3M	24				0	1
3951#Tax1E4D3Z3Y02HVA9V	26				0	1
2562#Tax1E4D3Z3Y02HF74H	25				0	1
3094#Tax1E4D3Z3Y02G6POG	22				0	1
2850#Tax1E4D3Z3Y02IWIP7	15				0	1
1967#Tax1E4D3Z3Y02HOIV7	28				0	1
657#Taj1E4D3Z3Y02F78LB	23				1	0
1865#Tax1E4D3Z3Y02FXQ3Z	17				0	1
1783#Tax1E4D3Z3Y02I0U0N	27				0	1
4642#Tax1E4D3Z3Y02F19M8	19				0	1
503#Taj1E4D3Z3Y02HIGSP	22				1	0
4181#Tax1E4D3Z3Y02JJNA4	29				0	1
4126#Tax1E4D3Z3Y02GRF1L	13				0	1
1483#Tax1E4D3Z3Y02FYSS6	19				0	2
4069#Tax1E4D3Z3Y02IRV51	14				0	1
3800#Tax1E4D3Z3Y02HTXCV	18				0	1
1996#Tax1E4D3Z3Y02IQAKN	24				0	1
4695#Tax1E4D3Z3Y02HGQNZ	13				0	1
4584#Tax1E4D3Z3Y02JQPMT	23				0	1
1036#Taj1E4D3Z3Y02FNADO	14				1	0
3492#Tax1E4D3Z3Y02ID2JM	26				0	1
2065#Tax1E4D3Z3Y02GHQI2	29				0	1
1265#Tax1E4D3Z3Y02HIO2A	16				0	1
4150#Tax1E4D3Z3Y02H6Y8Y	16				0	1
544#Taj1E4D3Z3Y02F8NI9	15				1	0
4696#Tax1E4D3Z3Y02IUZE9	13				0	1
4370#Tax1E4D3Z3Y02IHRCX	15				0	1
3253#Tax1E4D3Z3Y02HG8S2	16				0	2
4527#Tax1E4D3Z3Y02G2TVY	27				0	1
4634#Tax1E4D3Z3Y02JUT6K	18				0	1
1196#Taj1E4D3Z3Y02GSFMO	25				1	0
1114#Taj1E4D3Z3Y02GBUIY	15				1	0
2389#Tax1E4D3Z3Y02HNI49	17				0	2
3657#Tax1E4D3Z3Y02HI3VM	16				0	2
4497#Tax1E4D3Z3Y02IBDCS	18				0	1
239#Taj1E4D3Z3Y02GSAHE	21				76	0
2635#Tax1E4D3Z3Y02GFQL1	25				0	1
122#Taj1E4D3Z3Y02JMODN	25				3	0
269#Taj1E4D3Z3Y02H5P63	17				1	0
878#Taj1E4D3Z3Y02GFJUW	14				2	0
2277#Tax1E4D3Z3Y02HU7EB	24				0	2
363#Taj1E4D3Z3Y02H4UNM	14				1	0
4264#Tax1E4D3Z3Y02IBGL9	14				0	1
2353#Tax1E4D3Z3Y02FZZ5I	21				0	1
4573#Tax1E4D3Z3Y02IHOM4	17				0	1
3198#Tax1E4D3Z3Y02GV0TP	19				0	1
4140#Tax1E4D3Z3Y02GSB74	15				0	1
3215#Tax1E4D3Z3Y02FJCP4	18				0	1
2159#Tax1E4D3Z3Y02IL0KB	28				0	1
3059#Tax1E4D3Z3Y02JOLBW	13				0	1
4834#Tax1E4D3Z3Y02JO6T0	30				0	1
1449#Tax1E4D3Z3Y02FO7DW	21				0	1
4725#Tax1E4D3Z3Y02I7D11	13				0	1
4538#Tax1E4D3Z3Y02HBKG5	15				0	1
2873#Tax1E4D3Z3Y02G79ZU	24				0	1
4062#Tax1E4D3Z3Y02IKKGW	25				0	1
3591#Tax1E4D3Z3Y02IUKSU	24				0	1
1314#Tax1E4D3Z3Y02JLM16	14				0	1
2748#Tax1E4D3Z3Y02JXWRF	18				0	1
1798#Tax1E4D3Z3Y02JULFQ	13				0	1
2535#Tax1E4D3Z3Y02G3ML1	15				0	1
522#Taj1E4D3Z3Y02H39T0	16				1	0
1632#Tax1E4D3Z3Y02GYG20	19				0	1
1423#Tax1E4D3Z3Y02G4CK9	13				0	1
3352#Tax1E4D3Z3Y02IAHKW	14				0	1
2412#Tax1E4D3Z3Y02IF0G5	24				0	1
667#Taj1E4D3Z3Y02F9CB0	23				1	0
1280#Tax1E4D3Z3Y02GZMN7	20				0	1
313#Taj1E4D3Z3Y02GUH9N	24				2	0
2017#Tax1E4D3Z3Y02IGPRF	13				0	1
4322#Tax1E4D3Z3Y02JUTX7	15				0	1
4031#Tax1E4D3Z3Y02JXY92	24				0	1
3023#Tax1E4D3Z3Y02GKHJQ	17				0	1
2884#Tax1E4D3Z3Y02JHZPT	14				0	2
2661#Tax1E4D3Z3Y02HRNPQ	14				0	1
3841#Tax1E4D3Z3Y02IY9V9	24				0	1
1324#Tax1E4D3Z3Y02GRNLD	25				0	1
3077#Tax1E4D3Z3Y02IDG9X	14				0	1
3305#Tax1E4D3Z3Y02F3A5X	23				0	1
3433#Tax1E4D3Z3Y02HJA0U	16				0	1
4202#Tax1E4D3Z3Y02HDK09	16				0	1
3477#Tax1E4D3Z3Y02JZMQF	13				0	1
459#Taj1E4D3Z3Y02GDZRN	29				1	0
4267#Tax1E4D3Z3Y02H5Z0Y	14				0	1
3715#Tax1E4D3Z3Y02HOC41	24				0	1
1495#Tax1E4D3Z3Y02HRG3M	27				0	1
1753#Tax1E4D3Z3Y02HAJUL	27				0	2
3187#Tax1E4D3Z3Y02H2HWA	20				0	1
2688#Tax1E4D3Z3Y02HGDFU	24				0	1
4367#Tax1E4D3Z3Y02IR7A0	18				0	1
2756#Tax1E4D3Z3Y02HTQVS	22				0	1
1919#Tax1E4D3Z3Y02GMTKK	22				0	1
1938#Tax1E4D3Z3Y02GDFQB	21				0	1
4244#Tax1E4D3Z3Y02JZHIA	13				0	1
3107#Tax1E4D3Z3Y02IT1M9	23				0	1
3441#Tax1E4D3Z3Y02H0F4V	25				0	1
404#Taj1E4D3Z3Y02IIJ5C	24				2	0
516#Taj1E4D3Z3Y02GV76Q	20				1	0
1813#Tax1E4D3Z3Y02GL851	17				0	1
2004#Tax1E4D3Z3Y02HJEYW	27				0	1
4754#Tax1E4D3Z3Y02FNS93	14				0	1
3861#Tax1E4D3Z3Y02J0140	20				0	1
702#Taj1E4D3Z3Y02IP1RZ	17				1	0
2297#Tax1E4D3Z3Y02HFSA0	22				0	1
4383#Tax1E4D3Z3Y02JD2W6	16				0	1
2163#Tax1E4D3Z3Y02GJURT	17				0	1
2214#Tax1E4D3Z3Y02HTWFW	23				0	1
357#Taj1E4D3Z3Y02F13IG	21				4	0
4679#Tax1E4D3Z3Y02GZ0T5	27				0	1
3236#Tax1E4D3Z3Y02GIAYT	24				0	1
4008#Tax1E4D3Z3Y02FIMQ2	23				0	1
1941#Tax1E4D3Z3Y02HCQ0E	17				0	1
2826#Tax1E4D3Z3Y02GF36K	18				0	1
455#Taj1E4D3Z3Y02GMRLI	16				2	0
4472#Tax1E4D3Z3Y02JU5AF	16				0	1
2132#Tax1E4D3Z3Y02H67KM	24				0	1
3181#Tax1E4D3Z3Y02IQJ5P	24				0	1
2612#Tax1E4D3Z3Y02HUM37	16				0	1
3751#Tax1E4D3Z3Y02GY5M4	13				0	1
2272#Tax1E4D3Z3Y02HTSC0	22				0	1
1889#Tax1E4D3Z3Y02IQC7U	30				0	1
2692#Tax1E4D3Z3Y02JA57D	26				0	1
2646#Tax1E4D3Z3Y02IJ959	17				0	1
10#Taj1E4D3Z3Y02JLZLH	28				1	0
4762#Tax1E4D3Z3Y02H6JTY	15				0	1
550#Taj1E4D3Z3Y02JXZHR	24				1	0
2083#Tax1E4D3Z3Y02HXCBU	21				0	5
1081#Taj1E4D3Z3Y02JSPZH	16				1	0
4769#Tax1E4D3Z3Y02I2NZD	25				0	1
1736#Tax1E4D3Z3Y02I1EB1	16				0	2
958#Taj1E4D3Z3Y02GD37S	21				2	0
3299#Tax1E4D3Z3Y02I3MR4	24				0	1
592#Taj1E4D3Z3Y02HEICM	17				1	0
4111#Tax1E4D3Z3Y02HVB7O	16				0	1
4420#Tax1E4D3Z3Y02I3CVR	21				0	1
1978#Tax1E4D3Z3Y02IB4IN	24				0	1
2364#Tax1E4D3Z3Y02GQR5V	18				0	1
1640#Tax1E4D3Z3Y02GEHHA	24				0	1
4118#Tax1E4D3Z3Y02ISWER	21				0	1
173#Taj1E4D3Z3Y02F8GYV	19				1	0
66#Taj1E4D3Z3Y02G07WI	15				1	0
2709#Tax1E4D3Z3Y02G5AXE	16				0	1
2026#Tax1E4D3Z3Y02IM0UH	23				0	1
3130#Tax1E4D3Z3Y02II480	29				0	1
793#Taj1E4D3Z3Y02JI2DR	21				10	0
1205#Taj1E4D3Z3Y02F1CET	24				1	0
1696#Tax1E4D3Z3Y02H7R1G	24				0	1
3168#Tax1E4D3Z3Y02JF61X	28				0	1
3674#Tax1E4D3Z3Y02H0WFJ	24				0	1
3469#Tax1E4D3Z3Y02IMDJT	13				0	1
3625#Tax1E4D3Z3Y02HLSTF	20				0	1
59#Taj1E4D3Z3Y02HOKRZ	26				1	0
4572#Tax1E4D3Z3Y02J0SK9	18				0	1
4728#Tax1E4D3Z3Y02HDNFL	13				0	1
3388#Tax1E4D3Z3Y02HGO4Y	24				0	1
4546#Tax1E4D3Z3Y02IPRN5	22				0	1
3329#Tax1E4D3Z3Y02IPTKJ	14				0	1
2091#Tax1E4D3Z3Y02J4UTG	13				0	1
1971#Tax1E4D3Z3Y02FR2FP	24				0	1
4161#Tax1E4D3Z3Y02JG0NO	27				0	1
2358#Tax1E4D3Z3Y02JWMTR	18				0	1
1226#Tax1E4D3Z3Y02G5ITC	15				0	1
2498#Tax1E4D3Z3Y02IYUBF	21				0	3
1256#Tax1E4D3Z3Y02JDCX9	21				0	4
1949#Tax1E4D3Z3Y02GZ4B2	23				0	1
2247#Tax1E4D3Z3Y02JJ223	13				0	1
1853#Tax1E4D3Z3Y02HDJ3Q	25				0	1
219#Taj1E4D3Z3Y02I9Z0P	15				1	0
1016#Taj1E4D3Z3Y02IK57F	18				1	0
2480#Tax1E4D3Z3Y02J0BPY	19				0	1
2300#Tax1E4D3Z3Y02HQTVS	20				0	1
3734#Tax1E4D3Z3Y02H511J	16				0	1
799#Taj1E4D3Z3Y02JUSWF	14				1	0
925#Taj1E4D3Z3Y02G160J	24				1	0
390#Taj1E4D3Z3Y02GD427	16				1	0
3357#Tax1E4D3Z3Y02IJBX3	16				0	1
2368#Tax1E4D3Z3Y02GBN5E	17				0	1
1515#Tax1E4D3Z3Y02GR6LQ	21				0	1
1955#Tax1E4D3Z3Y02JMLI9	17				0	1
945#Taj1E4D3Z3Y02ITSB5	17				1	0
2784#Tax1E4D3Z3Y02IL7EQ	16				0	1
206#Taj1E4D3Z3Y02JOLSM	23				1	0
959#>Taj1E4D3Z3Y02IF6O5	22				2	0
3791#Tax1E4D3Z3Y02I48P1	21				0	1
3194#Tax1E4D3Z3Y02JLCC5	17				0	2
358#Taj1E4D3Z3Y02IG5IR	15				3	0
331#Taj1E4D3Z3Y02JYW5P	29				1	0
3606#Tax1E4D3Z3Y02H5CGC	24				0	1
2746#Tax1E4D3Z3Y02G8DL4	24				0	1
737#Taj1E4D3Z3Y02J5YPH	13				2	0
4338#Tax1E4D3Z3Y02HY5GA	21				0	1
3037#Tax1E4D3Z3Y02F3PD4	30				0	1
2228#Tax1E4D3Z3Y02JB778	15				0	1
2070#Tax1E4D3Z3Y02HFS61	13				0	2
4112#Tax1E4D3Z3Y02I0PZ2	21				0	1
3830#Tax1E4D3Z3Y02H826B	24				0	1
4336#Tax1E4D3Z3Y02IY8K1	14				0	1
220#Taj1E4D3Z3Y02J267D	24				1	0
1312#Tax1E4D3Z3Y02GR48U	25				0	1
4473#Tax1E4D3Z3Y02JV4GJ	22				0	1
2365#Tax1E4D3Z3Y02H72P4	22				0	1
1263#Tax1E4D3Z3Y02J277W	19				0	6
4612#Tax1E4D3Z3Y02JIMD4	16				0	1
4170#Tax1E4D3Z3Y02H4RB9	21				0	1
4017#Tax1E4D3Z3Y02G9HKE	30				0	1
3811#Tax1E4D3Z3Y02G3ZVE	26				0	1
572#Taj1E4D3Z3Y02I1FDR	14				1	0
3762#Tax1E4D3Z3Y02JMXD3	17				0	1
3984#Tax1E4D3Z3Y02J2DM3	15				0	1
4159#Tax1E4D3Z3Y02JK2NI	17				0	1
3795#Tax1E4D3Z3Y02I51A1	24				0	1
2549#Tax1E4D3Z3Y02IHO5H	16				0	1
1448#Tax1E4D3Z3Y02HJSHC	20				0	3
3146#Tax1E4D3Z3Y02HRZ4T	21				0	3
3684#Tax1E4D3Z3Y02G7IGV	24				0	1
1472#Tax1E4D3Z3Y02HQTY1	18				0	1
1573#Tax1E4D3Z3Y02FV1UU	24				0	1
2020#Tax1E4D3Z3Y02G7L1I	24				0	1
3770#Tax1E4D3Z3Y02ID4D1	16				0	1
3524#Tax1E4D3Z3Y02J29FM	16				0	1
4485#Tax1E4D3Z3Y02JM4SV	24				0	1
2622#Tax1E4D3Z3Y02IOFNU	18				0	1
3725#Tax1E4D3Z3Y02IJSSQ	24				0	1
2799#Tax1E4D3Z3Y02I1UFR	13				0	1
1772#Tax1E4D3Z3Y02H6MWE	28				0	1
418#Taj1E4D3Z3Y02IXUJP	26				4	0
2324#Tax1E4D3Z3Y02I3DWL	16				0	1
4466#Tax1E4D3Z3Y02IGLHV	22				0	1
4174#Tax1E4D3Z3Y02JJT1V	20				0	1
933#Taj1E4D3Z3Y02GBHKD	24				1	0
2217#Tax1E4D3Z3Y02HPCN0	15				0	1
2333#Tax1E4D3Z3Y02HB2MJ	24				0	1
348#Taj1E4D3Z3Y02F8BVO	24				2	0
2052#Tax1E4D3Z3Y02H6TA1	19				0	1
4785#Tax1E4D3Z3Y02JQ9QV	15				0	1
2868#Tax1E4D3Z3Y02FU6TQ	29				0	1
4496#Tax1E4D3Z3Y02JHTDT	20				0	1
993#Taj1E4D3Z3Y02GTI58	22				1	0
627#Taj1E4D3Z3Y02HWI4I	24				1	0
1090#Taj1E4D3Z3Y02JCHF6	23				2	0
1308#Tax1E4D3Z3Y02IL5TD	21				0	1
2503#Tax1E4D3Z3Y02JGXIG	20				0	1
4100#Tax1E4D3Z3Y02H14LM	16				0	1
4458#Tax1E4D3Z3Y02GQHWE	27				0	1
388#Taj1E4D3Z3Y02J4BFV	14				1	0
1425#Tax1E4D3Z3Y02GJDG7	15				0	4
4826#Tax1E4D3Z3Y02JI02R	13				0	1
4190#Tax1E4D3Z3Y02G3YMY	13				0	1
3083#Tax1E4D3Z3Y02HHU7D	25				0	1
1842#Tax1E4D3Z3Y02GLQX2	25				0	1
485#Taj1E4D3Z3Y02H16VA	14				1	0
2143#Tax1E4D3Z3Y02HETF5	20				0	1
3316#Tax1E4D3Z3Y02JFFEC	22				0	1
3881#Tax1E4D3Z3Y02JDTJ3	24				0	1
1270#Tax1E4D3Z3Y02FUT8Y	15				0	1
1645#Tax1E4D3Z3Y02IR7PJ	24				0	1
3508#Tax1E4D3Z3Y02JBSBU	24				0	1
1389#Tax1E4D3Z3Y02HAQRH	16				0	1
324#Taj1E4D3Z3Y02IZJKU	18				1	0
637#Taj1E4D3Z3Y02I211B	25				1	0
2066#Tax1E4D3Z3Y02JNZNA	15				0	1
4223#Tax1E4D3Z3Y02HJ0HZ	21				0	1
2679#Tax1E4D3Z3Y02IS1CB	22				0	1
752#Taj1E4D3Z3Y02I1Q56	14				1	0
1232#Tax1E4D3Z3Y02HZUQ2	24				0	1
2899#Tax1E4D3Z3Y02IWL34	20				0	1
3045#Tax1E4D3Z3Y02HSDCC	19				0	1
2941#Tax1E4D3Z3Y02G8KAQ	15				0	2
379#Taj1E4D3Z3Y02FPG6X	17				1	0
3404#Tax1E4D3Z3Y02H1MDX	14				0	1
1639#Tax1E4D3Z3Y02IZMGU	15				0	1
3872#Tax1E4D3Z3Y02JJ3AV	17				0	1
1035#Taj1E4D3Z3Y02I2X5O	18				1	0
3367#Tax1E4D3Z3Y02F25VG	24				0	1
3964#Tax1E4D3Z3Y02HLRB5	26				0	1
1894#Tax1E4D3Z3Y02HX7JQ	15				0	1
535#Taj1E4D3Z3Y02HWHF6	24				1	0
3138#Tax1E4D3Z3Y02JTN9Z	14				0	1
683#Taj1E4D3Z3Y02JIYRK	14				1	0
2260#Tax1E4D3Z3Y02IR3PS	23				0	1
1215#Tax1E4D3Z3Y02G5APB	22				0	1
4378#Tax1E4D3Z3Y02H1SID	14				0	1
3886#Tax1E4D3Z3Y02I6Q90	20				0	1
2995#Tax1E4D3Z3Y02JML9D	17				0	1
1712#Tax1E4D3Z3Y02G6KGH	16				0	1
2344#Tax1E4D3Z3Y02ITVF4	22				0	1
765#Taj1E4D3Z3Y02GYGAJ	14				1	0
2552#Tax1E4D3Z3Y02HZXWO	24				0	1
2521#Tax1E4D3Z3Y02HCADO	30				0	1
312#Taj1E4D3Z3Y02J4HO0	21				1	0
2435#Tax1E4D3Z3Y02HNKCT	25				0	6
4452#Tax1E4D3Z3Y02ISU6E	24				0	1
1002#Taj1E4D3Z3Y02HZVM7	20				2	0
4837#Tax1E4D3Z3Y02I7XGI	15				0	1
370#Taj1E4D3Z3Y02F84T5	17				9	0
3398#Tax1E4D3Z3Y02JQSO6	22				0	1
567#Taj1E4D3Z3Y02F03BF	18				1	0
3749#Tax1E4D3Z3Y02GSO2Q	21				0	1
3115#Tax1E4D3Z3Y02JLIO4	22				0	1
380#Taj1E4D3Z3Y02IVS0S	20				1	0
3206#Tax1E4D3Z3Y02HPP1W	19				0	1
1279#Tax1E4D3Z3Y02GE6WI	23				0	1
965#Taj1E4D3Z3Y02H0ROG	23				1	0
2974#Tax1E4D3Z3Y02J0ZW7	21				0	1
2079#Tax1E4D3Z3Y02H14PE	21				0	2
1395#Tax1E4D3Z3Y02IWNLS	18				0	1
286#Taj1E4D3Z3Y02JY7NN	26				2	0
1075#Taj1E4D3Z3Y02IG0DR	16				2	0
2426#Tax1E4D3Z3Y02GGK7N	22				0	1
800#Taj1E4D3Z3Y02HT8KY	14				1	0
3125#Tax1E4D3Z3Y02HR4KJ	24				0	1
1365#Tax1E4D3Z3Y02INUYQ	19				0	1
4469#Tax1E4D3Z3Y02F920G	14				0	2
3613#Tax1E4D3Z3Y02JSR7Q	18				0	1
1779#Tax1E4D3Z3Y02GXUET	24				0	1
4563#Tax1E4D3Z3Y02JGSWV	14				0	1
1568#Tax1E4D3Z3Y02ISFPX	19				0	1
607#Taj1E4D3Z3Y02HW0W1	15				1	0
1807#Tax1E4D3Z3Y02GJG1C	20				0	1
2902#Tax1E4D3Z3Y02H9NTA	24				0	1
3093#Tax1E4D3Z3Y02IQ2FS	21				0	1
2508#Tax1E4D3Z3Y02IFQH5	17				0	1
1073#Taj1E4D3Z3Y02HMNFM	21				1	0
2187#Tax1E4D3Z3Y02HBSHM	22				0	1
3399#Tax1E4D3Z3Y02HS2SG	21				0	1
3860#Tax1E4D3Z3Y02I5E2R	17				0	1
2844#Tax1E4D3Z3Y02IQOKN	20				0	1
3575#Tax1E4D3Z3Y02FRRBO	23				0	1
816#Taj1E4D3Z3Y02GESNR	13				1	0
3031#>Tax1E4D3Z3Y02JSST4	17				0	1
4260#Tax1E4D3Z3Y02GDMDG	19				0	1
4010#Tax1E4D3Z3Y02JDIXN	17				0	1
3159#Tax1E4D3Z3Y02JKT35	28				0	1
1062#Taj1E4D3Z3Y02HBMK3	19				1	0
3112#Tax1E4D3Z3Y02JISW1	17				0	1
3169#Tax1E4D3Z3Y02IT2IK	15				0	1
1700#Tax1E4D3Z3Y02HKTZR	21				0	1
2609#Tax1E4D3Z3Y02JZBQ9	17				0	1
4240#Tax1E4D3Z3Y02F9R3G	17				0	1
3261#Tax1E4D3Z3Y02GPRQ2	21				0	1
445#Taj1E4D3Z3Y02FYQ89	22				1	0
2131#Tax1E4D3Z3Y02JSRKE	23				0	2
1339#Tax1E4D3Z3Y02HX85L	24				0	1
4002#Tax1E4D3Z3Y02HZMWD	17				0	1
2338#Tax1E4D3Z3Y02HRAIB	17				0	1
3866#Tax1E4D3Z3Y02H0RGS	28				0	1
4741#Tax1E4D3Z3Y02INLBL	23				0	1
3781#Tax1E4D3Z3Y02GJC1Z	25				0	1
2120#Tax1E4D3Z3Y02I3K8U	28				0	1
4603#Tax1E4D3Z3Y02G8HTS	26				0	1
1858#Tax1E4D3Z3Y02F37EI	22				0	1
4636#Tax1E4D3Z3Y02F9PJI	18				0	1
718#Taj1E4D3Z3Y02GPHV2	22				2	0
2147#Tax1E4D3Z3Y02GS6P7	26				0	1
1581#Tax1E4D3Z3Y02GS2G7	22				0	1
3997#Tax1E4D3Z3Y02H87T4	13				0	1
1507#Tax1E4D3Z3Y02IMVZC	14				0	1
1604#Tax1E4D3Z3Y02JY3X0	22				0	1
4689#Tax1E4D3Z3Y02IAQTP	14				0	1
868#Taj1E4D3Z3Y02GPK2R	25				2	0
4592#Tax1E4D3Z3Y02IOWO3	20				0	1
4096#Tax1E4D3Z3Y02HD8FV	23				0	1
4736#Tax1E4D3Z3Y02H0100	17				0	1
1140#Taj1E4D3Z3Y02F274A	26				1	0
3417#Tax1E4D3Z3Y02F8GJF	14				0	1
275#Taj1E4D3Z3Y02HIQJK	24				1	0
2035#Tax1E4D3Z3Y02IHGVZ	16				0	1
197#Taj1E4D3Z3Y02HPSPQ	15				1	0
3626#Tax1E4D3Z3Y02H82S0	22				0	1
3314#Tax1E4D3Z3Y02JSB0X	18				0	1
2208#Tax1E4D3Z3Y02IUAJO	14				0	1
4459#Tax1E4D3Z3Y02JCUG8	17				0	2
1731#Tax1E4D3Z3Y02GLEL2	13				0	1
4024#Tax1E4D3Z3Y02HDALC	30				0	1
853#Taj1E4D3Z3Y02GF9VW	16				4	0
1500#Tax1E4D3Z3Y02H6UBY	24				0	2
4275#Tax1E4D3Z3Y02GR13K	27				0	1
4812#Tax1E4D3Z3Y02G7TJM	15				0	1
4393#Tax1E4D3Z3Y02HFXZP	16				0	1
2136#Tax1E4D3Z3Y02HFH67	20				0	1
4103#Tax1E4D3Z3Y02JKY2I	20				0	1
4175#Tax1E4D3Z3Y02IFYTH	14				0	1
2685#Tax1E4D3Z3Y02JVQ34	19				0	1
4073#Tax1E4D3Z3Y02IGO13	18				0	1
3517#Tax1E4D3Z3Y02GNTH6	24				0	1
3410#Tax1E4D3Z3Y02HLTKO	21				0	1
3028#Tax1E4D3Z3Y02H5QPD	25				0	1
1295#Tax1E4D3Z3Y02IXS2D	21				0	1
3978#Tax1E4D3Z3Y02IPLDF	24				0	2
2832#Tax1E4D3Z3Y02GX135	23				0	4
1111#Taj1E4D3Z3Y02IN06S	27				1	0
3281#Tax1E4D3Z3Y02G9E6Q	28				0	1
3249#Tax1E4D3Z3Y02G437Q	17				0	4
4055#Tax1E4D3Z3Y02FOIC9	27				0	1
3271#Tax1E4D3Z3Y02HX0JL	19				0	1
4608#Tax1E4D3Z3Y02HA66N	14				0	1
2238#Tax1E4D3Z3Y02I3IO7	28				0	1
1878#Tax1E4D3Z3Y02JNF3Q	15				0	1
2388#Tax1E4D3Z3Y02G4U3U	24				0	1
4807#Tax1E4D3Z3Y02I8DVU	27				0	1
2938#Tax1E4D3Z3Y02JBADV	20				0	1
2964#Tax1E4D3Z3Y02GPE17	20				0	1
1690#Tax1E4D3Z3Y02GRD2V	20				0	1
3915#Tax1E4D3Z3Y02JMROL	20				0	2
4516#Tax1E4D3Z3Y02ITJLM	25				0	1
617#Taj1E4D3Z3Y02G2FWU	18				1	0
3943#Tax1E4D3Z3Y02GYAPC	28				0	1
4136#Tax1E4D3Z3Y02HAT0H	26				0	1
4061#Tax1E4D3Z3Y02HKQZH	23				0	1
3801#Tax1E4D3Z3Y02H88LM	21				0	1
2918#Tax1E4D3Z3Y02IINLT	21				0	1
3821#Tax1E4D3Z3Y02IRB8D	27				0	1
1594#Tax1E4D3Z3Y02IY46V	21				0	4
251#Taj1E4D3Z3Y02F59ZR	15				1	0
369#Taj1E4D3Z3Y02HW54F	22				1	0
1548#Tax1E4D3Z3Y02G7BRY	21				0	2
3900#Tax1E4D3Z3Y02H63QR	21				0	1
4053#Tax1E4D3Z3Y02JRNXV	20				0	1
1823#Tax1E4D3Z3Y02I1NNP	24				0	1
2537#Tax1E4D3Z3Y02JX82G	24				0	1
2267#Tax1E4D3Z3Y02GUJW3	19				0	1
887#Taj1E4D3Z3Y02JUPVW	16				1	0
72#Taj1E4D3Z3Y02F8R84	15				1	0
3371#Tax1E4D3Z3Y02JSX8G	21				0	1
1496#Tax1E4D3Z3Y02IW7JH	14				0	1
1682#Tax1E4D3Z3Y02IWHBK	24				0	1
2781#Tax1E4D3Z3Y02HQ743	19				0	1
1108#Taj1E4D3Z3Y02H1YMA	17				1	0
2282#Tax1E4D3Z3Y02JRTYM	24				0	1
1014#Taj1E4D3Z3Y02JEZ15	20				1	0
2760#Tax1E4D3Z3Y02JV8PE	24				0	1
843#Taj1E4D3Z3Y02IWRH9	14				2	0
2529#Tax1E4D3Z3Y02ISXHR	27				0	1
2315#Tax1E4D3Z3Y02I84VS	24				0	1
4677#Tax1E4D3Z3Y02JUB0K	16				0	1
2257#Tax1E4D3Z3Y02HHTR0	14				0	1
610#Taj1E4D3Z3Y02F0TM6	21				5	0
514#Taj1E4D3Z3Y02FYBC5	22				1	0
3973#Tax1E4D3Z3Y02HXRDZ	21				0	1
2444#Tax1E4D3Z3Y02IGXEM	18				0	1
3921#Tax1E4D3Z3Y02H9FXF	15				0	1
725#Taj1E4D3Z3Y02IQF6M	24				1	0
4088#Tax1E4D3Z3Y02JE52Z	17				0	1
4290#Tax1E4D3Z3Y02GOMVZ	14				0	1
1994#Tax1E4D3Z3Y02GF2VY	14				0	1
3252#Tax1E4D3Z3Y02IM8SA	17				0	1
3907#Tax1E4D3Z3Y02G6SAG	16				0	1
3857#Tax1E4D3Z3Y02FPDP8	16				0	1
4048#Tax1E4D3Z3Y02HZH5D	17				0	1
1136#Taj1E4D3Z3Y02GWM67	14				1	0
4183#Tax1E4D3Z3Y02IK501	30				0	1
1175#Taj1E4D3Z3Y02GKPR3	18				1	0
4011#Tax1E4D3Z3Y02IWRZ2	24				0	1
1683#Tax1E4D3Z3Y02F2731	28				0	1
1326#Tax1E4D3Z3Y02H7NAG	25				0	2
3714#Tax1E4D3Z3Y02IBR14	19				0	1
1382#Tax1E4D3Z3Y02GDF6B	13				0	2
1452#Tax1E4D3Z3Y02GAAA9	22				0	1
2384#Tax1E4D3Z3Y02GVY9S	20				0	1
2637#Tax1E4D3Z3Y02HV2SQ	24				0	1
589#Taj1E4D3Z3Y02HB4IK	20				1	0
1337#Tax1E4D3Z3Y02HE6S5	17				0	1
3101#Tax1E4D3Z3Y02GEAVJ	27				0	1
2098#Tax1E4D3Z3Y02HOITH	21				0	1
3837#Tax1E4D3Z3Y02HUDN8	26				0	1
150#Taj1E4D3Z3Y02FVPJI	17				1	0
3018#Tax1E4D3Z3Y02IEHAH	22				0	1
245#Taj1E4D3Z3Y02IZZSP	19				4	0
2604#Tax1E4D3Z3Y02J3CA6	18				0	1
2511#Tax1E4D3Z3Y02JKGE3	23				0	1
2546#Tax1E4D3Z3Y02JV78G	19				0	1
3012#Tax1E4D3Z3Y02G3MJ9	29				0	1
2666#Tax1E4D3Z3Y02JVPDR	22				0	1
332#Taj1E4D3Z3Y02I0Z9U	20				2	0
3599#Tax1E4D3Z3Y02JQ1Z8	16				0	2
1099#Taj1E4D3Z3Y02GHRYR	26				2	0
1965#Tax1E4D3Z3Y02IR4HR	24				0	1
745#Taj1E4D3Z3Y02I9ZD3	16				2	0
34#Taj1E4D3Z3Y02HWI1Q	16				4	0
3691#Tax1E4D3Z3Y02HWAVM	22				0	1
3650#Tax1E4D3Z3Y02JMNAO	17				0	2
2656#Tax1E4D3Z3Y02HGVFQ	21				0	1
2082#Tax1E4D3Z3Y02JZ9SM	13				0	1
3056#Tax1E4D3Z3Y02FWE66	15				0	1
2613#Tax1E4D3Z3Y02JC0Y5	18				0	1
1410#Tax1E4D3Z3Y02IMZR7	17				0	1
3789#Tax1E4D3Z3Y02J1OK5	18				0	1
2693#Tax1E4D3Z3Y02FY4WR	24				0	2
1434#Tax1E4D3Z3Y02I03EF	24				0	1
4449#Tax1E4D3Z3Y02I5DAA	13				0	1
2713#Tax1E4D3Z3Y02JE9IO	13				0	1
4182#Tax1E4D3Z3Y02G1E9V	14				0	1
3457#Tax1E4D3Z3Y02HGR7O	24				0	1
2471#Tax1E4D3Z3Y02I26LW	19				0	1
1547#Tax1E4D3Z3Y02FZP4N	24				0	1
1045#Taj1E4D3Z3Y02JVL00	25				1	0
1619#Tax1E4D3Z3Y02F73ZN	24				0	1
4265#Tax1E4D3Z3Y02I1UMG	20				0	1
1069#Taj1E4D3Z3Y02JPLS5	17				1	0
1224#Tax1E4D3Z3Y02F5TQT	18				0	1
368#Taj1E4D3Z3Y02ILXBL	21				12	0
4007#Tax1E4D3Z3Y02HPMT7	20				0	1
3078#Tax1E4D3Z3Y02JNFMP	14				0	1
4705#Tax1E4D3Z3Y02G5PYN	28				0	1
611#Taj1E4D3Z3Y02FU6ZE	22				1	0
1849#Tax1E4D3Z3Y02FWCE5	25				0	2
849#Taj1E4D3Z3Y02I7TBC	17				6	0
4680#Tax1E4D3Z3Y02F8ESZ	14				0	1
492#Taj1E4D3Z3Y02HJB5Y	16				3	0
2740#Tax1E4D3Z3Y02J4WAF	24				0	1
208#Taj1E4D3Z3Y02GSWQD	18				1	0
2271#Tax1E4D3Z3Y02IN3IB	21				0	1
3225#Tax1E4D3Z3Y02HZK4S	16				0	1
2773#Tax1E4D3Z3Y02GUPYI	21				0	1
292#Taj1E4D3Z3Y02F5SQC	26				1	0
4039#Tax1E4D3Z3Y02HL2OQ	27				0	1
2445#Tax1E4D3Z3Y02HZ1KC	24				0	1
291#Taj1E4D3Z3Y02GBLJ3	19				1	0
3703#Tax1E4D3Z3Y02I83Z9	24				0	2
3071#Tax1E4D3Z3Y02F9QWZ	19				0	1
3272#Tax1E4D3Z3Y02JEZ7S	22				0	1
114#Taj1E4D3Z3Y02JAGGK	23				1	0
1939#Tax1E4D3Z3Y02I32US	13				0	1
73#Taj1E4D3Z3Y02H31U2	14				1	0
3335#Tax1E4D3Z3Y02H7I3S	22				0	1
67#Taj1E4D3Z3Y02F89SJ	24				1	0
3636#Tax1E4D3Z3Y02I4GYV	16				0	1
241#Taj1E4D3Z3Y02H90FS	21				1	0
3133#Tax1E4D3Z3Y02G05J2	16				0	1
2561#Tax1E4D3Z3Y02IQ3QM	17				0	1
327#Taj1E4D3Z3Y02HL0Z2	26				1	0
1970#Tax1E4D3Z3Y02GN0JM	25				0	1
4697#Tax1E4D3Z3Y02GR875	21				0	1
2391#Tax1E4D3Z3Y02JDIJS	23				0	1
4125#Tax1E4D3Z3Y02GQMAB	14				0	1
4559#Tax1E4D3Z3Y02JMJQV	22				0	1
1281#Tax1E4D3Z3Y02HI7W9	21				0	1
1864#Tax1E4D3Z3Y02GNP3H	28				0	2
3214#Tax1E4D3Z3Y02JPD9A	17				0	3
4554#Tax1E4D3Z3Y02IEM5N	20				0	1
3675#Tax1E4D3Z3Y02GV10Z	16				0	1
4765#Tax1E4D3Z3Y02G3UF2	21				0	1
3491#Tax1E4D3Z3Y02JUEQ0	21				0	1
1603#Tax1E4D3Z3Y02G68N9	21				0	2
1881#Tax1E4D3Z3Y02H9ARF	20				0	1
3952#Tax1E4D3Z3Y02IYIEI	14				0	1
4403#Tax1E4D3Z3Y02JZ8RP	13				0	1
2375#Tax1E4D3Z3Y02HISXJ	28				0	1
24#Taj1E4D3Z3Y02JI14I	30				1	0
2759#Tax1E4D3Z3Y02G5X7F	20				0	2
3321#Tax1E4D3Z3Y02HOHR2	25				0	1
2049#Tax1E4D3Z3Y02JKTVY	15				0	1
3197#Tax1E4D3Z3Y02G4PJD	27				0	1
104#Taj1E4D3Z3Y02GU1U8	16				1	0
1558#Tax1E4D3Z3Y02G55Z8	16				0	2
4241#Tax1E4D3Z3Y02HQ95D	28				0	1
3370#Tax1E4D3Z3Y02JNHNL	22				0	1
3493#Tax1E4D3Z3Y02JQXZV	13				0	1
4371#Tax1E4D3Z3Y02ICW9N	24				0	1
2175#Tax1E4D3Z3Y02GGNF6	16				0	1
1513#Tax1E4D3Z3Y02GCAGX	18				0	1
1264#Tax1E4D3Z3Y02IOIAG	16				0	1
4468#Tax1E4D3Z3Y02F0740	24				0	1
747#Taj1E4D3Z3Y02H251I	18				1	0
159#Taj1E4D3Z3Y02H16HJ	14				6	0
1633#Tax1E4D3Z3Y02GF1GB	27				0	1
47#Taj1E4D3Z3Y02GHKLV	17				1	0
4540#Tax1E4D3Z3Y02GTVQC	23				0	1
1427#Tax1E4D3Z3Y02G4WWC	24				0	1
1942#Tax1E4D3Z3Y02I7HF1	15				0	1
1484#Tax1E4D3Z3Y02HGFA2	23				0	1
4217#Tax1E4D3Z3Y02ILMEH	16				0	2
3619#Tax1E4D3Z3Y02I6DW3	15				0	1
1017#Taj1E4D3Z3Y02HQDSL	23				1	0
2042#Tax1E4D3Z3Y02G7XQX	27				0	1
1057#Taj1E4D3Z3Y02IC3WS	16				1	0
3748#Tax1E4D3Z3Y02JKSH3	21				0	1
538#Taj1E4D3Z3Y02I8ALS	25				1	0
4711#Tax1E4D3Z3Y02I8LRD	17				0	1
521#Taj1E4D3Z3Y02G7D8Y	29				1	0
1923#Tax1E4D3Z3Y02HOOVZ	24				0	2
162#Taj1E4D3Z3Y02GFGGO	16				1	0
880#Taj1E4D3Z3Y02GBUJY	17				1	0
433#Taj1E4D3Z3Y02F0CSQ	24				2	0
3461#Tax1E4D3Z3Y02GQTOE	19				0	1
2164#Tax1E4D3Z3Y02FYLDH	20				0	1
1912#Tax1E4D3Z3Y02J22LG	15				0	3
3293#Tax1E4D3Z3Y02IWVG0	19				0	1
986#Taj1E4D3Z3Y02G5HME	27				1	0
786#Taj1E4D3Z3Y02HLSYW	14				1	0
1008#Taj1E4D3Z3Y02GL1NE	22				2	0
4530#Tax1E4D3Z3Y02IJV14	15				0	1
3022#Tax1E4D3Z3Y02I42MV	22				0	1
4148#Tax1E4D3Z3Y02HJRXV	18				0	1
4082#Tax1E4D3Z3Y02G0Z6B	22				0	1
201#Taj1E4D3Z3Y02HWQX1	14				1	0
1401#Tax1E4D3Z3Y02GRNUY	20				0	1
4297#Tax1E4D3Z3Y02J4MS1	24				0	1
719#Taj1E4D3Z3Y02GLHUR	16				1	0
4645#Tax1E4D3Z3Y02GL458	21				0	1
1529#Tax1E4D3Z3Y02ILAPW	24				0	1
4305#Tax1E4D3Z3Y02IOQPW	18				0	1
4289#Tax1E4D3Z3Y02IGBQ5	24				0	1
902#Taj1E4D3Z3Y02HTKUO	19				2	0
827#Taj1E4D3Z3Y02FZ9HO	15				1	0
266#Taj1E4D3Z3Y02GPX9F	13				3	0
1353#Tax1E4D3Z3Y02I9SHR	27				0	1
1742#Tax1E4D3Z3Y02GXL9L	23				0	1
3128#Tax1E4D3Z3Y02IEUN4	21				0	1
2585#Tax1E4D3Z3Y02ILQW6	14				0	1
4404#Tax1E4D3Z3Y02HY7CX	14				0	1
1624#Tax1E4D3Z3Y02HMT1D	15				0	1
2892#Tax1E4D3Z3Y02JUG50	15				0	1
4440#Tax1E4D3Z3Y02G2J9E	21				0	1
1695#Tax1E4D3Z3Y02I2QKK	24				0	1
97#Taj1E4D3Z3Y02GOF92	18				1	0
2983#Tax1E4D3Z3Y02I79EC	28				0	1
2378#Tax1E4D3Z3Y02GIY2B	19				0	2
3645#Tax1E4D3Z3Y02FTYYJ	24				0	1
668#Taj1E4D3Z3Y02I6XB4	25				1	0
774#Taj1E4D3Z3Y02GQ2XN	23				1	0
4306#Tax1E4D3Z3Y02IW56N	21				0	1
3463#Tax1E4D3Z3Y02F13JN	30				0	1
910#Taj1E4D3Z3Y02G1OSE	25				2	0
2701#Tax1E4D3Z3Y02GNCGS	24				0	1
1341#Tax1E4D3Z3Y02H7JGW	16				0	1
693#Taj1E4D3Z3Y02IELWZ	19				1	0
4601#Tax1E4D3Z3Y02GV2CS	21				0	1
2684#Tax1E4D3Z3Y02JQIVY	22				0	1
4123#Tax1E4D3Z3Y02JTIXB	22				0	1
3424#Tax1E4D3Z3Y02ISFQO	24				0	2
4799#Tax1E4D3Z3Y02HN9W2	13				0	1
893#Taj1E4D3Z3Y02HNT6L	24				1	0
3979#Tax1E4D3Z3Y02F14IW	15				0	1
2309#Tax1E4D3Z3Y02GO7II	24				0	1
3959#Tax1E4D3Z3Y02HEWP7	15				0	1
4348#Tax1E4D3Z3Y02JBH1E	22				0	1
4414#Tax1E4D3Z3Y02HT15N	27				0	1
2558#Tax1E4D3Z3Y02F45VY	14				0	1
755#Taj1E4D3Z3Y02GUERJ	25				1	0
1085#Taj1E4D3Z3Y02IILND	24				1	0
1714#Tax1E4D3Z3Y02HQG1Z	23				0	1
3942#Tax1E4D3Z3Y02F8NIO	16				0	1
1403#Tax1E4D3Z3Y02IUQEC	21				0	2
2268#Tax1E4D3Z3Y02F0OXW	27				0	1
1497#Tax1E4D3Z3Y02I87DQ	22				0	1
497#Taj1E4D3Z3Y02H5IPR	24				1	0
4236#Tax1E4D3Z3Y02G7KE8	19				0	1
4615#Tax1E4D3Z3Y02HAHY3	13				0	1
169#Taj1E4D3Z3Y02I2NNQ	19				1	0
411#Taj1E4D3Z3Y02JPRQU	21				2	0
2579#Tax1E4D3Z3Y02I0086	20				0	1
398#Taj1E4D3Z3Y02HRR5N	13				5	0
2016#Tax1E4D3Z3Y02HC601	16				0	1
3934#Tax1E4D3Z3Y02IMX9G	15				0	1
3182#Tax1E4D3Z3Y02H4TSW	24				0	1
955#Taj1E4D3Z3Y02F75AP	19				1	0
942#Taj1E4D3Z3Y02GXONR	14				1	0
1376#Tax1E4D3Z3Y02F9TXW	23				0	3
1888#Tax1E4D3Z3Y02GHTF7	17				0	3
3267#Tax1E4D3Z3Y02IKDYC	22				0	1
2369#Tax1E4D3Z3Y02FN2ZU	29				0	1
4119#Tax1E4D3Z3Y02JWWRG	17				0	1
2647#Tax1E4D3Z3Y02JU3TU	30				0	1
190#Taj1E4D3Z3Y02HV1UA	24				1	0
2816#Tax1E4D3Z3Y02GGWZH	22				0	1
1808#Tax1E4D3Z3Y02IMFAX	27				0	1
2802#Tax1E4D3Z3Y02F8PI6	13				0	1
1739#Tax1E4D3Z3Y02HTELP	22				0	1
822#Taj1E4D3Z3Y02HD5MS	20				1	0
601#Taj1E4D3Z3Y02IVF0J	21				1	0
231#Taj1E4D3Z3Y02IWDST	21				5	0
4700#Tax1E4D3Z3Y02HROI3	26				0	1
551#Taj1E4D3Z3Y02J5K49	24				1	0
4720#Tax1E4D3Z3Y02HRDN6	17				0	1
504#Taj1E4D3Z3Y02I4TA0	26				5	0
3753#Tax1E4D3Z3Y02ITJLS	14				0	1
2823#Tax1E4D3Z3Y02GB2QS	24				0	1
3894#Tax1E4D3Z3Y02I4R2W	15				0	1
3177#Tax1E4D3Z3Y02GMRSZ	14				0	1
3387#Tax1E4D3Z3Y02IDZTV	21				0	1
4583#Tax1E4D3Z3Y02HOETI	23				0	1
1966#Tax1E4D3Z3Y02F98UM	15				0	1
1665#Tax1E4D3Z3Y02IO6KL	15				0	1
1782#Tax1E4D3Z3Y02G8QH2	15				0	2
3873#Tax1E4D3Z3Y02JSFP0	24				0	1
2698#Tax1E4D3Z3Y02JNYII	15				0	1
2252#Tax1E4D3Z3Y02H3D9G	23				0	7
2506#Tax1E4D3Z3Y02IIP1Q	17				0	1
3403#Tax1E4D3Z3Y02H3L3J	24				0	1
792#Taj1E4D3Z3Y02IBVBO	16				1	0
3122#Tax1E4D3Z3Y02GPDP6	15				0	1
1248#Tax1E4D3Z3Y02HXQSN	23				0	1
4727#Tax1E4D3Z3Y02HX01V	27				0	1
3368#Tax1E4D3Z3Y02JJH39	24				0	1
3994#Tax1E4D3Z3Y02I9BOP	13				0	1
2401#Tax1E4D3Z3Y02IHWW7	25				0	1
4205#Tax1E4D3Z3Y02JDF4A	26				0	1
3733#Tax1E4D3Z3Y02IXF0A	25				0	1
1516#Tax1E4D3Z3Y02G646H	18				0	1
2462#Tax1E4D3Z3Y02HF8ON	17				0	1
2053#Tax1E4D3Z3Y02JW9NF	24				0	1
924#Taj1E4D3Z3Y02G1DLS	24				1	0
4064#Tax1E4D3Z3Y02GK0MW	24				0	1
2301#Tax1E4D3Z3Y02HBTNM	13				0	1
4775#Tax1E4D3Z3Y02GYNRI	25				0	1
4162#Tax1E4D3Z3Y02H4NC7	16				0	1
2481#Tax1E4D3Z3Y02IPM5M	23				0	1
2027#Tax1E4D3Z3Y02FWN6T	15				0	1
172#Taj1E4D3Z3Y02G2N0O	28				1	0
4045#Tax1E4D3Z3Y02HM7PQ	24				0	1
3922#Tax1E4D3Z3Y02HZGB9	19				0	1
1366#Tax1E4D3Z3Y02GSY48	20				0	1
4252#Tax1E4D3Z3Y02F5RP6	24				0	1
223#Taj1E4D3Z3Y02JK46C	14				1	0
1255#Tax1E4D3Z3Y02F9EDP	24				0	1
1043#Taj1E4D3Z3Y02JNMQS	17				1	0
2660#Tax1E4D3Z3Y02GLPK2	21				0	1
4571#Tax1E4D3Z3Y02GTXEZ	26				0	1
1852#Tax1E4D3Z3Y02JLLKV	24				0	1
3548#Tax1E4D3Z3Y02IDZ1R	27				0	1
3449#Tax1E4D3Z3Y02IFQL5	17				0	2
639#Taj1E4D3Z3Y02IXVGL	16				1	0
1505#Tax1E4D3Z3Y02HIDFQ	17				0	3
2248#Tax1E4D3Z3Y02JNFQP	21				0	1
4746#Tax1E4D3Z3Y02I64UY	14				0	1
2809#Tax1E4D3Z3Y02J2AMG	28				0	1
4844#Tax1E4D3Z3Y02JY9H1	14				0	1
1227#Tax1E4D3Z3Y02IS7X8	21				0	1
1417#Tax1E4D3Z3Y02F7BJ3	18				0	1
216#Taj1E4D3Z3Y02GMOEU	26				1	0
3351#Tax1E4D3Z3Y02HJ9WV	25				0	1
3478#Tax1E4D3Z3Y02IAI4G	14				0	1
3600#Tax1E4D3Z3Y02JH9BQ	23				0	1
1951#Tax1E4D3Z3Y02ISE3Y	14				0	1
2766#Tax1E4D3Z3Y02JSEZR	25				0	1
4032#Tax1E4D3Z3Y02HGEHP	24				0	1
3661#Tax1E4D3Z3Y02GCOT7	15				0	1
2928#Tax1E4D3Z3Y02IG15N	18				0	1
1794#Tax1E4D3Z3Y02G5860	19				0	1
4755#Tax1E4D3Z3Y02H6HAW	16				0	1
2193#Tax1E4D3Z3Y02JFVMT	28				0	1
3522#Tax1E4D3Z3Y02G43NG	20				0	1
2636#Tax1E4D3Z3Y02IYU0C	15				0	1
676#Taj1E4D3Z3Y02IVS56	14				1	0
277#Taj1E4D3Z3Y02IUDJ9	21				16	0
3191#Tax1E4D3Z3Y02JGREN	29				0	1
3306#Tax1E4D3Z3Y02J0SHF	23				0	1
2640#Tax1E4D3Z3Y02G6JFX	14				0	1
2700#Tax1E4D3Z3Y02JTSNA	14				0	1
1183#Taj1E4D3Z3Y02I7QKQ	14				1	0
2747#Tax1E4D3Z3Y02F8YO4	24				0	1
4312#Tax1E4D3Z3Y02GTN11	15				0	1
2215#Tax1E4D3Z3Y02G1SKU	25				0	1
2671#Tax1E4D3Z3Y02HYI73	22				0	1
123#Taj1E4D3Z3Y02JESD0	19				1	0
304#Taj1E4D3Z3Y02H0SC7	17				1	0
2417#Tax1E4D3Z3Y02IHIN9	15				0	2
1631#Tax1E4D3Z3Y02F8J0S	21				0	1
2294#Tax1E4D3Z3Y02GECZE	15				0	1
1369#Tax1E4D3Z3Y02JTWL1	24				0	1
54#Taj1E4D3Z3Y02GHT8M	20				1	0
1151#Taj1E4D3Z3Y02ISC0B	24				1	0
3347#Tax1E4D3Z3Y02IWPBE	25				0	1
1204#Taj1E4D3Z3Y02JKY5Y	24				1	0
839#Taj1E4D3Z3Y02HOD07	20				1	0
2520#Tax1E4D3Z3Y02IUW5H	28				0	1
88#Taj1E4D3Z3Y02JDOUL	26				1	0
1009#Taj1E4D3Z3Y02GKP9J	19				1	0
4825#Tax1E4D3Z3Y02H4TXO	27				0	1
403#Taj1E4D3Z3Y02F3DK2	18				1	0
3438#Tax1E4D3Z3Y02H31RD	15				0	2
1829#Tax1E4D3Z3Y02JYREO	24				0	1
3698#Tax1E4D3Z3Y02H2KCY	16				0	1
1629#Tax1E4D3Z3Y02F34BE	24				0	1
2755#Tax1E4D3Z3Y02IL9XH	24				0	1
1918#Tax1E4D3Z3Y02F4EWZ	24				0	1
3237#Tax1E4D3Z3Y02GOJBP	13				0	2
4197#Tax1E4D3Z3Y02HHFCN	15				0	1
3150#Tax1E4D3Z3Y02IW7X0	21				0	1
4487#Tax1E4D3Z3Y02HU0NP	24				0	1
4678#Tax1E4D3Z3Y02HV1DR	21				0	1
3164#Tax1E4D3Z3Y02GT57B	18				0	2
2729#Tax1E4D3Z3Y02GUINA	15				0	1
703#Taj1E4D3Z3Y02I1ZNJ	23				1	0
4366#Tax1E4D3Z3Y02HN6JG	25				0	1
3454#Tax1E4D3Z3Y02JI0V1	17				0	1
4382#Tax1E4D3Z3Y02J0RE3	20				0	1
3304#Tax1E4D3Z3Y02IN5ZX	15				0	1
2885#Tax1E4D3Z3Y02IY8CX	13				0	1
3106#Tax1E4D3Z3Y02GECYY	16				0	1
2488#Tax1E4D3Z3Y02FYBSO	16				0	1
1461#Tax1E4D3Z3Y02F22CK	13				0	1
2487#Tax1E4D3Z3Y02GITIH	23				0	2
3188#Tax1E4D3Z3Y02GJ651	17				0	1
3869#Tax1E4D3Z3Y02IKJJ7	22				0	1
1985#Tax1E4D3Z3Y02GF2IG	25				0	1
2669#Tax1E4D3Z3Y02JP7YO	14				0	1
1691#Tax1E4D3Z3Y02HV7BS	14				0	1
3567#Tax1E4D3Z3Y02I1ISL	14				0	1
3666#Tax1E4D3Z3Y02HU7NC	30				0	1
2003#Tax1E4D3Z3Y02GXSWO	14				0	1

libraries_with_counts

Format

Show or HideShow perl code used to test libraries_with_counts format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test libraries_with_counts content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetTableRawExpression/test/BIOSGetTableRawExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for libraries_with_counts

<?xml version="1.0"?>
<collection>
  <class count_nr="1206" count_raw="4348" definition="" id="pool1" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="1206" count_raw="4348" definition="Test import BIOS DATA number 1" id="LIBTEST1" key="test_library1" tag="Taj" url=""/>
  </class>
  <class count_nr="3644" count_raw="4263" definition="" id="pool2" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="3644" count_raw="4263" definition="Test import BIOS DATA number 2" id="LIBTEST2" key="test_library2" tag="Tax" url=""/>
  </class>
</collection>
BIOSGetXmlClusterExpression 2017.04.28 02:03:21 Execution time: 18 s.
Show or Hide

BioMOBY

  • URI: bios.dijon.inra.fr
  • Registry: http://moby.toulouse.inra.fr/cgi/MOBY-Central.pl
  • RDF: http://bios.dijon.inra.fr/playmoby/rdf/inra_BIOSGetXmlClusterExpression.rdf
  • Contact: sebastien.carrere@toulouse.inra.fr,jonathan.kreplak@dijon.inra.fr

expression_data

Format

Show or HideShow perl code used to test expression_data format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test expression_data content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for expression_data

<?xml version="1.0"?>
<entry_db accession=""><entry accession="CLUSTERTEST004" confidence="" id="4" length="" locus_tag="" type="" version="" xmlfile="">
  <entry_features accession="CLUSTERTEST004">
    <pattern definition="pool1" type="pool">
      <property id="count" value="0"/>
    </pattern>
    <pattern definition="pool2" type="pool">
      <property id="count" value="0"/>
    </pattern>
    <pattern definition="LIBTEST2" type="additional">
      <property id="TESTPROPERTY [20140916]" value="35"/>
    </pattern>
    <pattern definition="LIBTEST1" type="additional">
      <property id="TESTPROPERTY [20140916]" value="2"/>
    </pattern>
  </entry_features>
</entry>
<entry accession="CLUSTERTEST002" confidence="" id="1" length="79" locus_tag="" type="mRNA" version="20140916" xmlfile="">
  <definition confidence="" id="product" ontology="">IPR000347:Plant metallothionein, family 15;</definition>
  <entry_features accession="CLUSTERTEST002">
    <pattern definition="pool1" type="pool">
      <property id="count" value="0"/>
    </pattern>
    <pattern definition="pool2" type="pool">
      <property id="count" value="10"/>
    </pattern>
    <pattern definition="LIBTEST1" type="additional">
      <property id="TESTPROPERTY [20140916]" value="1"/>
    </pattern>
  </entry_features>
</entry>
<entry accession="CLUSTERTEST001" confidence="" id="3" length="111" locus_tag="" type="mRNA" version="20140916" xmlfile="">
  <definition confidence="" id="product" ontology="">IPR003612:Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor;</definition>
  <entry_features accession="CLUSTERTEST001">
    <pattern definition="pool1" type="pool">
      <property id="count" value="40"/>
    </pattern>
    <pattern definition="pool2" type="pool">
      <property id="count" value="14"/>
    </pattern>
    <pattern definition="LIBTEST2" type="additional">
      <property id="TESTPROPERTY [20140916]" value="22"/>
    </pattern>
    <pattern definition="LIBTEST1" type="additional">
      <property id="TESTPROPERTY [20140916]" value="12"/>
    </pattern>
  </entry_features>
</entry>
<entry accession="CLUSTERTEST003" confidence="" id="2" length="61" locus_tag="" type="mRNA" version="20140916" xmlfile="">
  <definition confidence="" id="product" ontology="">IPR002067:Mitochondrial carrier protein; IPR018108:;</definition>
  <entry_features accession="CLUSTERTEST003">
    <pattern definition="pool1" type="pool">
      <property id="count" value="0"/>
    </pattern>
    <pattern definition="pool2" type="pool">
      <property id="count" value="12"/>
    </pattern>
  </entry_features>
</entry>
</entry_db>

libraries_with_counts

Format

Show or HideShow perl code used to test libraries_with_counts format

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Content

Show or Hide Show perl code used to test libraries_with_counts content

return (1,"ok") if ($reference_data eq $new_data);return (0,$diff);#this is a default test provided by PlayMoby where we compare (strictly) Moby article contents. We use perl module String::Diff to compare http://bios.dijon.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml and http://bios.dijon.inra.fr/playmoby/services/BIOSGetXmlClusterExpression/test/BIOSGetXmlClusterExpression.xml.new Differences are reported as "[string in reference]{string in new result}"
ok

Raw

Show or Hide Show raw output data for libraries_with_counts

<?xml version="1.0"?>
<collection>
  <class count_nr="1206" count_raw="40" definition="" id="pool1" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="1206" count_raw="4348" definition="Test import BIOS DATA number 1" id="LIBTEST1" key="test_library1" tag="Taj" url=""/>
  </class>
  <class count_nr="3644" count_raw="36" definition="" id="pool2" key="">
    <library authority="bios.toulouse.inra.fr" count_nr="3644" count_raw="4263" definition="Test import BIOS DATA number 2" id="LIBTEST2" key="test_library2" tag="Tax" url=""/>
  </class>
</collection>